ID: 1111918673

View in Genome Browser
Species Human (GRCh38)
Location 13:94388003-94388025
Sequence ATGCAGTTATTGTTGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111918670_1111918673 16 Left 1111918670 13:94387964-94387986 CCTGAGTGAGATTCAGCATTTCT 0: 1
1: 0
2: 3
3: 18
4: 219
Right 1111918673 13:94388003-94388025 ATGCAGTTATTGTTGATCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111918673 Original CRISPR ATGCAGTTATTGTTGATCCA GGG Intronic
900857827 1:5200208-5200230 ATGCTGGTATTGTTGATCCTTGG + Intergenic
900936329 1:5768537-5768559 ATGCAGGTGCTGTTGGTCCAAGG - Intergenic
909932873 1:81518014-81518036 ATGCATTTATTGGTTATCTAAGG - Intronic
910681114 1:89866043-89866065 ATGCAGGTATTGTAGAGCAAAGG - Intronic
911926795 1:103842879-103842901 ATGTATTTATTTTTGATACAGGG - Intergenic
916815434 1:168347515-168347537 ATGCTTTTATTGTAGATGCAGGG + Intergenic
924738099 1:246777284-246777306 ATGCCCTTATTGTTGACCTATGG - Intergenic
1063408429 10:5817811-5817833 ATTCAGTCCTTGTTGATCTAGGG - Intronic
1063602901 10:7498089-7498111 AAGCAGTGATTTTTGCTCCATGG + Intergenic
1066419738 10:35253733-35253755 ATTCAGTTGTTGTTTATTCAAGG - Intronic
1067957569 10:50809168-50809190 CTGAAGGCATTGTTGATCCACGG + Intronic
1074218482 10:111411277-111411299 ATGCAGATTTTGTTGCTCCTGGG + Intergenic
1074426634 10:113357267-113357289 AGCCAGTTATTGAAGATCCAGGG + Intergenic
1074952348 10:118350245-118350267 ATGCATTTTTTGTTGTTGCATGG + Intergenic
1075699537 10:124460325-124460347 ATGCAGTTTTTAGTGTTCCAGGG - Intergenic
1076087273 10:127644886-127644908 ATACAGTTTTTTTTAATCCATGG - Intergenic
1079505135 11:21144782-21144804 ATGCTGTAATTGGAGATCCAGGG + Intronic
1084393770 11:68895675-68895697 ATGCAGTTTTTTTTGAGACAGGG + Intronic
1085058309 11:73421336-73421358 GTGCTGTTTTTGTTGAACCAAGG + Intronic
1086372043 11:86164709-86164731 ATGCAATGAGTGCTGATCCACGG + Intergenic
1089188948 11:116640656-116640678 ATCCAGTTCTTGTTGATCCAGGG + Intergenic
1093987578 12:25553926-25553948 AAGCAGGTATTGTTTATTCATGG - Intronic
1094469092 12:30786182-30786204 ATGCAGATAATGTGGGTCCAGGG + Intergenic
1096821323 12:54237477-54237499 AACCAGTTATTGATGATTCATGG + Exonic
1098587597 12:72172299-72172321 ATGCAGTAATTCTTGAATCAAGG - Intronic
1098701400 12:73632402-73632424 ATGCTGTTGTTGCTGGTCCAGGG - Intergenic
1098990249 12:77058016-77058038 ATGCAGCTTCTGCTGATCCAAGG - Intronic
1099127801 12:78787691-78787713 ATGTAGTTATTATTGCCCCATGG + Intergenic
1105539655 13:21304556-21304578 TTCCAGATATTTTTGATCCAAGG - Intergenic
1107088767 13:36453258-36453280 ATGCTGATGTTGCTGATCCATGG - Intergenic
1108556874 13:51602063-51602085 ATGCATTTATTGTTGGAACAGGG + Intronic
1109342788 13:61082984-61083006 ATGCAATGATAGTGGATCCATGG + Intergenic
1109520334 13:63502088-63502110 ATGCAGTTATTGATAAACCCTGG + Intergenic
1111761041 13:92464602-92464624 ATGCAGGTATTCTTGAGTCAAGG - Intronic
1111918673 13:94388003-94388025 ATGCAGTTATTGTTGATCCAGGG + Intronic
1113706380 13:112435873-112435895 ATGCAGTTATTTCTGATGCCCGG + Intergenic
1115764102 14:36605017-36605039 TTGCAGTTCTTCTTGACCCAAGG - Intergenic
1116638383 14:47427903-47427925 ATGCAGTTAGTCTAGATCTATGG + Intronic
1116819048 14:49610182-49610204 ATGCAGTTAGTGTTCAGACAAGG - Intronic
1120136227 14:80873256-80873278 ATGGAGTCATTCTTGATGCATGG + Intronic
1121060382 14:90902593-90902615 ATGCATTTATTTTTGATATAAGG - Intronic
1123160060 14:106269409-106269431 ATGCAGTTTATGTAGATCTATGG - Intergenic
1124687492 15:31794814-31794836 ATACAGTTATTGTTTCTCCTGGG + Intronic
1125080006 15:35661139-35661161 AGGCAGTTTTTGTTGACCAAGGG + Intergenic
1127256173 15:57295857-57295879 ATGCAGTTGTTTTTCTTCCAAGG - Intronic
1130034843 15:80349375-80349397 ATGGAGTTATTTTCCATCCAAGG + Intronic
1131573891 15:93567018-93567040 ATACAGTGCTTGTTAATCCAGGG + Intergenic
1135126364 16:19813053-19813075 ATGCTGATATTTCTGATCCATGG + Intronic
1135688987 16:24521204-24521226 ACGCAGGTATGGATGATCCAAGG - Intergenic
1135853401 16:25984828-25984850 CTGCAGTGGTTCTTGATCCAAGG + Intronic
1140742969 16:77957912-77957934 ATGCATTTATTTTTGAGACAGGG + Intronic
1143925470 17:10365526-10365548 ATGCAGATGCTGCTGATCCAGGG + Intronic
1144138078 17:12318409-12318431 ATGCTGATATTGCTGGTCCAAGG - Intergenic
1147997109 17:44366250-44366272 ATGCTGTTACTGTTGGCCCAGGG + Intergenic
1149218008 17:54380896-54380918 ATGCAGTAATTTTTGTTTCATGG - Intergenic
1150365824 17:64583255-64583277 ATGCTGTCATTGTAGCTCCAGGG - Intronic
1151030130 17:70727974-70727996 ATGCAGTCATTGGTTCTCCACGG - Intergenic
1151604288 17:75126502-75126524 ATGCAGTGATTGTAGATTAATGG - Intronic
1151721530 17:75859308-75859330 ATGTATTTATTTTTGATACAGGG + Intergenic
1152843164 17:82583153-82583175 ACGCAGTGATTGTTGCTTCATGG + Intronic
1156123389 18:33873034-33873056 ATGCAGTTATTATATATCCAAGG - Intronic
1158670311 18:59468376-59468398 ATGCATTTATTTTTGAGACAGGG - Intronic
1159729158 18:72003416-72003438 TTGTAGTTTTTGTTGATCAAAGG + Intergenic
1167752280 19:51388302-51388324 ATGCGTTTATTGTTCAACCAGGG + Exonic
925115389 2:1374216-1374238 ATGCAATGATTGTTGCTACAAGG + Intronic
927009251 2:18885474-18885496 ATGCTGTTATTTTTGATCTTCGG - Intergenic
929123080 2:38499448-38499470 ATGCTGATGTTGTTGGTCCAGGG - Intergenic
930527942 2:52554750-52554772 ATGCTGATATTGCTGGTCCAGGG - Intergenic
931903440 2:66817591-66817613 ATTCTGTTTTTGTGGATCCAAGG + Intergenic
931919348 2:66996224-66996246 ATGCACTATTTGTTGAACCATGG - Intergenic
933654659 2:84877804-84877826 GTGCAGTTATTGCAGGTCCAGGG - Intronic
935517764 2:104064255-104064277 ATGCATTCATGGTTTATCCACGG - Intergenic
935847692 2:107184706-107184728 ATCCTGTTATTGGTGATACAGGG - Intergenic
936375797 2:111940335-111940357 AGGCAATTATTGCTGATGCAAGG - Intronic
938923920 2:136021488-136021510 ATGCTGTTGCTGCTGATCCACGG + Intergenic
939079943 2:137647650-137647672 ATCCAGTTCTTATTGATCAATGG - Intronic
939775293 2:146379418-146379440 ATGCAGTCATTGTTTATTGAAGG + Intergenic
940606418 2:155928861-155928883 ATCCACTTATTGGTGCTCCAGGG - Intergenic
940900770 2:159124436-159124458 ATGCTGTTGCTGTTGGTCCAGGG + Intronic
941633994 2:167915623-167915645 ATGCAGTTACTGCTAGTCCAAGG - Intergenic
944101829 2:196035995-196036017 ATGCAGGTACTGTTGTACCAAGG - Intronic
944413976 2:199465595-199465617 TTGCAGTTATTGTTCATGAAAGG - Intronic
948749290 2:240121527-240121549 ATGCTTTTATTGTTGATTTATGG + Intergenic
1173026219 20:39309926-39309948 ATACGTTTATTATTGATCCAGGG + Intergenic
1173279512 20:41616611-41616633 TTGGAGTTATTTTTGTTCCAGGG - Intronic
1175488845 20:59365110-59365132 ATGCAGTTATTCTGGGGCCATGG + Intergenic
1182408194 22:30156601-30156623 ATACAATTAATTTTGATCCAAGG - Intronic
1182445872 22:30389137-30389159 ATGCATTTATTTTTGAGACAGGG + Intronic
949592440 3:5508587-5508609 ATGCTGTTATGGTAGATTCAGGG + Intergenic
951685307 3:25337270-25337292 TTTAAATTATTGTTGATCCATGG - Intronic
953221151 3:40972926-40972948 ATGCAGTTGGTGTTTCTCCAAGG - Intergenic
953843819 3:46410917-46410939 ATGCAGATACTGCTGACCCAAGG + Intronic
955024914 3:55158259-55158281 AAGAGGTTATTGTTGATCTAAGG - Intergenic
955250964 3:57281779-57281801 ATACAGTTATTCTAGACCCAGGG + Intronic
956039108 3:65127653-65127675 ATGCAATTTTGGTTGCTCCAAGG - Intergenic
956594958 3:70957430-70957452 ATCCTCTTATTGTTGATCAAAGG - Intronic
959797375 3:110446325-110446347 ATGCAGTTATTGCTTAAGCACGG - Intergenic
962113276 3:132472771-132472793 TTGCATTTATTGTTGTCCCAAGG + Intronic
963218882 3:142783580-142783602 TTCCAAATATTGTTGATCCATGG + Intronic
963828817 3:149985193-149985215 ATACAGGTATTGTAGATACATGG + Intronic
964829579 3:160868873-160868895 ATACAAATATTGTTGATTCATGG + Intronic
971073598 4:23123507-23123529 ATGCAGAGATTGTTAATACATGG - Intergenic
972400742 4:38701137-38701159 GGGCAGTTATTGTTGATGGAGGG + Intergenic
973697347 4:53503595-53503617 ATCCAGTCTTTGTTGTTCCATGG + Intronic
975931293 4:79526377-79526399 ATGCAGCTCTTGTTTATTCATGG + Intergenic
976945384 4:90759554-90759576 ATGTTGTTATTGTTGCACCATGG + Intronic
981450407 4:144890528-144890550 ATGCTAATATTGTTGGTCCAGGG + Intergenic
987839034 5:23198929-23198951 CTGCAGAGATTTTTGATCCAGGG - Intergenic
988067999 5:26247246-26247268 TTCCATTTATTGTTGATCTAAGG + Intergenic
990349010 5:54897305-54897327 ATGCAAATAGTATTGATCCAGGG + Intergenic
992622111 5:78604068-78604090 ATGCAGTTAGTGCAGATACATGG + Intronic
994614564 5:102087804-102087826 ATGCAGTAGTTGTGTATCCAGGG + Intergenic
996206569 5:120745247-120745269 ATGAAATTATTGTTTATGCATGG + Intergenic
998464550 5:142333049-142333071 ATGCAGATTTTGTTAATCAAAGG + Intergenic
999117452 5:149176229-149176251 AAGCAGTGATTGCTGCTCCAGGG - Intronic
999606390 5:153321526-153321548 GTGAAGTTATGGTTCATCCAGGG - Intergenic
1001080164 5:168661669-168661691 ATGCAGTCATCTTTGTTCCAGGG + Intergenic
1001155537 5:169269535-169269557 CTGCAGTTCATTTTGATCCATGG - Intronic
1001291949 5:170469989-170470011 ATGCCGTTATTCTTGATTGAGGG + Intronic
1003781991 6:9439606-9439628 ATGCAAATATTGTTGGTCCAGGG + Intergenic
1005182290 6:23119575-23119597 CTGCAAATATTTTTGATCCATGG + Intergenic
1009449530 6:63785060-63785082 ATGCTGATATTGCTGACCCAGGG + Intronic
1012183745 6:96187940-96187962 ATGCATTAATTGCTGATCCAAGG - Intronic
1015089901 6:129343499-129343521 ATGGTCTTATTGTTCATCCAGGG + Intronic
1016221751 6:141681139-141681161 ATACATATATTTTTGATCCATGG + Intergenic
1016534443 6:145094754-145094776 ATGCAGTCATTGCTAACCCATGG + Intergenic
1016578098 6:145594075-145594097 ATGTTGTTATTACTGATCCATGG + Intronic
1017175847 6:151503978-151504000 ATGCATTTATTGTTTCTCTAAGG + Intronic
1018322378 6:162625247-162625269 CTGCAGTGATAATTGATCCAGGG - Intronic
1020712206 7:11621790-11621812 ATGCAGTAATTTTTTCTCCAAGG + Intronic
1022802810 7:33792275-33792297 ATGCAGCTATTGGGCATCCATGG - Intergenic
1023125646 7:36951636-36951658 ATGCTGTTGGTGTTGGTCCAAGG + Intronic
1025835329 7:65087879-65087901 ATGGAGTTATTGTTCATCATGGG + Intergenic
1025905105 7:65777352-65777374 ATGGAGTTATTGTTCATCATGGG + Intergenic
1028205780 7:88015011-88015033 ATGCAGTGATCATTGATACAGGG + Intronic
1028255367 7:88589465-88589487 ATGCTGATGTTGTTGATCCAGGG - Intergenic
1029462599 7:100705159-100705181 ATGCATTTATTTTTGAGACAGGG - Intergenic
1031027683 7:116697988-116698010 ATGTGGTTTTTGTAGATCCAGGG + Intronic
1032990198 7:137386012-137386034 ATGCACTTATGATTGATTCATGG + Intronic
1034833749 7:154332492-154332514 ATGCAGTTGATGTTGGTCCATGG + Intronic
1039292969 8:36118319-36118341 TTGAAATTATTTTTGATCCATGG + Intergenic
1040455927 8:47597686-47597708 ATGCAGTTCTTTTTATTCCAAGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041682538 8:60607714-60607736 ATGTAGATACTGCTGATCCAGGG + Intronic
1042744392 8:72091395-72091417 TTGCAGTTATTGTAGCTACATGG - Intronic
1043145907 8:76654225-76654247 AAGCATTTATTTTTGAGCCATGG - Intergenic
1044098646 8:88101661-88101683 ATGGAGCTATTGTTAAACCAAGG - Intronic
1046285514 8:112088251-112088273 ATGCAGTTATTGTTTATTATTGG + Intergenic
1051804862 9:20981217-20981239 CTGCAGTTACTTCTGATCCAGGG - Intronic
1055301676 9:74889128-74889150 TTGCTGTTGTTGTTGAGCCAGGG + Intergenic
1056817919 9:89815153-89815175 ATGCTGATATTCCTGATCCAGGG - Intergenic
1057851418 9:98569529-98569551 ATGCAGTTGTTTTTTCTCCAAGG - Intronic
1186387032 X:9120492-9120514 ATGCATTTATTATTGTTACATGG - Intronic
1187680619 X:21764019-21764041 CTGCAGTTATAATTGATTCAAGG - Intergenic
1188215427 X:27470784-27470806 ATGCAGTTATTGTTCTTAAAAGG - Intergenic
1188974653 X:36658675-36658697 ATACAGTTCTTGCTGAACCAAGG - Intergenic
1190459701 X:50660323-50660345 ATGCAGATGCTGCTGATCCAAGG + Intronic
1190689511 X:52901695-52901717 ATGCAGAGATTTTTGATACAAGG + Intronic
1190696472 X:52954097-52954119 ATGCAGAGATTTTTGATACAAGG - Intronic
1191054320 X:56226850-56226872 ATCCTGTTATTGTGGCTCCAGGG + Intergenic
1194074361 X:89370035-89370057 ATGCAGTCATTGTCAACCCATGG - Intergenic
1200729753 Y:6721562-6721584 ATGCAGTCATTGTCAACCCATGG - Intergenic