ID: 1111916300

View in Genome Browser
Species Human (GRCh38)
Location 13:94364338-94364360
Sequence TACCCCATGGGGCACCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111916300_1111916306 4 Left 1111916300 13:94364338-94364360 CCTGGTTGGTGCCCCATGGGGTA 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1111916306 13:94364365-94364387 GGATCTTTAAGGTAACCAGATGG 0: 1
1: 0
2: 0
3: 8
4: 88
1111916300_1111916305 -7 Left 1111916300 13:94364338-94364360 CCTGGTTGGTGCCCCATGGGGTA 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1111916305 13:94364354-94364376 TGGGGTAAATTGGATCTTTAAGG 0: 1
1: 0
2: 0
3: 15
4: 112
1111916300_1111916308 18 Left 1111916300 13:94364338-94364360 CCTGGTTGGTGCCCCATGGGGTA 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1111916308 13:94364379-94364401 ACCAGATGGCTCTCAGGAACAGG 0: 1
1: 0
2: 0
3: 10
4: 172
1111916300_1111916307 12 Left 1111916300 13:94364338-94364360 CCTGGTTGGTGCCCCATGGGGTA 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1111916307 13:94364373-94364395 AAGGTAACCAGATGGCTCTCAGG 0: 1
1: 1
2: 0
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111916300 Original CRISPR TACCCCATGGGGCACCAACC AGG (reversed) Intronic
900878905 1:5366432-5366454 AACCCCATGGGGCACGAAGTTGG + Intergenic
902449283 1:16486396-16486418 TGCCCCATGTGGCACCCACCAGG + Intergenic
903758178 1:25677899-25677921 TACCCCATGGCTGACCACCCAGG + Intronic
905970988 1:42142303-42142325 TCTCCCATTGGGCACAAACCCGG - Intergenic
906196191 1:43932072-43932094 AACTCCACGGGGCACCATCCAGG - Intergenic
908689076 1:66756863-66756885 TACCCCATGGGGAAGCAACATGG - Intronic
914936894 1:151989500-151989522 TACCCCAAAGGGCACTGACCAGG + Intronic
917792343 1:178507106-178507128 GTCCTCATGGGTCACCAACCAGG + Intergenic
921425922 1:215000968-215000990 TACCCCATAGGCCACCAGTCTGG - Intergenic
1069347533 10:67487599-67487621 TCCTCCATGGGGAACCACCCAGG - Intronic
1073757496 10:106596328-106596350 TACTCCATGGAGCACCAGCATGG + Intronic
1073822023 10:107274892-107274914 TACCCTTTGTGGCACCCACCTGG - Intergenic
1074232935 10:111555667-111555689 TACCCCTGGGGGCACAAAGCCGG - Intergenic
1077462555 11:2717883-2717905 TACCCCGGGGGGCTCAAACCTGG - Intronic
1078358870 11:10652974-10652996 TTCCCCATGGTGCAGCAGCCTGG + Intronic
1081826279 11:46056271-46056293 TACCCCATGGGACACCTGGCAGG + Intronic
1083607943 11:63990115-63990137 TACCCCACTGAGCACCAGCCTGG - Intronic
1100250127 12:92812283-92812305 TACACCATTGCGCTCCAACCTGG + Intronic
1100398758 12:94208772-94208794 CACCAGACGGGGCACCAACCTGG - Intronic
1106479260 13:30124380-30124402 TCCCCACTGGGGCACCACCCAGG + Intergenic
1107061726 13:36166595-36166617 TACCCCTTTGGGAACCAAACTGG + Intergenic
1108784392 13:53877764-53877786 TATTCCATGCGGCACCAACCAGG + Intergenic
1111670019 13:91319138-91319160 TGCTCCAGGCGGCACCAACCAGG + Intergenic
1111916300 13:94364338-94364360 TACCCCATGGGGCACCAACCAGG - Intronic
1114969255 14:28005358-28005380 TACCCTATGGGGCTGGAACCAGG + Intergenic
1119387617 14:74267639-74267661 TACCCTCTGGGGAACCAAGCTGG + Intergenic
1120709870 14:87781822-87781844 GACAACATGGGCCACCAACCTGG - Intergenic
1122693303 14:103541549-103541571 TACACCTGGGGGCACCAGCCAGG - Intergenic
1125348427 15:38742753-38742775 TTTCCCATGGGGCACCACACTGG - Intergenic
1135591159 16:23706080-23706102 TACTCCAAGTGGCCCCAACCGGG - Intronic
1145781747 17:27568172-27568194 TGCCCCATGGGGGTCCAACTAGG - Intronic
1149451010 17:56750081-56750103 ACCCCCATGAGGCACCAACTAGG + Intergenic
1151700591 17:75740649-75740671 TGCCCCGTGGGGCAGCATCCTGG - Intronic
1154237950 18:12623965-12623987 CACTCCAGGGCGCACCAACCTGG - Intronic
1156461641 18:37324611-37324633 TTCCCAATGGGGTACCAACCAGG - Intronic
1156536050 18:37865623-37865645 TATCCCATGGGACCCCAGCCAGG + Intergenic
1161587838 19:5115101-5115123 GACCCCATGGGCCGGCAACCAGG + Intronic
1163370812 19:16900234-16900256 TACCCCATGGCTCCCCACCCAGG + Intronic
1164614845 19:29660938-29660960 TTCCCCTTGAGGCTCCAACCAGG - Intergenic
1165002690 19:32778240-32778262 TACCCCACAGGACACCACCCAGG + Intronic
1168516318 19:57013046-57013068 AACTCCAGGGGGCACCATCCAGG + Intergenic
928336413 2:30402307-30402329 AACCCCAGAGGGTACCAACCAGG + Intergenic
930168028 2:48222445-48222467 TACCCCAGGGCACTCCAACCTGG + Intergenic
931942779 2:67271395-67271417 TACTCCTTGGGGCACCTAGCTGG - Intergenic
933694840 2:85210124-85210146 TTCCCCATGGGGCCTCACCCAGG - Intronic
933844260 2:86312721-86312743 TACCCCATGGGGCTACAGTCAGG + Intronic
941625147 2:167823119-167823141 CACCCCATGGGGCCCCCACCTGG - Intergenic
947749328 2:232524461-232524483 TACCCCATGGGGCAACAGGGTGG + Intronic
1169058399 20:2642338-2642360 TACACCATGGAGCACAAAACAGG + Intergenic
1176021961 20:62966624-62966646 TCCCCCATGGCTCACCCACCCGG - Intronic
1180079586 21:45480650-45480672 CAGCCCATGTGGCACCCACCAGG - Intronic
1181303779 22:21902430-21902452 TATCCCCTGGGGCACCACCCAGG + Intergenic
1182508719 22:30803480-30803502 TCCCCCCTGTGGCACCAGCCTGG - Intronic
1183447255 22:37865985-37866007 TACCCCATGTGGCATCTACCTGG - Intronic
1184276936 22:43414036-43414058 TAGCCCACGGGGCATCAGCCAGG - Intronic
1184286791 22:43476545-43476567 GTCACCATGAGGCACCAACCAGG - Intronic
1184287019 22:43477539-43477561 GCCACCATGTGGCACCAACCAGG - Intronic
1184916390 22:47571822-47571844 TACACCATGGGGCTCCAAGAAGG - Intergenic
1185360454 22:50403669-50403691 TACTCCATCGGGCCCCAGCCAGG + Intronic
954829281 3:53405148-53405170 TACACCATTGAGCTCCAACCTGG + Intergenic
958592046 3:96170684-96170706 TACCTGATGGGTAACCAACCAGG + Intergenic
959186812 3:103055716-103055738 TCCCCAATGGGGCTCCAATCAGG - Intergenic
960429126 3:117547320-117547342 GACCCAAAGGGGCAGCAACCAGG - Intergenic
969490643 4:7497511-7497533 TGCCCCGTGGGGGCCCAACCAGG + Intronic
970469614 4:16363856-16363878 AACCTCATGGGACACCTACCTGG - Intergenic
977613299 4:99059087-99059109 TACATCATGGCTCACCAACCAGG - Intronic
985881459 5:2641789-2641811 TACCCCCTGGACCACCCACCTGG + Intergenic
997447465 5:133952017-133952039 TGGCCCATGTGGCACCTACCTGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999860319 5:155638501-155638523 TGCCCCATGTGGCACTAACTTGG - Intergenic
1006145782 6:31958889-31958911 TACCCGAGGGGGCGGCAACCGGG + Exonic
1026663777 7:72324624-72324646 TACCCCATTGAGCTCCAGCCTGG - Intronic
1027188272 7:75984351-75984373 GACCCCACTGGTCACCAACCTGG + Intronic
1029349811 7:100005089-100005111 TGCCCCATTGCGCACCAGCCTGG + Intergenic
1031972641 7:128075428-128075450 TTCCCCATGGGGCAGCCATCTGG + Intronic
1033602541 7:142898619-142898641 TTCCCCAGGTGGCTCCAACCTGG + Intergenic
1034610889 7:152367348-152367370 CACCCCAGGGAGCACCTACCAGG + Intronic
1036142637 8:6222710-6222732 TACCCAATGGGGTACACACCAGG + Intergenic
1039678880 8:39706852-39706874 TACCCCCTGGGGAACCAAACTGG - Exonic
1042103385 8:65297985-65298007 TGCCCCATGGGGTAACAACATGG + Intergenic
1044135808 8:88584437-88584459 AACCTCATGGGGCATCAACCTGG + Intergenic
1046391737 8:113581881-113581903 TACACCATGTTGCACAAACCTGG - Intergenic
1047108416 8:121760711-121760733 TACACCATGGGACTCCAGCCTGG + Intergenic
1053302127 9:36959791-36959813 TACCCCAATGGCCACCAGCCTGG + Intronic
1059227958 9:112690633-112690655 TACCCCCTGGGGCATGAGCCTGG - Intronic
1060986113 9:127819843-127819865 CACCTGAGGGGGCACCAACCAGG + Intronic
1186937534 X:14466914-14466936 TTCCCCATGTGGAACCATCCTGG - Intergenic
1189374735 X:40458169-40458191 TATCCCTTGGGCCTCCAACCAGG - Intergenic
1190036303 X:47028295-47028317 TACCCCATGGGGCTAAACCCAGG + Intronic