ID: 1111937686

View in Genome Browser
Species Human (GRCh38)
Location 13:94573373-94573395
Sequence CCACCCCAGAACTACCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111937683_1111937686 29 Left 1111937683 13:94573321-94573343 CCAGTAGATAAAATGACTTGGTC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1111937686 13:94573373-94573395 CCACCCCAGAACTACCATGATGG 0: 1
1: 0
2: 1
3: 9
4: 125
1111937682_1111937686 30 Left 1111937682 13:94573320-94573342 CCCAGTAGATAAAATGACTTGGT 0: 1
1: 0
2: 5
3: 36
4: 212
Right 1111937686 13:94573373-94573395 CCACCCCAGAACTACCATGATGG 0: 1
1: 0
2: 1
3: 9
4: 125
1111937684_1111937686 -6 Left 1111937684 13:94573356-94573378 CCAGCTTTCATCATCAGCCACCC 0: 1
1: 0
2: 3
3: 20
4: 241
Right 1111937686 13:94573373-94573395 CCACCCCAGAACTACCATGATGG 0: 1
1: 0
2: 1
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111937686 Original CRISPR CCACCCCAGAACTACCATGA TGG Intergenic
901177213 1:7313076-7313098 ACCCCCCAGAACTACTATGAAGG + Intronic
904093587 1:27961137-27961159 CCACCCCAGACCCAGCAAGAGGG + Intronic
910897103 1:92080600-92080622 GGACCCCAGAAGTACCATGGGGG - Exonic
912125586 1:106533318-106533340 CCACCCCACAACATCTATGAGGG + Intergenic
913393970 1:118345952-118345974 CCACCCCAGAGCTGGTATGATGG + Intergenic
916068674 1:161157027-161157049 CCACCCCACACCTCCCAAGAGGG - Intronic
917106291 1:171495912-171495934 CCTCACCAGAACTACTATGCTGG - Intronic
917310646 1:173674316-173674338 CCATCCCAAAAGAACCATGAAGG - Intergenic
919051111 1:192512573-192512595 CCACCCCAGAACCACCCACAGGG + Intergenic
920728489 1:208460607-208460629 CTACCCCAAACCTACTATGAGGG - Intergenic
921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG + Intronic
922567223 1:226608680-226608702 CCACCCCAGTCCAGCCATGAGGG + Exonic
1062841177 10:673124-673146 CCACCCCAGAGCACCCAGGATGG + Intronic
1066043810 10:31579264-31579286 CCTGCCCAGAATCACCATGATGG + Intergenic
1069092623 10:64219962-64219984 CCATCCCAAAGCTACAATGATGG - Intergenic
1075003568 10:118815051-118815073 CCACCTCAGAACTCCCCTGCAGG + Intergenic
1076054464 10:127360347-127360369 CCAACCCACAACTAGCAGGAGGG + Intronic
1076674957 10:132142844-132142866 CCACCCCAAAACCACCCTGCAGG + Intronic
1077006340 11:359301-359323 CCACCCCAGTCCTGCCATGCTGG - Intergenic
1077350611 11:2091493-2091515 CCACCCCAGAACCAGCAGGTGGG + Intergenic
1083365632 11:62140097-62140119 CCACCCCGGAGCTGCCAGGAAGG + Intronic
1083625862 11:64071675-64071697 CCACCCCATAACCACCAAGCTGG - Intronic
1084628485 11:70328594-70328616 CCAACCCAGAAATCCCATTACGG - Intronic
1086339482 11:85833639-85833661 CCAACCCAGAACCACTTTGAAGG - Intergenic
1089532812 11:119142551-119142573 CCACCCCACAACCACCAGGAAGG + Intergenic
1095203872 12:39417044-39417066 AAACACCAGAACTAGCATGAAGG + Intronic
1095263681 12:40128432-40128454 CCACCCCAACTCTACCAAGATGG + Intergenic
1100390114 12:94140561-94140583 CCACAGCCGAACTAGCATGACGG + Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104209951 12:126679062-126679084 CTACTCCAGAACTAGCATGGTGG - Intergenic
1104647889 12:130509865-130509887 GCAGCCCAGAAGCACCATGATGG + Intronic
1107247065 13:38309379-38309401 CCACCCTAGAACTAGCATTATGG + Intergenic
1111937686 13:94573373-94573395 CCACCCCAGAACTACCATGATGG + Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1124486855 15:30125297-30125319 CCAGCCCAGAAGATCCATGAAGG - Intergenic
1124541937 15:30594274-30594296 CCAGCCCAGAAGATCCATGAAGG - Intergenic
1124548587 15:30656065-30656087 CCAGCCCAGAAGATCCATGAAGG - Intronic
1124756670 15:32413026-32413048 CCAGCCCAGAAGATCCATGAAGG + Intergenic
1126820334 15:52496849-52496871 CCAACTCAGGACTACCCTGAAGG - Intronic
1127710556 15:61593401-61593423 CCATCCAAGAACTAACAAGATGG - Intergenic
1127992183 15:64128154-64128176 AAACCACAGAACTACCATGTAGG + Intronic
1130222159 15:82028759-82028781 CCACCCCAGAAGTGGTATGATGG + Intergenic
1130959576 15:88650740-88650762 CCACCCCAAAGCCACCATGCTGG - Intronic
1132279009 15:100596295-100596317 CCACCCCAGAACTATCTTATGGG - Intronic
1136070121 16:27782542-27782564 CCACCCCAGAAGGACCCAGAAGG + Intergenic
1137755376 16:50897956-50897978 CCACCCCAGAACTGGCAGAATGG + Intergenic
1139549350 16:67664915-67664937 CCACCCCAGAACTCAGATCAGGG + Intronic
1141445377 16:84054678-84054700 ACGCCACAGAGCTACCATGACGG + Intronic
1142404635 16:89880960-89880982 CCATCCCAGCAGCACCATGATGG - Intronic
1142799240 17:2335011-2335033 CCAACACTGAACTACCCTGAAGG + Intronic
1143998270 17:11027993-11028015 CCAACCCAGAAACACCGTGAAGG + Intergenic
1144642269 17:16944097-16944119 CCACCCCAGATCTGCTTTGAAGG - Intronic
1145206861 17:20989123-20989145 CCACCCCAGATCTCCTTTGAAGG + Intergenic
1146665725 17:34701837-34701859 CCACCCAAGAACAGACATGAGGG + Intergenic
1147266120 17:39235981-39236003 CCACCCCAGAAGTGAGATGAAGG - Intergenic
1148389943 17:47264275-47264297 CCACTCCAGATCTATCTTGAAGG + Intronic
1152912167 17:83011057-83011079 CCACCCCAGACCAAACACGAAGG - Intronic
1152938641 17:83154382-83154404 CCACCCCACACATATCATGAGGG - Intergenic
1156240307 18:35247327-35247349 CTATCCTAGAACTTCCATGAGGG + Exonic
1158655087 18:59323592-59323614 CTACCACAGAACTTCCATGTTGG + Intergenic
1161925417 19:7295343-7295365 CCTCCCCAGAACTGGCATGCAGG - Intergenic
1164942986 19:32266022-32266044 CCAGCTCAGAAACACCATGAGGG + Intergenic
1166718693 19:44985390-44985412 CCACCACTGAACCACCATGCCGG + Intronic
929636332 2:43525525-43525547 CAACCCCAAGACTACCATGCTGG + Intronic
931460328 2:62444339-62444361 ACACCCCAGAACTACACTGGTGG + Intergenic
931695982 2:64870942-64870964 CCACCTCAGATCAACCAGGAGGG - Intergenic
932809431 2:74811804-74811826 TCACCCCACAACCACCATCAAGG - Intergenic
934674115 2:96237560-96237582 CCACCCCAGAACTGACACAACGG + Intergenic
935349430 2:102141079-102141101 CCAGCCCAGAAGCACTATGATGG - Intronic
935842414 2:107127999-107128021 CCACACCTGACCAACCATGATGG - Intergenic
937281017 2:120717186-120717208 CCATCCCAGAGCTGCCAGGAAGG - Intergenic
938116149 2:128604084-128604106 CCAGCCCAGCAGGACCATGATGG + Intergenic
946219458 2:218214257-218214279 CCACCCCAGAACAACAATGAAGG + Intergenic
947694476 2:232172807-232172829 CTACCCCACACCTACAATGATGG - Intronic
1169211281 20:3767534-3767556 CCACCCCAGCCCTGCCATCACGG + Intronic
1173963804 20:47095896-47095918 CCAACCCAGAAATACAATGAAGG + Intronic
1174609215 20:51785515-51785537 CCTCCCCAGAGCAACCAAGATGG + Intronic
1175301644 20:57947332-57947354 CCACCCCACCCCTGCCATGAAGG - Intergenic
1175375409 20:58520359-58520381 CCACCCCAGAGCAACAATTATGG - Intergenic
1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG + Intronic
1178199610 21:30389236-30389258 CCACCCTAGAACTACCCTCTGGG + Intronic
1178288169 21:31343597-31343619 CCACTCCAGAACTCCCATCCAGG + Intronic
1180021216 21:45128762-45128784 CCACCCCAGAACAAGCAGGAGGG - Intronic
1181571193 22:23768463-23768485 CATCCCCAGAACTCCCACGAGGG + Intronic
1183633541 22:39047442-39047464 CAAGCCCAGGACTACCATCAGGG + Intronic
1184236235 22:43184630-43184652 CCTCCCCAGACCCACCTTGAGGG - Intronic
950580521 3:13858876-13858898 CCACCCCCACACTACCATGGAGG + Intronic
952903774 3:38126561-38126583 CCGCCCCAGCACCACCATGGAGG - Exonic
955482280 3:59401928-59401950 ACACCCCAGAACTCCAAAGAAGG - Intergenic
956280691 3:67553253-67553275 CCACCACAGATCTTCCATCATGG + Intronic
959350233 3:105252941-105252963 CCCACCAGGAACTACCATGAAGG + Intergenic
964846741 3:161052411-161052433 ACACCCCAGGACTACGAAGATGG - Intronic
965882129 3:173398229-173398251 CAACCCCAGAACTAGCCGGAGGG - Intronic
967633656 3:191776431-191776453 CCACCCTAGAACTGGTATGATGG - Intergenic
970072771 4:12180383-12180405 TCATCCCAGAAATACAATGAGGG + Intergenic
972242561 4:37208946-37208968 CCACCTCCACACTACCATGACGG + Intergenic
973924279 4:55721655-55721677 CCACCCCAAATCTACAATGTTGG - Intergenic
975733038 4:77356224-77356246 CCACCATGGAACAACCATGATGG - Intronic
976678712 4:87731606-87731628 GCAACCCAGAAGTACAATGAGGG + Intergenic
980771646 4:137380754-137380776 CCACCCTAGAGCTAGCATGATGG + Intergenic
981131175 4:141160085-141160107 CCACCCCAGAACTACTGAGCTGG + Intronic
986661011 5:10060248-10060270 CCAGCCAAGCTCTACCATGAAGG + Intergenic
988340020 5:29959437-29959459 CCACCCCAGCACTGGCATCATGG + Intergenic
991628633 5:68631567-68631589 CAACCCCAGACCTGCCATGCTGG + Intergenic
991955274 5:71988031-71988053 CCACCCCAGAACTGGAATCATGG + Intergenic
995226137 5:109703492-109703514 CCACCCAAGAACTTGCATGAAGG - Intronic
996125590 5:119722297-119722319 CCATTCCAGAGCTCCCATGAGGG - Intergenic
1004214513 6:13689215-13689237 TCACCCTAGAACTATCATCAAGG + Intronic
1004602400 6:17162967-17162989 CCTCCCCAGAAACACCACGATGG + Intergenic
1006594907 6:35185789-35185811 CTACCCCAGACCTACCCTGCTGG - Intergenic
1010971053 6:82263932-82263954 CCATCACAGAACTATCATAAAGG - Intergenic
1016804953 6:148203277-148203299 CCACCCCAGAATTCTCATAATGG - Intergenic
1019660258 7:2220068-2220090 CCACCCCAATGCTACCATGACGG + Intronic
1019745720 7:2699605-2699627 ACACCCAAGAACTCCCATCACGG - Intronic
1020351325 7:7221966-7221988 TAACACCAGAACTACCCTGAGGG + Intronic
1023859959 7:44212694-44212716 CCACCCCAGCCCTAGCATCAGGG - Exonic
1026445883 7:70484448-70484470 CCACCTCAGAACTCCCCTGGTGG - Intronic
1035287848 7:157817480-157817502 CCACCCCAGAGCCACCATCACGG + Intronic
1036772267 8:11587366-11587388 CCACCCTATAGCAACCATGATGG + Intergenic
1036989135 8:13571895-13571917 CCACTCCACAACTACCAAAATGG - Intergenic
1037814489 8:22104627-22104649 CCACCCCGGAGACACCATGAGGG + Exonic
1040567268 8:48579030-48579052 CGACCCCAAAACTGCCATGTAGG + Intergenic
1043176527 8:77028689-77028711 CCACCCTAGAACTGACATGGTGG + Intergenic
1045389999 8:101705724-101705746 CCACCCCAAAGCCACCATGGAGG + Intronic
1046451270 8:114393657-114393679 ACACCTCAGAACAACCATGTTGG - Intergenic
1048710207 8:137201435-137201457 CCACCCCACCACTCCCATGGTGG + Intergenic
1050458741 9:5858725-5858747 TGACCTCAGAACCACCATGAAGG - Intergenic
1056138766 9:83654384-83654406 CCACTTCACACCTACCATGATGG + Intergenic
1059700515 9:116771481-116771503 CCATCCCATAAGTACCAAGAGGG + Intronic
1061403594 9:130381867-130381889 CACCCCCAGCACTGCCATGAAGG + Intronic
1061758526 9:132833347-132833369 GCACCCGACAACTGCCATGATGG + Intronic
1061883514 9:133579469-133579491 CCACCCCAGAACCGACATGTGGG + Intronic
1186091019 X:6049175-6049197 CCACCCCAGAAATGCTATGTTGG + Intronic
1199340410 X:146670823-146670845 CGACCCCAGAAGTATCATAATGG + Intergenic
1199508610 X:148594491-148594513 CCACACCAAAACTACAATAAGGG + Intronic
1200139595 X:153892760-153892782 CCACCCCTGAACTGCTATTATGG + Intronic