ID: 1111937674

View in Genome Browser
Species Human (GRCh38)
Location 13:94573225-94573247
Sequence CCCCACCCTCTCCCATAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 341}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111937674 Original CRISPR CCCCACCCTCTCCCATAGAT AGG (reversed) Intergenic
901767969 1:11515777-11515799 CCCCAACCTCACCCAGAGCTAGG - Intronic
903194852 1:21677943-21677965 TCTCACCTTCCCCCATAGATAGG + Intergenic
903474472 1:23610079-23610101 TCCCAGCCTCTCCCAGAGTTTGG + Intronic
903786517 1:25864733-25864755 CCCCAGCCTCTCCAGTAGCTGGG - Intronic
903887742 1:26550891-26550913 GCCCACCCAGACCCATAGATCGG + Intronic
904937370 1:34141156-34141178 CCCCACCCACCCCCATACACTGG + Intronic
905083010 1:35342268-35342290 CCTCACCCTCCCCCGTAGCTGGG + Intronic
905551253 1:38841731-38841753 CCTCAGCCTCTCACATAGCTGGG - Intronic
905787251 1:40768022-40768044 CCCCAGCCTCTCCCATTTTTTGG - Intronic
906321439 1:44819750-44819772 CCCCAGCTTCTCCAATAGGTGGG + Intergenic
906387386 1:45382352-45382374 CCTCAGCCTCTCCAATAGCTGGG + Intronic
907227509 1:52962015-52962037 CCCCAGCCTCTCGAATAGCTGGG + Intronic
908295195 1:62706343-62706365 CCTCACCCTCCCCAATAGCTGGG + Intergenic
909991215 1:82224859-82224881 CCTCAGCCTCTCCCGTAGTTGGG + Intergenic
910121759 1:83798200-83798222 CCTCAGCCTCCCCCATAGCTGGG + Intergenic
910210020 1:84783146-84783168 CCCCTCCCTCTCACATCGAGAGG - Intergenic
911392493 1:97264276-97264298 CCTCACCCTCTCAAATAGCTGGG + Intronic
911574793 1:99562595-99562617 CCTCAGCCTCCCCCATAGCTGGG + Intergenic
911772818 1:101768671-101768693 TTCCTCCATCTCCCATAGATTGG + Intergenic
912532602 1:110337697-110337719 TCACACCCTCTACTATAGATTGG + Intergenic
913061104 1:115208874-115208896 TTCCAGCCTCTCCCATAGTTAGG - Intergenic
915490474 1:156247596-156247618 CCCCAGCCTCTGCCCGAGATGGG + Intronic
915763820 1:158342599-158342621 CCCCAGCCTCTCCAGTAGCTGGG + Intergenic
916914284 1:169389176-169389198 CCTCACCCTCTCCAGTAGCTGGG - Intronic
917329633 1:173868327-173868349 CCCCACCCCCTCCCACGGAGCGG - Intronic
917621882 1:176804588-176804610 ACCCACCCTCAACCACAGATGGG + Intronic
919366196 1:196664169-196664191 TCCCAGCCTCTCACATAGCTGGG + Intronic
919653661 1:200176751-200176773 CCTCAGCCTCCCCCATAGCTGGG + Exonic
921672154 1:217937583-217937605 CCTCAGCCTCTCCAATAGCTGGG + Intergenic
922937955 1:229435169-229435191 CCCCACCCCCTCCAATTTATTGG - Intergenic
922989722 1:229896142-229896164 CCCCACCCTCACCCCTAGAATGG + Intergenic
923028539 1:230226673-230226695 CGCCACTCTCTCCCAAAGTTAGG + Intronic
923862109 1:237901715-237901737 CCCCAGCCTCTTACACAGATTGG - Intergenic
924210920 1:241766583-241766605 CCTCACCCTCTCCATTAGATAGG - Intronic
1063400046 10:5734810-5734832 CCCCAGCCTCTCGAATAGCTGGG + Intronic
1063641216 10:7832663-7832685 CCCCACCCTCCCCAGTAGTTGGG + Intronic
1063643196 10:7852088-7852110 CCCCACCATCTCCCAGAGACGGG + Intronic
1064288948 10:14015557-14015579 CCACACCCTCTCCCACAGCAAGG - Intronic
1064540007 10:16395817-16395839 CCCCAGCCTCTCCAGTAGCTGGG + Intergenic
1064765138 10:18663122-18663144 CCCCACCCTCTGGAGTAGATGGG + Intronic
1065280559 10:24133454-24133476 CCTCACCCTCCCCAGTAGATGGG - Intronic
1067918030 10:50421722-50421744 CCCCACCGTCTCCACTACATAGG - Intronic
1067989051 10:51188960-51188982 CCCAACCCTCTCCCACAAAAGGG - Intronic
1068473779 10:57499115-57499137 GCCCACCCTCTATCCTAGATAGG - Intergenic
1069055970 10:63845074-63845096 CCTCAGCCTCTCGCATAGCTGGG + Intergenic
1073264362 10:102216164-102216186 CTCTCCCCTCTCCCATAGCTAGG - Intergenic
1073472440 10:103731274-103731296 CCTCAGCCTCACCAATAGATGGG + Intronic
1075120207 10:119659224-119659246 CCCCATCCTCTGCCCAAGATAGG + Intronic
1077314520 11:1912054-1912076 CCTCACCCTCTCACATAGCTGGG - Intergenic
1077315569 11:1918018-1918040 CCCCATCCTCTCCCATGGTGGGG - Intergenic
1077389467 11:2293162-2293184 CCTCAGCCTCTCACATAGCTGGG + Intergenic
1077421555 11:2452500-2452522 CCCCACCCTGCCCCAAAGAGGGG + Intronic
1078766781 11:14305927-14305949 CCTCAGCCTCTCACATAGCTGGG - Intronic
1080541125 11:33266589-33266611 CCTCAGCCTCTCCAATAGCTAGG - Intronic
1081569687 11:44281902-44281924 CCCCACCCTCTGCTGAAGATTGG - Intronic
1083078336 11:60065153-60065175 CCTCAGCCTCTCACATAGCTGGG + Intronic
1083277685 11:61606443-61606465 GCCCACCCCCTCCCAGAGCTGGG - Intergenic
1084508496 11:69586605-69586627 CCTCAGCCTCCCCCATAGCTTGG - Intergenic
1084941302 11:72614816-72614838 CCCCAGCCTCTCCCCTCCATTGG - Intronic
1086097384 11:83064208-83064230 CCGCACCCTTCCCCATAGCTGGG + Intronic
1088040889 11:105380311-105380333 CTATACCCTCTCCCATAGAAAGG + Intergenic
1088376302 11:109145462-109145484 CCCCCCCATCTCCCAGAGACAGG - Intergenic
1089495941 11:118908740-118908762 CCCCACCCTCCCCCATTGTTAGG - Intronic
1091495358 12:967818-967840 CCCCAGCCTCTCAAATAGCTGGG - Intronic
1095298930 12:40559675-40559697 CCCTACCCTCCCACAAAGATTGG + Intronic
1095321850 12:40837959-40837981 CCCCACCCTCTCCAATGGCAGGG + Intronic
1095768251 12:45921096-45921118 CCTCAGCCTCTCGCATAGCTGGG + Exonic
1096732546 12:53626121-53626143 CCCCACCCTCTTCCTCAGACAGG + Intronic
1097177708 12:57152903-57152925 CCCCACCCTCACCCACTGTTAGG + Intronic
1099148392 12:79076851-79076873 CCTCAGCCTCTCGCATAGCTGGG - Intronic
1100954575 12:99892792-99892814 CCCCACCCTCAACCGTAGCTTGG - Intronic
1101875972 12:108597258-108597280 CCCCACCCCCACCCAGAGACTGG + Intronic
1102242270 12:111331962-111331984 CCTCAGCCTCCCCCATAGCTGGG - Intronic
1102507344 12:113392066-113392088 CCTTTCCCTCTCCCAGAGATGGG + Intergenic
1103246393 12:119461578-119461600 ACCCACCCTCTCCCATGCACTGG + Intronic
1103417148 12:120750325-120750347 CCTCAGCCTCTCACATAGCTGGG + Intergenic
1103442580 12:120974311-120974333 CCTCAGCCTCTCCAATAGCTGGG - Intergenic
1104250728 12:127090992-127091014 TCCCACCCTCTTCTAAAGATTGG + Intergenic
1104313025 12:127671356-127671378 CCTCAGCCTCTCCAATAGCTAGG - Intergenic
1105044841 12:132993973-132993995 CCCCACCCCATCTCTTAGATGGG + Intronic
1105513905 13:21074297-21074319 CCCCATCCTCTCCAGTAGCTGGG - Intergenic
1106201496 13:27541352-27541374 CCCCAACCCCTCCCATAAAAAGG + Intergenic
1106334873 13:28775073-28775095 CCTCAGCCTCTCACATAGCTGGG - Intergenic
1106486843 13:30179811-30179833 CCCCACCCTTGCCCATACACTGG - Intergenic
1110834785 13:80071357-80071379 CCCCACCCTCTCCAGTAGCTGGG + Intergenic
1111937674 13:94573225-94573247 CCCCACCCTCTCCCATAGATAGG - Intergenic
1112020623 13:95368080-95368102 CCACACCCGCTCCCAGAGCTAGG + Intergenic
1113242109 13:108349755-108349777 CCCCAGCCTCCCGAATAGATGGG + Intergenic
1113849372 13:113409269-113409291 CTCCACCCCCTGCCACAGATGGG - Intergenic
1113855433 13:113442337-113442359 CCTCAGCCTCCCACATAGATGGG - Intronic
1114329593 14:21623114-21623136 CCCCACACTCTCCAATATGTTGG - Intergenic
1115343653 14:32318900-32318922 CCCCACCCCCACCCAAAGAGGGG - Intergenic
1116958715 14:50948700-50948722 CCCCACCCTCTTGAATAGCTGGG + Intergenic
1116967705 14:51031424-51031446 CCCTACCCTCTCACAGAGACTGG - Intronic
1121354418 14:93201809-93201831 CCTCACCCTCTCAAATAGCTGGG - Intronic
1122110986 14:99502316-99502338 TCCCACCATCTCCTATACATGGG - Exonic
1124990560 15:34669413-34669435 CCCCACCACCTCTCATAGCTGGG - Intergenic
1125510950 15:40291996-40292018 CCCCAGCCTCTCCCATAAATAGG + Intronic
1125514960 15:40313455-40313477 CCTCACCCTCTCCAGTAGCTGGG + Intergenic
1126153608 15:45545215-45545237 CCTCAGCCTCTCCAATAGCTGGG + Intergenic
1126587390 15:50302526-50302548 CCCCAGCCTCTCAAATAGCTGGG - Intronic
1128272184 15:66320006-66320028 CCTCAGCCTCTCACATAGCTAGG - Intronic
1128509074 15:68302537-68302559 CCACTCCCTTCCCCATAGATAGG - Exonic
1129269104 15:74410174-74410196 CCCCTCCCTCTCTCATGGCTGGG - Exonic
1129396748 15:75254096-75254118 CCCATCCCTCTCCCAAAGAAAGG + Intergenic
1129473976 15:75771082-75771104 CCCATCCCTCTCCCAAAGAAAGG + Intergenic
1130871882 15:87978225-87978247 GGCCACCCTCTCCCAAAGAGGGG - Intronic
1132609131 16:806453-806475 CCTCAGCCTCTCCAATAGCTGGG - Intronic
1132979409 16:2728499-2728521 CCCCAGCCTCCCCCGTAGCTTGG + Intergenic
1133061990 16:3180795-3180817 CCCCGCAATCTCCCATAAATGGG + Intergenic
1133382862 16:5345715-5345737 CACCACTCTCTCCCATGCATCGG - Intergenic
1133761837 16:8805181-8805203 CCTCAGCCTCCCCCATAGCTGGG + Intronic
1134051449 16:11140603-11140625 CCCCACCATGTCCCACAGAGTGG + Intronic
1134081441 16:11327674-11327696 CCCCAGCCTCTCAAGTAGATGGG + Intronic
1134257547 16:12624615-12624637 CCTCAGCCTCTCGCATAGCTGGG + Intergenic
1134619028 16:15673646-15673668 CCTCAGCCTCCCCCATAGCTAGG + Intronic
1135309434 16:21393848-21393870 CCTCAGCCTCTCCAATAGCTGGG + Intergenic
1135384887 16:22029739-22029761 TCTCAGCCTCTCCCATAGCTGGG + Intronic
1135482562 16:22833082-22833104 CCCCAGCCTCTGCTAAAGATGGG + Intronic
1135737643 16:24945205-24945227 CCCCAGCCTCTCCGGTAGCTGGG - Intronic
1136149011 16:28334161-28334183 CCTCAGCCTCTCCAATAGCTGGG + Intergenic
1136306177 16:29372972-29372994 CCTCAGCCTCTCCAATAGCTGGG + Intergenic
1136382546 16:29902311-29902333 CCTCACCCTCTCCAGTAGCTGGG - Intronic
1137709428 16:50555957-50555979 CCCCACCCTCTCCCTGAGGAAGG + Intronic
1137716585 16:50601925-50601947 CCCCAGCCTCTCCCATCCCTGGG + Intronic
1138352342 16:56352661-56352683 CCCCACCCTTCCCCACAGCTGGG + Intronic
1138454902 16:57115595-57115617 CCACACCCTCCCCCATCAATGGG + Intronic
1138762153 16:59557832-59557854 CCCCACCCCCTCCTACAGAAAGG - Intergenic
1141108066 16:81249851-81249873 TCCCACCCTATGCCACAGATTGG - Intronic
1141122950 16:81375852-81375874 CCCCACCCTCCCAAATAGTTGGG - Intronic
1142760831 17:2041188-2041210 GCCCACTCTCTCCCAGAGCTTGG - Intronic
1142779625 17:2171156-2171178 CCTCACCCTCCCACATAGCTAGG - Intronic
1143054860 17:4155251-4155273 CTCGTCCCTCTCCTATAGATAGG - Intronic
1143340016 17:6203454-6203476 CCTCACCCTCCCACATAGCTGGG - Intergenic
1144830607 17:18129048-18129070 CTCCACCCTCCCCCATGTATAGG + Intronic
1146387845 17:32393404-32393426 CCTCAGCCTCCCCCATAGCTGGG - Intergenic
1146710183 17:35034217-35034239 CCTCAGCCTCTCACATAGCTGGG - Intronic
1146942340 17:36851961-36851983 CCCCACCTTCTCCCATGTATGGG + Intergenic
1147401426 17:40182425-40182447 CCTCAGCCTCCCCCATAGCTGGG + Intronic
1147729167 17:42586887-42586909 CCCTTCTCTCTCCCATAGCTGGG - Exonic
1148040551 17:44703372-44703394 CCTCAGCCTCTCCAATAGCTGGG + Intergenic
1148433674 17:47663867-47663889 CCCCAGCCTCCTCCATAGGTGGG - Intronic
1152105509 17:78326338-78326360 TGCCACCCTCTCCCATTGTTGGG - Intergenic
1152118055 17:78400875-78400897 CCCCACCCACAGCCATAGAAGGG - Intronic
1152167572 17:78720432-78720454 CCTCAGCCTCCCCAATAGATAGG + Intronic
1153098894 18:1441286-1441308 CTCCACCTTGTCCCATAGCTGGG - Intergenic
1153295590 18:3543284-3543306 CCTCAGCCTCCCCCTTAGATGGG + Intronic
1154283796 18:13032783-13032805 CCCCTCCCTCAGCCATAGAATGG + Intronic
1155114607 18:22752079-22752101 CCCCGCCCTCTCCAATAGCAGGG + Intergenic
1155522169 18:26679506-26679528 CCCCAACCTCTCAGAGAGATGGG - Intergenic
1155721216 18:29014175-29014197 CACCACACTCTCTCAAAGATAGG - Intergenic
1156409884 18:36817549-36817571 CCCCAGCCTCCCCAATAGCTGGG + Intronic
1158994219 18:62900579-62900601 CCCCAGCCTCTCAAATAGCTGGG + Intronic
1159596226 18:70385176-70385198 CCTCAACCTCTCGCATAGCTGGG + Intergenic
1160181824 18:76643552-76643574 CTCAATCCTCTCCCATATATGGG + Intergenic
1161452905 19:4356427-4356449 CCTCAGCCTCTCAAATAGATGGG - Intronic
1161944306 19:7425431-7425453 CCTCACCCTCTCCAATTGCTGGG - Intronic
1162521163 19:11180343-11180365 CCTCAGCCTCTCGCATAGCTGGG + Intronic
1162613895 19:11779793-11779815 CCCCAGCCTCTCAAATAGCTGGG - Intronic
1163283265 19:16330388-16330410 CCCCACCCCCTGCCATAGCTGGG - Intergenic
1163395145 19:17055737-17055759 CCCCATCCTCTGCCTTAGTTGGG + Intronic
1163518181 19:17777418-17777440 CCTCACCCTCTCGAATAGCTGGG - Intronic
1163693831 19:18752432-18752454 CCTCAGCCTCTCGCATAGCTGGG + Intronic
1164238367 19:23359336-23359358 CCTCAGCCTCTCGCATAGCTGGG + Exonic
1165411172 19:35662653-35662675 CCCCAGCCTCTCAAGTAGATGGG + Intergenic
1165712656 19:38023226-38023248 CCTCACCCTCTCCAGAAGATAGG - Intronic
1167309078 19:48726340-48726362 CCTCAGCCTCTCCAATAGCTGGG + Intronic
1168367408 19:55800421-55800443 CTTCACCCTCTCGCATAGCTGGG + Intronic
1168446059 19:56414915-56414937 CCTCAGCCTCCCACATAGATGGG - Intronic
925944054 2:8844523-8844545 CCTCACCCTCCCACATAGCTGGG - Intergenic
926863368 2:17332962-17332984 ACCTACCATCTACCATAGATAGG + Intergenic
926891845 2:17645304-17645326 CCCCACCCCCACCCAAAGGTTGG + Intronic
928242616 2:29599946-29599968 CCCTACCATCTCCCTAAGATTGG + Intronic
928246571 2:29634211-29634233 CCTCACCCTCTCGAATAGCTAGG + Intronic
929014491 2:37481343-37481365 CCCCAACCTCTCTCCCAGATTGG - Intergenic
929159244 2:38815180-38815202 CCTCACCCTCCCACATAGCTGGG + Intronic
929494222 2:42425281-42425303 CCTCAGCCTCTCCAATAGCTTGG - Intergenic
929769979 2:44883609-44883631 CCCCACCATGTCCCATGGACTGG + Intergenic
931397232 2:61898358-61898380 CCTCAACCTCCCGCATAGATGGG - Intronic
931524549 2:63138566-63138588 CCTCAGCCTCCCCCATAGCTGGG + Intronic
931881238 2:66573695-66573717 CCCCTCCCCAGCCCATAGATGGG + Exonic
932596941 2:73099853-73099875 CCCCAACCTCTTCCAAAGACAGG + Intronic
935653318 2:105399780-105399802 ACGCACCCTCTCCCAGGGATGGG - Intronic
936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG + Intergenic
936175975 2:110220221-110220243 CCTCAGCCTCTCACATAGCTAGG - Intergenic
936191897 2:110340613-110340635 CCTCACACTCTCCCATGGCTGGG - Intergenic
937641812 2:124221007-124221029 CCCCACCCTGTCCCACATTTGGG + Intronic
938045744 2:128118379-128118401 CCTCACCCTCTCGAATAGCTGGG + Intronic
938500749 2:131830399-131830421 CCCCATCCTCTCCCTGCGATGGG + Intergenic
941489528 2:166126132-166126154 CCTCACCCTCTCCAAGAAATTGG + Intronic
947855029 2:233318087-233318109 CCTCAGCCTCTCACATAGCTGGG + Intronic
948879351 2:240848532-240848554 CCCCACCCTCTAACACACATCGG - Intergenic
1169461783 20:5801791-5801813 GCCCCCCGTATCCCATAGATGGG + Intronic
1170609749 20:17902801-17902823 CCCCACTCTCTCCCAGAGCTTGG - Intergenic
1171502488 20:25604436-25604458 CCCCAGCCTCTCGCATAGCTAGG + Intergenic
1172544038 20:35745436-35745458 CCCCAGCCTCCCAAATAGATGGG - Intergenic
1173373529 20:42461419-42461441 CCTCACCCTCTCCAGTAGCTAGG - Intronic
1175682871 20:61004048-61004070 CCTCACCCACCTCCATAGATAGG - Intergenic
1175839562 20:62018563-62018585 CCCCACCCCGCCCCACAGATGGG + Intronic
1178683149 21:34690132-34690154 CCCCACCCTCACCCATCAAGAGG - Intronic
1179038502 21:37781312-37781334 CCCCAGCCTCTGCCAAAGTTCGG - Intronic
1179873555 21:44255963-44255985 CCCCACCCCCTCCCCTAGACCGG - Intronic
1180594440 22:16964104-16964126 CCCCTCCAGCTCCCAGAGATCGG + Intronic
1181340177 22:22172554-22172576 CCCCAGCCTCTCCAGTAGCTGGG - Intergenic
1182269343 22:29143856-29143878 TGCCACCCTGTCCCTTAGATAGG + Intronic
1182628896 22:31669298-31669320 CCTCATCCTCTCGCATAGCTGGG - Intergenic
1182645772 22:31808209-31808231 CCCCAGCCTCCCCAATAGCTAGG + Intronic
1183192524 22:36330908-36330930 CCCCACCCTCACCAAGAGAGGGG - Intronic
1183397941 22:37583748-37583770 CCTCAGCCTCTCCCGTAGCTGGG - Intergenic
1183530507 22:38351023-38351045 TCCCACCCTCTGCCAAAGATGGG + Intronic
1183543390 22:38442856-38442878 CCCCAGCCTCTCGAATAGCTGGG + Intronic
1183691394 22:39390792-39390814 CCTCACCCTCTCCAGTAGCTGGG - Intergenic
1183748539 22:39706027-39706049 CCCCAGCCTCTCCCAGAAAAAGG + Intergenic
1184466902 22:44673810-44673832 GCCCACCCTCTCCCAGCCATAGG - Intronic
1184769425 22:46588913-46588935 CCCCACCCCCTCCCACAGTAAGG + Intronic
1185159352 22:49213591-49213613 TCCCCACCTCTCCCCTAGATGGG + Intergenic
1185235262 22:49708817-49708839 CCCCTCCCCTTCCCACAGATTGG + Intergenic
950496371 3:13336665-13336687 CCCCACCCTCACACCTAGAGAGG - Intronic
950906747 3:16545653-16545675 CCCCAGGCTCTGACATAGATGGG - Intergenic
952369800 3:32710834-32710856 CCCCAGCCTCTTCAATAGCTGGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954416382 3:50395470-50395492 CCCCACCCTGTCCCACAGTGGGG + Intronic
954610617 3:51942912-51942934 GCCCACCCTCCCCCATAGCTCGG + Intronic
954794366 3:53154091-53154113 TCCCACCCTCTCTCAGAGAAAGG + Intergenic
955315983 3:57939577-57939599 CCTCAGCCTCTCAGATAGATGGG + Intergenic
955735417 3:62033536-62033558 CCCCACCCCCCACCAGAGATAGG + Intronic
958973449 3:100638568-100638590 ACCCACTCTCTCCCATTGGTTGG - Intronic
959165231 3:102768670-102768692 CCTCACCCTCTCCCCTTGATAGG + Intergenic
959211599 3:103390757-103390779 CCTCAGCCTCCCCCATAGCTGGG + Intergenic
960951479 3:123001225-123001247 CCCCACCCTCTCTCATACAGTGG + Intronic
961019012 3:123488311-123488333 CCTCAGCCTCCCCCATAGCTGGG - Intergenic
962444618 3:135453400-135453422 CTCCACTCTCTCCCATTGACTGG + Intergenic
963269649 3:143273279-143273301 CCCCACCCTCTAACATAGCTAGG + Intronic
964826978 3:160839360-160839382 CCCCACCCACTCCTAGAGATGGG - Intronic
965378474 3:167957391-167957413 CTCCTCCCTCTCCCCCAGATAGG + Intergenic
966520820 3:180871644-180871666 CCCCAGCCTCTCACGTAGCTGGG + Intronic
966838396 3:184067732-184067754 CCTCACCCTCTCCAATCCATGGG + Intergenic
966912316 3:184566404-184566426 CCCCACCCCATCCCAGACATGGG + Intronic
968047609 3:195632694-195632716 CCTCTCCCTCTCCCACACATGGG - Intergenic
968441724 4:627774-627796 CCCCACCCTGTCCCAAATCTGGG + Intronic
968779854 4:2572211-2572233 CCCCAGCCTCCCCAATAGCTGGG - Intronic
969366693 4:6699300-6699322 CCCCAGCCTCTGTCATAGCTGGG + Intergenic
969372716 4:6744026-6744048 CCTCAGCCTCTCCAGTAGATGGG + Intergenic
972374800 4:38460273-38460295 CCCCACCGCCTCCCAGAGATGGG + Intergenic
973095296 4:46190118-46190140 CTCCACCATCTCCAATATATGGG - Intergenic
975114746 4:70667512-70667534 CCCCAGCCTCCCGCATAGCTGGG - Intronic
976126470 4:81838411-81838433 CCCCAACCTCTCAAATAGCTGGG + Intronic
976281674 4:83332811-83332833 CCCCAACCTCTCCCCAAGAAAGG - Intronic
976721808 4:88176594-88176616 CCTCAGCCTCTCACATAGCTGGG + Intronic
977682383 4:99810826-99810848 CCCCACCCCATCCCACAGACTGG - Intergenic
978170915 4:105668928-105668950 CCCCAGCCTCTCCAGTAGCTGGG - Intronic
979590734 4:122477434-122477456 CCCCACCCTCCCACATAGCTGGG + Intergenic
981087023 4:140694453-140694475 CCTCACCCTCCCGCATAGCTGGG - Intronic
981226376 4:142299275-142299297 CCACAGCCTCTCGCATAGCTGGG + Intronic
982203104 4:152976974-152976996 CCCCACCCTCCCCCAAAGCCCGG + Exonic
982449386 4:155533932-155533954 CCCCACCCTTTTCCATAAGTGGG - Intergenic
982716534 4:158814685-158814707 CCCCTCCCTCCCCCAAAGACAGG - Intronic
983496770 4:168450789-168450811 CCTCAGCCTCTCTAATAGATGGG - Intronic
983620018 4:169751285-169751307 CCTCAGCCTCTCCAATAGCTGGG - Intronic
984518454 4:180771151-180771173 CCTCAGCCTCTCCCGTAGCTGGG - Intergenic
984878482 4:184390202-184390224 CCCCTCTCCCTCCCATAGATGGG - Intronic
986790722 5:11157018-11157040 CCCCACCCTATCACACAGAGAGG - Intronic
987272934 5:16330972-16330994 CCTCAGCCTCCCCCATAGTTAGG - Intergenic
987353556 5:17042590-17042612 CCTCAGCCTCTCAGATAGATGGG + Intergenic
987947490 5:24630435-24630457 CCTCAACCTCTCACATAGCTGGG - Intronic
988024347 5:25665833-25665855 CCGCTGCCTCTCACATAGATGGG + Intergenic
988410377 5:30878313-30878335 CCTCAGCCTCTCCCATAGCTGGG + Intergenic
989765618 5:45079295-45079317 CACCTCACTCTCCCAGAGATAGG - Intergenic
990481831 5:56219155-56219177 CCCCAGCCTCCCACATAGCTGGG - Intronic
991498152 5:67248516-67248538 CCTCAGCCTCCCACATAGATGGG + Intergenic
991669619 5:69034849-69034871 CCTCAGCCTCTCACATAGCTGGG - Intergenic
992159323 5:73985212-73985234 CCCCACCCTCTCCCACAAGAGGG + Intergenic
994211664 5:97094085-97094107 ACCCACACTCTTCCATATATGGG - Exonic
995284102 5:110367220-110367242 CCCCAGCCTCCCTCATAGCTGGG + Intronic
995568546 5:113456570-113456592 CCTCAGCCTCTCCAATAGCTGGG + Intronic
1001054143 5:168435524-168435546 CTTCAGCCTCTCCCATAGCTGGG + Intronic
1001387131 5:171349052-171349074 CCGCACCCTGGCCCATATATAGG + Intergenic
1002090502 5:176802801-176802823 CCCAACCTTCTCCAATAGACTGG + Intergenic
1002119300 5:176989542-176989564 CCCCAGCCTCTCCAGTAGCTGGG - Intronic
1002439289 5:179256038-179256060 CCCCAGCCTCTCCCGCAGCTTGG + Intronic
1002837375 6:876352-876374 CCTGACCCTCTCCCAGGGATGGG + Intergenic
1004168981 6:13281148-13281170 CTCCAGACTCTGCCATAGATAGG + Intronic
1004609742 6:17228492-17228514 CCTCAGCCTCTCCTATAGCTGGG - Intergenic
1005727894 6:28667649-28667671 CCGCACCCTCTCCAGTAGGTGGG - Intergenic
1005777136 6:29146418-29146440 CCCTACCCTCTCCTTCAGATGGG + Intergenic
1006028373 6:31161775-31161797 CCTCACCTTCTCCCCTAGTTGGG + Exonic
1006282348 6:33064824-33064846 CCCCACCCTATCCTGTAGTTAGG + Exonic
1006752153 6:36385348-36385370 CCTCAGCCTCTCCAATAGCTGGG - Intronic
1006914013 6:37583135-37583157 CACCACCCTTTCCCAGAGCTGGG + Intergenic
1007280462 6:40708650-40708672 CCTCAGCCTCCCCCATAGCTGGG - Intergenic
1007420794 6:41718322-41718344 CCTCAGCCTCTCCCATAGCTGGG + Intronic
1007516138 6:42412928-42412950 CCCCACCCTGTCACCCAGATTGG - Intronic
1007800727 6:44390018-44390040 CACCACACTCTCCAATAAATTGG - Intronic
1007835775 6:44672519-44672541 CCCCATCCTCTCCCACAGTAGGG - Intergenic
1011802754 6:91036418-91036440 CCCCACCTTCTCCCAAGGATGGG - Intergenic
1014362168 6:120492772-120492794 CCCCAGCCTCTCCAGTAGCTGGG + Intergenic
1015394497 6:132719347-132719369 CCCCAGCCTCTCCAGTAGCTGGG + Intergenic
1016363319 6:143290930-143290952 CCCCACCCTCTTCCCAAGATGGG + Intronic
1016386476 6:143535745-143535767 CCTCACCCTCTCCAGTAGCTGGG - Intergenic
1017676313 6:156817512-156817534 CCCCAGCCTCCCACATAGCTGGG - Intronic
1018222094 6:161591437-161591459 CTCCACCCTCTCCCACAGGAGGG + Intronic
1019792832 7:3028321-3028343 CCACCCCCTCTCCCATGGAATGG + Intronic
1020031727 7:4938124-4938146 CCTCAGCCTCCCCCATAGCTGGG + Intronic
1021410634 7:20326653-20326675 CCTCAGCCTCTCACATAGCTGGG + Intergenic
1021611259 7:22460198-22460220 CCCAACCCTACCCCATAGCTAGG - Intronic
1021724264 7:23534297-23534319 CCACACCCTCTCACATAGCTGGG + Intergenic
1023373258 7:39532652-39532674 CCCTAGCCTCTGCCAGAGATTGG + Intergenic
1023950161 7:44837604-44837626 CCTCACCCTCTCCACTAGCTGGG + Intronic
1024624195 7:51190322-51190344 CCTCAGCCTCTCCAGTAGATGGG + Intronic
1025610261 7:63071486-63071508 CCCCACCCTCCCCCAAAGTGAGG + Intergenic
1025955612 7:66180600-66180622 CCTCAGCCTCTCCAATAGCTGGG + Intergenic
1028169665 7:87581205-87581227 CCTCAGCCTCTCCAATAGCTGGG + Intronic
1028496125 7:91463267-91463289 CTCCACCCTCTGCCAGAGGTGGG + Intergenic
1028973962 7:96891521-96891543 CCCCACACTCTGCCACAGCTTGG + Intergenic
1031503400 7:122550116-122550138 CCCCACCATTTCCCAGAGAGAGG - Intronic
1031899629 7:127393923-127393945 CCCCCGCCTCTCCCGTAGCTGGG - Intronic
1032075547 7:128834101-128834123 CTCCACCCTCTCCCATCTCTCGG + Intronic
1032127875 7:129207775-129207797 CCTCAGCCTCTCACATAGCTAGG - Intronic
1033261795 7:139850478-139850500 CCCCACCCACACCCACACATGGG + Intronic
1037330688 8:17740979-17741001 CCTCACCCTCCCCAATAGCTGGG + Intronic
1037741747 8:21614043-21614065 CCCTCCCTTCTCCCATAGGTGGG - Intergenic
1039447269 8:37642848-37642870 CCTCAGCCTCCCCCATAGCTGGG + Intergenic
1039502023 8:38025614-38025636 CCCCAGCCTCTCAAATAGCTAGG + Intergenic
1040018840 8:42722247-42722269 CCCCAGCCTCTCCGGTAGATGGG - Intronic
1040026443 8:42786426-42786448 CCTCAGCCTCCCCAATAGATGGG - Intronic
1045838625 8:106553432-106553454 CCTCAGCCTCCCCCATAGGTGGG + Intronic
1046201103 8:110928822-110928844 CCCCACCATCTCCCAGAGAGAGG - Intergenic
1046410716 8:113838916-113838938 CCTCAGCCTCTCTAATAGATGGG + Intergenic
1046482110 8:114835600-114835622 CCCCAGCCTCTCAAATAGCTAGG - Intergenic
1046853142 8:118998729-118998751 CCTCAGCCTCTCAAATAGATGGG - Intronic
1047757316 8:127928615-127928637 CCCCACCCTATCCCCCAGAGGGG + Intergenic
1047888444 8:129279385-129279407 CCTCAGCCTCCCACATAGATGGG + Intergenic
1049436328 8:142587756-142587778 CCCCACCCTCGCCCACAGGCAGG + Intergenic
1049814995 8:144594853-144594875 CCTCACTCTGTCACATAGATTGG - Intronic
1050367429 9:4885403-4885425 CCCTACCCTCTCGCAGAGAGTGG + Intronic
1050727541 9:8669060-8669082 CCCTCCCCTTTCCCATAGAGAGG - Intronic
1050770826 9:9197524-9197546 CCCCACCCTCTCGAGTAGCTGGG + Intronic
1052981522 9:34453422-34453444 CCTCACCCTCTCCCAAAGCAGGG + Intronic
1053384592 9:37676852-37676874 CCCCACTCTCTGCCTTATATTGG + Intronic
1055355917 9:75436787-75436809 CCTCAGCCTCTCACATAGCTGGG - Intergenic
1055804709 9:80079577-80079599 TCTCACCCTCTACCATAAATAGG - Intergenic
1056733230 9:89183421-89183443 GCCCAGCCTCTCCCAAAGAAAGG + Intergenic
1060508901 9:124218086-124218108 CACAACCCCCACCCATAGATGGG + Intergenic
1060585514 9:124782912-124782934 CTCCACCCACTCCCCCAGATGGG - Intronic
1060757651 9:126224650-126224672 CCCCACCCTCACACATACACTGG + Intergenic
1061339566 9:129968277-129968299 CCTCAGCCTCCCCCATAGCTGGG - Intronic
1061371545 9:130200518-130200540 CCCCACCCCCCCACATAGGTGGG + Intronic
1061700059 9:132409300-132409322 CCTCAGCCTCCCCCATAGCTGGG + Intergenic
1061806776 9:133141311-133141333 CCCCACCCTCTCCCAGGGTCTGG + Intronic
1061945847 9:133907937-133907959 CACCACCCTCCCCCAGAGAGTGG + Intronic
1062168858 9:135122959-135122981 CCCCACTCCCTCCCAAATATCGG - Intergenic
1062303206 9:135887515-135887537 CTTCAGCCTCTCCCATTGATTGG - Intronic
1186712847 X:12218578-12218600 ACCCACTCTCTCCCCTAAATGGG + Intronic
1187212231 X:17242991-17243013 CCCCACCATCTCCCATGACTTGG - Intergenic
1187502210 X:19848887-19848909 CCTCATCCTCTCAAATAGATGGG + Intronic
1189705586 X:43755977-43755999 TCCCATCCTCTCACAGAGATGGG - Intergenic
1189816504 X:44829636-44829658 CCTCACCCTCCCCCATAGCTGGG - Intergenic
1190791342 X:53703320-53703342 CCTCAGCCTCTCCAATAGCTGGG - Intergenic
1194340968 X:92705081-92705103 CCCCAGCCTCTCAAATAGCTGGG + Intergenic
1194737861 X:97535565-97535587 CCTCAGCCTCTCAAATAGATGGG + Intronic
1194766530 X:97848772-97848794 CACCACCCTCCTCCATAGTTGGG - Intergenic
1197856160 X:130916231-130916253 CCTCACCCTCTCGCGTAGCTGGG + Intergenic
1198426981 X:136530361-136530383 CCTCACCCTCCCCAATAGCTGGG + Intergenic
1198719593 X:139601861-139601883 CCCCAACCTCTCCCAGATGTGGG - Intronic
1198850474 X:140961111-140961133 CCTCAGCCTCCCCCATAGCTGGG + Intergenic
1200142733 X:153909943-153909965 CCACACCCCCTCCCACAGCTTGG - Intronic
1200649322 Y:5821800-5821822 CCCCAGCCTCTCAAATAGCTGGG + Intergenic
1202273104 Y:23089210-23089232 CCCCAGGCTCTGACATAGATGGG - Intergenic
1202292922 Y:23331472-23331494 CCCCAGGCTCTGACATAGATGGG + Intergenic
1202426101 Y:24722954-24722976 CCCCAGGCTCTGACATAGATGGG - Intergenic
1202444688 Y:24947132-24947154 CCCCAGGCTCTGACATAGATGGG + Intergenic