ID: 1111924095

View in Genome Browser
Species Human (GRCh38)
Location 13:94444636-94444658
Sequence GCTCCTTGAACTTACCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111924095_1111924099 10 Left 1111924095 13:94444636-94444658 CCTGGATGGTAAGTTCAAGGAGC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1111924099 13:94444669-94444691 TGTCCTTTTTTCATTCCCCCTGG 0: 1
1: 0
2: 0
3: 36
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111924095 Original CRISPR GCTCCTTGAACTTACCATCC AGG (reversed) Intronic
901810482 1:11764488-11764510 GCTCCTGTAACTGCCCATCCAGG - Intronic
901837982 1:11936423-11936445 CCTCCTTCAGCTTACCCTCCTGG + Intronic
902808540 1:18875446-18875468 TCTCCTTGTACTTGTCATCCGGG + Exonic
903808092 1:26019706-26019728 CCTCCTGGAACTTACCCTCCAGG - Intergenic
903969462 1:27109438-27109460 GCTCCGTGAACCTACGAGCCTGG + Intronic
905887797 1:41501068-41501090 TCTCTTGGAATTTACCATCCTGG - Intergenic
906188125 1:43877249-43877271 GCTCCTGGAATTTCCCATGCAGG - Intronic
908429187 1:64039225-64039247 GCTCCTTGAAGTTTACATTCTGG + Intronic
911786106 1:101950202-101950224 GTTCCTTGAACTCACCAACATGG + Intronic
912746512 1:112249759-112249781 GTTCTTTGAACTTACCATGTAGG + Intergenic
916492405 1:165313595-165313617 GCTCCCTGAAGTTTCCAGCCTGG - Intronic
917876742 1:179293385-179293407 GCAGTTTGAACTGACCATCCAGG - Intergenic
919355325 1:196515713-196515735 GCACCTTGAACTAAACATCCAGG + Intronic
920123507 1:203675984-203676006 GCCCCTAGAACTTAGCCTCCTGG - Intronic
923897429 1:238287239-238287261 GTTCCCTGAACTTAGCATGCAGG + Intergenic
1065481984 10:26204646-26204668 GCTCCATGAACTTATCATCTAGG - Intronic
1066754707 10:38699739-38699761 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
1068419390 10:56770691-56770713 CCACCTGGAACTTACCAACCAGG + Intergenic
1068607458 10:59021535-59021557 GCTTCTTGAGCATACCTTCCTGG + Intergenic
1068783858 10:60948613-60948635 ACTCCTGGAACTCATCATCCAGG - Intronic
1069581681 10:69570977-69570999 ACTCCTTGAACTGAGCAGCCAGG - Intergenic
1072113980 10:92350590-92350612 GCTCCTTGAACTTATCTACTGGG - Intronic
1074461206 10:113638575-113638597 CCTCCTTTAGCTTACCTTCCTGG - Intronic
1076265022 10:129103035-129103057 GCTCCTTGAACATCCCAGGCAGG - Intergenic
1078844663 11:15110314-15110336 GCTCCTTAAATGTACAATCCTGG - Intergenic
1079345366 11:19647081-19647103 GCTGCTAGAACTTGCAATCCTGG + Intronic
1092519661 12:9255765-9255787 GCTTCTTGGACACACCATCCAGG + Intergenic
1097520290 12:60660080-60660102 GCTACTAGAATTTACCATACAGG - Intergenic
1102624659 12:114225338-114225360 CCTTCTTGAACTTTCCATGCTGG - Intergenic
1106345532 13:28873222-28873244 GTTCCTTGAACATACCATGGGGG + Intronic
1109205184 13:59475299-59475321 GCTCACTGAACTTCCCCTCCTGG - Intergenic
1111924095 13:94444636-94444658 GCTCCTTGAACTTACCATCCAGG - Intronic
1112063041 13:95761230-95761252 ACTCCTTGCCTTTACCATCCTGG - Intronic
1112138515 13:96611843-96611865 GCACCTTGAACAGAACATCCAGG + Intronic
1115420111 14:33184365-33184387 GCTCCTTGAACTGATACTCCAGG - Intronic
1119837487 14:77763409-77763431 GCTCCTTGATCTTGGCTTCCAGG - Intronic
1121183586 14:91947739-91947761 GCCCCTTGACCTTCCCACCCAGG + Exonic
1121989514 14:98542245-98542267 GGTCCTTGAGCTGAGCATCCTGG + Intergenic
1124395638 15:29299463-29299485 GTTCCTTCAACTCACCAGCCAGG + Intronic
1125893847 15:43285955-43285977 CCTCTCTGAACTTACCATGCTGG - Intronic
1125920636 15:43523536-43523558 GCTCCTTGGAGTTACCTTCAAGG - Exonic
1129952502 15:79604497-79604519 ATTCCTTGAATTTAGCATCCAGG + Intergenic
1131595137 15:93790765-93790787 GCTTCTTGAACCTTCCATTCTGG + Intergenic
1133520716 16:6553858-6553880 AGTCCTTGGACTTACCTTCCTGG + Intronic
1134366468 16:13583646-13583668 GCTCCATGTGCTTACAATCCAGG + Intergenic
1136727979 16:32377109-32377131 GCTTCTTGAACTTCCCAGTCTGG + Intergenic
1138163313 16:54776681-54776703 GCTTCTAGAAATAACCATCCTGG - Intergenic
1141006407 16:80356931-80356953 GCTTCTTCCACTTACCATCATGG - Intergenic
1141674143 16:85508796-85508818 GGTCCTTGAACTTCACATCCAGG + Intergenic
1141880581 16:86856365-86856387 CCTCCTGGAACTCACCTTCCAGG + Intergenic
1202998459 16_KI270728v1_random:140645-140667 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
1203130053 16_KI270728v1_random:1677049-1677071 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
1147393300 17:40122753-40122775 GCTCCTTGAGCTTACGGTGCCGG - Exonic
1152715814 17:81900041-81900063 ACTCCTTGAACTTCCATTCCTGG - Exonic
1158964027 18:62608153-62608175 GCCCCGTGAACTCACCTTCCAGG + Intergenic
1162595668 19:11627037-11627059 GCTCCCTGCACTGACCATCATGG + Intergenic
1165153024 19:33771977-33771999 GTTCCTTCAAGTCACCATCCTGG - Exonic
1165593160 19:36988435-36988457 GCTCAGGAAACTTACCATCCTGG + Intronic
1167402779 19:49283976-49283998 GCTCCTAGAAGAAACCATCCAGG - Intergenic
1167775387 19:51551274-51551296 GCTCCTTGAAGTTATCTTCTGGG + Intergenic
927398792 2:22686831-22686853 CCTCCTGGAACATATCATCCAGG - Intergenic
930244207 2:48966862-48966884 GCTGCTCTAACTTACCATCCAGG - Intronic
932603001 2:73143060-73143082 TCTCCTTGAACTTAACAGACTGG - Intronic
932873621 2:75428362-75428384 TCTCCTTGAACTTTCCAATCAGG - Intergenic
934317990 2:91943973-91943995 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
938968596 2:136410051-136410073 GTTTCATGAATTTACCATCCAGG - Intergenic
942446723 2:176083156-176083178 GCTCCTTGAGCTTTCCCGCCAGG - Intronic
943394533 2:187316807-187316829 GATCCATGATCTTACCAGCCTGG + Intergenic
1171355624 20:24543481-24543503 GGTCAATGAACTTCCCATCCGGG - Exonic
1175750365 20:61492885-61492907 GCTGCTTCAACTTGCCATCCAGG - Intronic
1177014108 21:15762540-15762562 TCTCCTTGTGCTTACCATCATGG + Intronic
1177459060 21:21386472-21386494 TGTCCTTGAAATTACCATACTGG - Intronic
1178386189 21:32152344-32152366 GACCCTGGAACTTACCCTCCAGG - Intergenic
1180144492 21:45911697-45911719 GCTGCTAGAACTTTCCATCTGGG - Intronic
1180306163 22:11127646-11127668 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
1180544682 22:16489829-16489851 GCTTCTTGAACTTCCCAGTCTGG - Intergenic
1185074673 22:48676850-48676872 GCTCCTTGGACTAACCTCCCTGG + Intronic
949389566 3:3544232-3544254 CCTCATGGAACTTACCATCAAGG + Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954381879 3:50223526-50223548 CTTCCTTGAACTTACTGTCCAGG + Intergenic
956992774 3:74787386-74787408 GCTCTTTTAACTTTCCATCAAGG - Intergenic
962034093 3:131632502-131632524 GCTCTTTGAATTTACCATTGTGG - Intronic
963779437 3:149472438-149472460 GCTTCTAGAAGTTACCATCATGG - Intergenic
966610711 3:181865484-181865506 GCTCCTTGAACATACCACTAAGG + Intergenic
968965056 4:3765651-3765673 GCTTCTGGAACTCACCACCCAGG + Intergenic
971232435 4:24810538-24810560 GGTCCTTGAACTTTATATCCAGG + Intronic
985053067 4:186012184-186012206 GCTCATTGAAATCACCAACCCGG - Intergenic
993815986 5:92546410-92546432 GCCCAATGAACTTGCCATCCTGG + Intergenic
997323322 5:132998053-132998075 GCTCCTTGAACATACCACTTAGG + Exonic
1004439092 6:15630044-15630066 GCTCCTTAAACTTAATTTCCTGG - Intronic
1007504264 6:42322895-42322917 GCTCCTTTACTTTACCTTCCAGG - Intronic
1007573050 6:42907122-42907144 GCTCCTTCAAGTTGCCATCAAGG - Intergenic
1007784929 6:44274386-44274408 GACCCTTGAACTTGACATCCAGG - Intronic
1009408868 6:63341938-63341960 GCTCCTTTGACTTAGAATCCTGG - Intergenic
1018185056 6:161259726-161259748 GCACCTTGAGCTTACCAACAGGG + Intronic
1018834309 6:167471641-167471663 GCTCCTTGACCTTGCCATCTGGG - Intergenic
1020048195 7:5059638-5059660 GCTCCTTGAAGTTTCCTTCATGG + Intronic
1041740511 8:61152156-61152178 GCACCTTGATCTTGGCATCCTGG - Intronic
1043982603 8:86658789-86658811 GCTCTTTGAGCTCACCATTCTGG + Intronic
1047775824 8:128069607-128069629 GCTCCTGGCAGTTGCCATCCAGG + Intergenic
1185936079 X:4258141-4258163 GCGCCTGGAACTTCCCACCCTGG + Intergenic
1193850699 X:86533829-86533851 CCTCCTTGATCCTACCATTCTGG - Intronic
1196723897 X:118878802-118878824 GCTCCACGAACTTGCCCTCCTGG + Intergenic
1199443866 X:147898612-147898634 CCTCCTTGAAATTCCCATGCTGG - Intergenic
1201185552 Y:11399011-11399033 GCTTCTTGAACTTCCCAGTCTGG - Intergenic