ID: 1111928812

View in Genome Browser
Species Human (GRCh38)
Location 13:94492335-94492357
Sequence TCTTCTAAGTTGAAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111928805_1111928812 17 Left 1111928805 13:94492295-94492317 CCCTCCCTCTCTACAGAGGGGTC No data
Right 1111928812 13:94492335-94492357 TCTTCTAAGTTGAAGGTGGTTGG No data
1111928804_1111928812 18 Left 1111928804 13:94492294-94492316 CCCCTCCCTCTCTACAGAGGGGT No data
Right 1111928812 13:94492335-94492357 TCTTCTAAGTTGAAGGTGGTTGG No data
1111928806_1111928812 16 Left 1111928806 13:94492296-94492318 CCTCCCTCTCTACAGAGGGGTCC No data
Right 1111928812 13:94492335-94492357 TCTTCTAAGTTGAAGGTGGTTGG No data
1111928808_1111928812 12 Left 1111928808 13:94492300-94492322 CCTCTCTACAGAGGGGTCCACAG No data
Right 1111928812 13:94492335-94492357 TCTTCTAAGTTGAAGGTGGTTGG No data
1111928807_1111928812 13 Left 1111928807 13:94492299-94492321 CCCTCTCTACAGAGGGGTCCACA No data
Right 1111928812 13:94492335-94492357 TCTTCTAAGTTGAAGGTGGTTGG No data
1111928809_1111928812 -5 Left 1111928809 13:94492317-94492339 CCACAGAACTCTTTTGCTTCTTC No data
Right 1111928812 13:94492335-94492357 TCTTCTAAGTTGAAGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111928812 Original CRISPR TCTTCTAAGTTGAAGGTGGT TGG Intergenic
No off target data available for this crispr