ID: 1111919417

View in Genome Browser
Species Human (GRCh38)
Location 13:94394831-94394853
Sequence CAGTAGGCACAGTTAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111919417 Original CRISPR CAGTAGGCACAGTTAGAGGC TGG Intronic
901152488 1:7113192-7113214 CAGAAGCCACAGACAGAGGCTGG + Intronic
901350546 1:8591925-8591947 TAGTAGGCACCTTTAGAGGAAGG - Intronic
901572202 1:10170089-10170111 CAGCAGGCACAGGCACAGGCTGG - Intronic
902949271 1:19869058-19869080 CAGCAGTCACAGTGAGATGCAGG + Intergenic
905773451 1:40653282-40653304 TAGTACCCACAGTTAGAGGTAGG + Intronic
905881029 1:41463871-41463893 AAGTGGGGACAGTCAGAGGCAGG + Intergenic
906185773 1:43860828-43860850 AATTAGGCCCAGTTACAGGCTGG - Intronic
906212454 1:44019756-44019778 TATTAGGCAAAGTCAGAGGCGGG - Intronic
906399490 1:45494658-45494680 CAGAAGGTACAGCTATAGGCTGG + Intronic
907412782 1:54294350-54294372 CAGAAGGAACAGTTTGTGGCAGG - Intronic
908494044 1:64676982-64677004 CAGCAGGTGCAGTCAGAGGCTGG + Exonic
909402377 1:75248563-75248585 CAGGAAGCAAAGTTAGAAGCTGG + Intronic
911049187 1:93655098-93655120 CAGCAGGAACAGTAAGGGGCTGG + Intronic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
913587418 1:120289388-120289410 GAGTAGGCACAGAGCGAGGCTGG + Intergenic
913620767 1:120608981-120609003 GAGTAGGCACAGAGCGAGGCTGG - Intergenic
916329552 1:163599462-163599484 CAGTAGGCACCTTGAAAGGCTGG - Intergenic
918405246 1:184205860-184205882 AAGAGGGCACAGTCAGAGGCAGG + Intergenic
919075365 1:192807290-192807312 CAGGAGACCCAGTTAGAGCCTGG - Intergenic
920267728 1:204736877-204736899 CTCTAGGCACAGGAAGAGGCAGG + Intergenic
924589885 1:245393814-245393836 CACTAGGTTCAGTTAGAAGCAGG - Intronic
1063020086 10:2118427-2118449 CAGTGTGCACAGGCAGAGGCAGG - Intergenic
1065662262 10:28018247-28018269 CAGTAAGCAAGTTTAGAGGCAGG - Intergenic
1066259932 10:33719672-33719694 AAGTCAGCACAGTTAGATGCAGG - Intergenic
1067574505 10:47400726-47400748 CAGTATGCAGATTTAGATGCAGG + Intergenic
1067989733 10:51198124-51198146 CAGTAGTCACAGTTTTGGGCAGG + Intronic
1075228726 10:120652705-120652727 GAGTTGGCACAGTTAGTGGTAGG - Intergenic
1075349202 10:121708844-121708866 CAGAAGGCACAGTGAGAAGCGGG + Intergenic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1082919961 11:58482348-58482370 CAGTAGACACCTTGAGAGGCTGG - Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1084419502 11:69053267-69053289 CAGAAGGCACCGGCAGAGGCTGG + Intronic
1084731722 11:71077966-71077988 CAGTAGGCAGAGTTAGGGATGGG - Intronic
1091220594 11:133927960-133927982 CAGTGCACAGAGTTAGAGGCAGG + Intronic
1092585692 12:9899081-9899103 CAGTTTGCACAGGGAGAGGCAGG + Intronic
1094762263 12:33547694-33547716 CATGTGGCACAGTAAGAGGCTGG - Intergenic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1095371001 12:41467183-41467205 CAGTAGACACAGTGAGAGTTTGG + Intronic
1099075684 12:78104479-78104501 CTGGATTCACAGTTAGAGGCAGG - Intronic
1102014604 12:109639524-109639546 CAATAGGCAGAGTTAGTTGCGGG + Intergenic
1102361022 12:112287683-112287705 CAGTAGGTAGAGGCAGAGGCAGG + Intronic
1104364301 12:128163195-128163217 CAGTAGTCACAGGAAGAGGGGGG - Intergenic
1105707588 13:22977608-22977630 CAGTGGGCACAGTGAAAAGCTGG + Intergenic
1111919417 13:94394831-94394853 CAGTAGGCACAGTTAGAGGCTGG + Intronic
1113302431 13:109036852-109036874 AAGTAGCCAAAGATAGAGGCTGG - Intronic
1116199038 14:41767588-41767610 TAGTATGCACATTTAAAGGCTGG - Intronic
1121339170 14:93094741-93094763 CTGCAGGCACAGGGAGAGGCAGG + Intronic
1122144246 14:99679744-99679766 CAGAAAGCTCAGTTCGAGGCTGG + Exonic
1122693297 14:103541529-103541551 AGGCAGGCACAGTCAGAGGCAGG - Intergenic
1125758480 15:42081757-42081779 CTGTGGGGACAGTGAGAGGCGGG - Intronic
1126376086 15:47997967-47997989 CGCCAGGCACAGTTAGAGACAGG - Intergenic
1127550518 15:60033249-60033271 CAGTGCTCTCAGTTAGAGGCTGG + Intronic
1127717583 15:61664625-61664647 CAGTGGTCACTCTTAGAGGCTGG - Intergenic
1127944449 15:63736285-63736307 TAATAGGCACAGTTGAAGGCAGG + Intronic
1132958286 16:2608210-2608232 CAGTGAGCCCAGATAGAGGCGGG - Intergenic
1133165911 16:3947085-3947107 CGGTGGCCACAGTTAGAGGTGGG - Intergenic
1135464623 16:22674731-22674753 CAGTAGGGATAGTAAGAGGAGGG + Intergenic
1137447121 16:48538668-48538690 CAGCAGGACCAGTAAGAGGCCGG - Intergenic
1137917399 16:52447509-52447531 CAGTAGGCTCACCTAGAGGTAGG - Intronic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1140280521 16:73550410-73550432 CAGTAGGCCCAGTGTGAGGCTGG + Intergenic
1141543066 16:84741709-84741731 CAGTTTGCACAGTTAGTGACAGG + Intronic
1142111625 16:88335045-88335067 CACTGGGCACAGGAAGAGGCAGG + Intergenic
1142199803 16:88755736-88755758 CAGAAGGCACCATGAGAGGCCGG + Intronic
1144375831 17:14640154-14640176 GTGGAAGCACAGTTAGAGGCAGG + Intergenic
1145935837 17:28714309-28714331 CATAAGGCACAGTGAGAGGCTGG + Exonic
1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG + Exonic
1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG + Intergenic
1149080632 17:52652225-52652247 CAGTAGGTACAGTTTAAGGAGGG + Intergenic
1150180325 17:63112375-63112397 CAGTAGGCAAAGTTCCAGGGAGG + Intronic
1152162129 17:78675385-78675407 CAGACGGCACAGTCAGAGTCGGG - Exonic
1153839313 18:8991666-8991688 CAGAAGGCACAGTTCCAGGGTGG - Intergenic
1160210443 18:76873927-76873949 CAGGAGGCACAGTGAGAGTGTGG - Intronic
1160210473 18:76874069-76874091 CAGGAGGCACAGTGAGAGTGTGG - Intronic
1160210490 18:76874141-76874163 CAGGAGGCACAGTGAGAGTGTGG - Intronic
1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG + Exonic
1161467988 19:4442782-4442804 CAGTGGGGACAGGCAGAGGCTGG - Intronic
1162141554 19:8588496-8588518 CCGTAGGCACTGTCAGAGGGAGG - Intronic
1163612704 19:18309473-18309495 CAGGAGGCGCAGTGAGAGGAGGG + Intronic
1163780263 19:19243107-19243129 GAGTAGGCAAATTTAGAGACAGG + Intronic
1166439236 19:42796732-42796754 CAAAAGGCACAGCCAGAGGCTGG - Intronic
1167304419 19:48698908-48698930 CAGAAGACACAGAGAGAGGCAGG - Intronic
1167391508 19:49198076-49198098 CAGTAGACACGCTGAGAGGCAGG + Intronic
926283357 2:11468001-11468023 TAGTAGGCAGTGGTAGAGGCAGG + Intergenic
926940974 2:18136425-18136447 GAAGAGGCACAGTTAGAGGCAGG + Intronic
927882659 2:26699625-26699647 CAGTGGTCTCAGTTAGAGTCTGG - Intronic
931127284 2:59292216-59292238 GAGTAGTGACAGTTAGAGACTGG + Intergenic
933616991 2:84492247-84492269 CAGTAGGCACATTTGAAGGTGGG - Intergenic
935508416 2:103937758-103937780 CAGCAGGCACAGATAGATTCAGG + Intergenic
938950350 2:136249395-136249417 CTGTGGGCACAGGGAGAGGCAGG + Intergenic
943654099 2:190489011-190489033 GAGTGTGCACAGTTACAGGCTGG - Intronic
945097666 2:206234896-206234918 CAGGAGGCAGAGGCAGAGGCAGG - Intergenic
948006991 2:234617719-234617741 CATTAGGTACTGTTAGAGACAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169726575 20:8740378-8740400 CAGCAGGCAGCGTCAGAGGCTGG - Exonic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1173081272 20:39870285-39870307 CAGCAGGCACAGTGAGGGGGTGG + Intergenic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1174682795 20:52424322-52424344 AAGTAGGCACAGGTAGGCGCAGG - Intergenic
1176191631 20:63813571-63813593 CAGTAGAACCAGGTAGAGGCGGG - Intronic
1178941939 21:36913798-36913820 AAGTAGGCACAGCTAGTGGGTGG - Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181014417 22:20061056-20061078 CAGTGGGCACAGGTGTAGGCTGG - Intronic
1181974552 22:26719711-26719733 CTGTAGTCCCAGTTACAGGCTGG + Intergenic
1181985905 22:26799713-26799735 CGGTGGGCACAGATAAAGGCTGG + Intergenic
1182118612 22:27772933-27772955 CACTAGGCCCAGTTTGAGGCTGG + Intronic
950212645 3:11135438-11135460 CAGGAGGCAAAGGCAGAGGCAGG - Intergenic
950767931 3:15287537-15287559 CAGTAGCCACACGTGGAGGCTGG - Intronic
953236418 3:41111383-41111405 CTGTAGGACCAGGTAGAGGCTGG + Intergenic
954971155 3:54652723-54652745 CAGTGGGCACAGTGAGATGTTGG + Intronic
957314565 3:78560759-78560781 CAGAAGGCAAAGATAGAGTCAGG + Intergenic
961441288 3:126954801-126954823 CAGAAGACACAGCAAGAGGCTGG + Intronic
963854167 3:150237218-150237240 CACTAGGCACAGTAAGAGATTGG - Intergenic
964640111 3:158900196-158900218 CAGTTGCCACAGTTAGACCCTGG + Intergenic
966945664 3:184775539-184775561 CAGTGGGCAGAGCCAGAGGCAGG - Intergenic
969574743 4:8030315-8030337 CAGCAGGCAGAGTGGGAGGCAGG + Intronic
976421660 4:84851890-84851912 AATTAGGCACAGTAAGAGACTGG + Intronic
978466622 4:109015974-109015996 CAGCAGGGACAGGAAGAGGCAGG + Intronic
979667386 4:123327345-123327367 TAGGAGGCACTGTTTGAGGCTGG - Intergenic
980824456 4:138057029-138057051 CAGCTGGGACAGATAGAGGCAGG + Intergenic
981531039 4:145753939-145753961 GAGTTGGCACATTAAGAGGCAGG - Intronic
986251773 5:6066166-6066188 CAGGAGGAACAGTGACAGGCAGG + Intergenic
994505821 5:100641834-100641856 CAGTTTGCACAGGGAGAGGCAGG - Intergenic
996496328 5:124161349-124161371 CGGTAGGCACAGGTAGATGGGGG + Intergenic
997223151 5:132187066-132187088 CAGTAGGCACCGTTGGAGCTGGG - Intergenic
999246452 5:150157554-150157576 CAGGTGACACAGGTAGAGGCTGG + Intergenic
999665298 5:153906441-153906463 CAGTAGGCCCAGGCAGAGGTGGG - Intergenic
1000368700 5:160514844-160514866 AAGTGGGAACAGGTAGAGGCAGG - Intergenic
1000527149 5:162371452-162371474 GAGTTGGCACAGTTGGAGGTAGG + Intergenic
1002477014 5:179472787-179472809 CCATAGGCACAGGCAGAGGCCGG - Intergenic
1003455067 6:6274691-6274713 CAGTAGTCCCAGGAAGAGGCTGG - Intronic
1007323166 6:41041453-41041475 CAGGAGGCACTGGGAGAGGCAGG + Intronic
1007524593 6:42480730-42480752 CAGGAAGCACAGTGAGAGGCTGG - Intergenic
1009870499 6:69447136-69447158 AAGTAGTCACAGACAGAGGCAGG + Intergenic
1010233412 6:73555192-73555214 CAGTAACAAGAGTTAGAGGCAGG + Intergenic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1010806670 6:80245410-80245432 AAGTAGACAAAGTGAGAGGCTGG + Intronic
1013166942 6:107603252-107603274 CAGAAGGCACACTGGGAGGCAGG - Intronic
1017179836 6:151540857-151540879 CAGGGGGCACAGTCAGAGGCAGG - Intronic
1021041370 7:15866046-15866068 AAGGAGGCAAGGTTAGAGGCAGG + Intergenic
1023059296 7:36313182-36313204 GAGTAGGAACAGGTAGAGGAGGG + Intergenic
1023431293 7:40094191-40094213 CAGGAGGCAGAATTCGAGGCCGG - Exonic
1029032049 7:97478852-97478874 CAGTGGGCAAGATTAGAGGCAGG + Intergenic
1030396894 7:108997045-108997067 CAGAAGGCACATTGAGAAGCCGG - Intergenic
1031162563 7:118185369-118185391 CAGGAGGCAGAGGCAGAGGCAGG - Intronic
1033171241 7:139086404-139086426 CAGTACCCACAATTAGAGGGTGG - Intronic
1033641952 7:143269702-143269724 CAATGGGCACAGCTAGAGGCAGG - Intronic
1035485665 7:159223213-159223235 CAGTAGGCACAGTTAGGGCAGGG + Intergenic
1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG + Intergenic
1039756364 8:40527427-40527449 CAGTAGGTTCAGTGAGAGGTAGG - Intergenic
1043514069 8:80979950-80979972 CAGTAAGTACAGTTCCAGGCAGG - Intronic
1047495461 8:125405641-125405663 CAGTAGCCAGACTTGGAGGCAGG - Intergenic
1047539849 8:125754188-125754210 CAGTAGCCAGAGGAAGAGGCAGG - Intergenic
1047547294 8:125831101-125831123 AAGTAGGCACAGTGAGTTGCAGG - Intergenic
1051339028 9:16094063-16094085 CAGGAGGCATAGTAAGAGGTTGG + Intergenic
1051535644 9:18154414-18154436 CCGTAGGCACAGCTAGAGGCTGG + Intergenic
1052355800 9:27503726-27503748 CAGTTGGGAGTGTTAGAGGCTGG + Intronic
1053784162 9:41641270-41641292 CAGAAGAGGCAGTTAGAGGCTGG + Intergenic
1059970715 9:119665523-119665545 CAGATGGTAAAGTTAGAGGCTGG - Intergenic
1060039383 9:120286701-120286723 CACTAGGCACGGTTACAAGCTGG - Intergenic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061918497 9:133769560-133769582 CGGTGGGCACAGCTACAGGCCGG + Intronic
1062118466 9:134821621-134821643 CAGAAAGCACATTTACAGGCAGG + Intronic
1062478851 9:136742360-136742382 CAGCAGGCAGAGTTGGGGGCCGG - Intronic
1062582731 9:137235644-137235666 CAGGAGGCACAGGCAGAGCCAGG + Intronic
1186966237 X:14789011-14789033 CAGTATGTACATTTAGAGTCAGG + Intergenic
1187813161 X:23202815-23202837 CAGGAGGGACAGATAGAGGCAGG + Intergenic
1189412274 X:40783134-40783156 CAGAAGGCACAGAGAGATGCAGG - Intergenic
1189682293 X:43529225-43529247 GAGTAGGCAGAGGGAGAGGCTGG - Intergenic
1192658028 X:73012905-73012927 GAGTAGACATAGTTAGAAGCTGG - Intergenic
1197316403 X:124971333-124971355 CAGTAGTCACTCTTACAGGCTGG - Intergenic
1198481702 X:137047189-137047211 CAGTAGGCAGAGGAAGAGGGGGG + Intergenic