ID: 1111932285

View in Genome Browser
Species Human (GRCh38)
Location 13:94524505-94524527
Sequence CAGGCTCAGAGTCCTGTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111932272_1111932285 26 Left 1111932272 13:94524456-94524478 CCCTGGCAGCAATCCCCTCTGCC No data
Right 1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG No data
1111932271_1111932285 29 Left 1111932271 13:94524453-94524475 CCTCCCTGGCAGCAATCCCCTCT No data
Right 1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG No data
1111932277_1111932285 12 Left 1111932277 13:94524470-94524492 CCCTCTGCCACTGGCCTGGAGAC No data
Right 1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG No data
1111932281_1111932285 -2 Left 1111932281 13:94524484-94524506 CCTGGAGACCCTTTAGATAGGCA No data
Right 1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG No data
1111932276_1111932285 13 Left 1111932276 13:94524469-94524491 CCCCTCTGCCACTGGCCTGGAGA No data
Right 1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG No data
1111932279_1111932285 5 Left 1111932279 13:94524477-94524499 CCACTGGCCTGGAGACCCTTTAG No data
Right 1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG No data
1111932273_1111932285 25 Left 1111932273 13:94524457-94524479 CCTGGCAGCAATCCCCTCTGCCA No data
Right 1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG No data
1111932270_1111932285 30 Left 1111932270 13:94524452-94524474 CCCTCCCTGGCAGCAATCCCCTC No data
Right 1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG No data
1111932278_1111932285 11 Left 1111932278 13:94524471-94524493 CCTCTGCCACTGGCCTGGAGACC No data
Right 1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG No data
1111932283_1111932285 -10 Left 1111932283 13:94524492-94524514 CCCTTTAGATAGGCAGGCTCAGA No data
Right 1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111932285 Original CRISPR CAGGCTCAGAGTCCTGTCTG AGG Intergenic
No off target data available for this crispr