ID: 1111928208

View in Genome Browser
Species Human (GRCh38)
Location 13:94485330-94485352
Sequence TTGGAAACACTGATGATGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111928208_1111928216 24 Left 1111928208 13:94485330-94485352 CCGAGCATCATCAGTGTTTCCAA No data
Right 1111928216 13:94485377-94485399 AGTCTGCTTGTCCACAATGGAGG No data
1111928208_1111928214 21 Left 1111928208 13:94485330-94485352 CCGAGCATCATCAGTGTTTCCAA No data
Right 1111928214 13:94485374-94485396 ACCAGTCTGCTTGTCCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111928208 Original CRISPR TTGGAAACACTGATGATGCT CGG (reversed) Intergenic
No off target data available for this crispr