ID: 1111928971

View in Genome Browser
Species Human (GRCh38)
Location 13:94494132-94494154
Sequence GATCCTGGGGAGCCATGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111928971_1111928977 17 Left 1111928971 13:94494132-94494154 CCCACTCATGGCTCCCCAGGATC No data
Right 1111928977 13:94494172-94494194 CGTCCCCATACATTGCCACCTGG No data
1111928971_1111928981 26 Left 1111928971 13:94494132-94494154 CCCACTCATGGCTCCCCAGGATC No data
Right 1111928981 13:94494181-94494203 ACATTGCCACCTGGCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111928971 Original CRISPR GATCCTGGGGAGCCATGAGT GGG (reversed) Intergenic
No off target data available for this crispr