ID: 1111928208 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:94485330-94485352 |
| Sequence | TTGGAAACACTGATGATGCT CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1111928208_1111928216 | 24 | Left | 1111928208 | 13:94485330-94485352 | CCGAGCATCATCAGTGTTTCCAA | No data | ||
| Right | 1111928216 | 13:94485377-94485399 | AGTCTGCTTGTCCACAATGGAGG | No data | ||||
| 1111928208_1111928214 | 21 | Left | 1111928208 | 13:94485330-94485352 | CCGAGCATCATCAGTGTTTCCAA | No data | ||
| Right | 1111928214 | 13:94485374-94485396 | ACCAGTCTGCTTGTCCACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1111928208 | Original CRISPR | TTGGAAACACTGATGATGCT CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||