ID: 1111928606

View in Genome Browser
Species Human (GRCh38)
Location 13:94490006-94490028
Sequence CTAATTATGACAAATATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111928604_1111928606 -2 Left 1111928604 13:94489985-94490007 CCTTGGAACTTAGGAATCTCACT No data
Right 1111928606 13:94490006-94490028 CTAATTATGACAAATATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111928606 Original CRISPR CTAATTATGACAAATATAGG TGG Intergenic
No off target data available for this crispr