ID: 1111940514

View in Genome Browser
Species Human (GRCh38)
Location 13:94602011-94602033
Sequence CTTCAGCAGCACCGCGGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111940510_1111940514 1 Left 1111940510 13:94601987-94602009 CCAGGGTAAGACCCTGCGGGGCA 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
1111940511_1111940514 -10 Left 1111940511 13:94601998-94602020 CCCTGCGGGGCAGCTTCAGCAGC 0: 1
1: 0
2: 0
3: 18
4: 170
Right 1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 167
1111940506_1111940514 12 Left 1111940506 13:94601976-94601998 CCGCAGGGCAGCCAGGGTAAGAC 0: 1
1: 0
2: 0
3: 22
4: 220
Right 1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111940514 Original CRISPR CTTCAGCAGCACCGCGGCCC AGG Exonic
900137557 1:1124825-1124847 CTGCAGCAGTGCCGTGGCCCAGG - Intergenic
900423438 1:2565472-2565494 TTTCAGCGGCACCGCTGTCCTGG + Intergenic
900488268 1:2933707-2933729 CTTGAGCAGGACCGGGGTCCCGG + Intergenic
900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG + Intronic
901231331 1:7643082-7643104 CTTCAGAAGCACCTGGACCCTGG - Intronic
903779782 1:25813948-25813970 CTTCATCAGCACCTGGTCCCTGG + Exonic
904442480 1:30540717-30540739 CTTCAGCTGCACCTGGGCCTGGG - Intergenic
907248297 1:53121822-53121844 CTTTGGCAGCCCCGCGTCCCAGG - Intronic
918305150 1:183239482-183239504 CATCAGCAGCAGCGCTCCCCAGG - Exonic
919899678 1:202034755-202034777 TTTCTGCAGCACCAGGGCCCTGG + Intergenic
920190469 1:204190589-204190611 CTGCACCAGCACCGCGCCCTGGG + Exonic
920786471 1:209047083-209047105 CTTCAGCAGCTCTCAGGCCCAGG - Intergenic
922327739 1:224544663-224544685 CCTCAGCAGCACAGCGGTCATGG - Intronic
1072163257 10:92787744-92787766 CTTCAGCAGCACGGAGGCACAGG - Intergenic
1076466709 10:130687741-130687763 CATGAGCAGCACCGCTGCACTGG - Intergenic
1076644705 10:131945081-131945103 CTACAGCAACGCCCCGGCCCAGG - Intronic
1076837147 10:133026907-133026929 ATCCAGAAGCACCGCGGCCCAGG + Intergenic
1077377461 11:2211760-2211782 CGTCAGCAGCACAGCTGCCATGG + Intergenic
1077555369 11:3223512-3223534 CTACAGCAGCTCTGTGGCCCTGG + Intergenic
1081812575 11:45922198-45922220 CTTCAGGTGCTCCGCGGCTCTGG + Intronic
1083291376 11:61692198-61692220 CTTCAGCATCACCTGGGACCAGG + Intronic
1083800134 11:65041735-65041757 CTGCAGCAGCACCGGGTCCGCGG - Exonic
1084067051 11:66710698-66710720 CTGCAGCAGCTCCGAGGCCAGGG + Exonic
1084181878 11:67450957-67450979 CTCCAGCAGGACTGAGGCCCAGG + Intergenic
1084213760 11:67635731-67635753 CTTCAGCAGCACCGGGAGGCAGG - Intronic
1084891074 11:72237475-72237497 CCTCAGCCCCACCACGGCCCCGG - Exonic
1085447376 11:76609894-76609916 CTTCAGCAGGGCCCAGGCCCAGG - Intergenic
1089153997 11:116386443-116386465 CTGCAGCAGCTCTGCGGCCCTGG + Intergenic
1090268886 11:125371733-125371755 CTTTAGCACCTCCGCGTCCCTGG - Intronic
1091135270 11:133182784-133182806 CTTCAGCACCACCGCGTTCCTGG - Intronic
1093095165 12:14963673-14963695 CATGAGCAGCAACACGGCCCTGG + Intergenic
1094375371 12:29783650-29783672 GGCCAGCAGCGCCGCGGCCCCGG + Exonic
1094411168 12:30170068-30170090 TGCCAGCAGCGCCGCGGCCCCGG + Intergenic
1095349310 12:41189532-41189554 CACCAGCATCCCCGCGGCCCTGG + Intronic
1096791390 12:54047344-54047366 CTGCAGCGGCCCCGCGGCGCGGG - Intronic
1097262325 12:57726682-57726704 CTTCTCCAGCACGGCTGCCCGGG - Exonic
1098898066 12:76084865-76084887 CTCCTGCAGCCCCGAGGCCCAGG + Exonic
1100277608 12:93085597-93085619 CTTCAGCGGGAACGTGGCCCTGG + Intergenic
1101870718 12:108563065-108563087 CTTCAGCCACTCCGCTGCCCTGG + Intronic
1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG + Exonic
1112799981 13:103099909-103099931 CTTCTGCAGCCCAGGGGCCCTGG + Intergenic
1113378581 13:109784621-109784643 CATCCGCTGCACCACGGCCCCGG - Exonic
1113756922 13:112818818-112818840 CTTGAGGAGCCCCCCGGCCCAGG + Intronic
1118466665 14:66037518-66037540 CATCAGCAGCACTGCCGCACTGG - Intergenic
1120030487 14:79635545-79635567 CTTCAGCAGGAATGTGGCCCTGG - Intronic
1120394069 14:83945148-83945170 CTTCAGCAGCACCCCATTCCTGG + Intergenic
1120780241 14:88479963-88479985 CTACAGCAGGCCCGCGGCGCTGG - Exonic
1121704605 14:95982153-95982175 CATCAGCAGCAGTGCTGCCCTGG + Intergenic
1121746097 14:96294455-96294477 CGGCAGCAGCACAGCGGACCTGG + Intronic
1122137897 14:99645218-99645240 CGCCAGCAGCGCCCCGGCCCTGG - Exonic
1122300810 14:100730083-100730105 CTTCAGAACCACGGCTGCCCTGG - Intronic
1122930926 14:104932790-104932812 CTTCAGCAGCACGGCGGGGGTGG + Exonic
1131977527 15:97961086-97961108 CTCGGCCAGCACCGCGGCCCTGG + Exonic
1132231794 15:100189928-100189950 CATCAGCATCACCGGGGCCTTGG + Intronic
1132657020 16:1045701-1045723 CTGCACCAGCACCGAAGCCCAGG + Intergenic
1132722830 16:1325422-1325444 CTGCAGCCCCACCGCGGGCCAGG + Exonic
1132765255 16:1531255-1531277 CTTCATCAGCCCCGAGGCACTGG + Intronic
1132869401 16:2109056-2109078 CTCCAACAGCCCCGCGGCCACGG + Exonic
1133054908 16:3141026-3141048 CTTCCGCAGCTCCTCGGACCTGG + Exonic
1133115753 16:3577151-3577173 CTGGAGCAGCATCGAGGCCCGGG - Exonic
1134046535 16:11104937-11104959 GTTCAGCAGCCCAGCAGCCCAGG - Intronic
1134134109 16:11668487-11668509 CCGCAGCAGCCCCGCGGGCCCGG - Exonic
1134718010 16:16366542-16366564 CTCCAACAGCCCCGCGGCCACGG - Intergenic
1134956741 16:18385617-18385639 CTCCAACAGCCCCGCGGCCACGG + Intergenic
1139467910 16:67164080-67164102 ACTCTGCAGCTCCGCGGCCCCGG + Exonic
1141964511 16:87432790-87432812 CTCCAGAGGCACCACGGCCCCGG + Intronic
1142237289 16:88928209-88928231 GTTCGGCAGCACTGGGGCCCGGG + Intronic
1142387583 16:89775754-89775776 CTTCAGCAGCAGAGCAGGCCTGG + Exonic
1142411564 16:89919581-89919603 CTGCTGCAGCACCGCAGCCCGGG - Exonic
1142870263 17:2815162-2815184 CATCAGCAGCACCTCAGCGCTGG - Intronic
1143107259 17:4535992-4536014 CTTCAGAAGTGCCACGGCCCGGG + Intronic
1144062773 17:11598675-11598697 CCTCGGCAGCATCGCGGCCCAGG - Exonic
1147726687 17:42569944-42569966 CTGCTGCAGCACCTCAGCCCTGG + Intronic
1148218107 17:45844948-45844970 CCTCATCAGCACCGTGGCCGGGG + Exonic
1151471371 17:74320111-74320133 CTTCAGCTTCACCTCAGCCCAGG - Intergenic
1151716580 17:75834247-75834269 CTCCAGCAGCACCTGGGCCAAGG - Intronic
1151728303 17:75896917-75896939 CTCCAGCAGCTGCGCGGCCATGG + Exonic
1152588500 17:81199676-81199698 ACTGAGCAGCACCGTGGCCCAGG - Intronic
1156858966 18:41814572-41814594 TTTCAGCAGCACCGCACTCCTGG + Intergenic
1157867223 18:51197293-51197315 CAGCGGCAGCTCCGCGGCCCTGG - Exonic
1159586899 18:70289723-70289745 CTTCAGCCGCAGAGCAGCCCCGG - Intronic
1160812677 19:1019772-1019794 CTTCAGCAGCCCCCAAGCCCCGG + Intronic
1162033936 19:7929256-7929278 CACCAGCAGCACCGCGTACCTGG - Intronic
1164633343 19:29775762-29775784 CTTCAGGAGCAGAGAGGCCCGGG - Intergenic
1165430268 19:35768033-35768055 CTGCAGCAGCAGGGCGGCCTGGG - Exonic
1165903240 19:39178485-39178507 CTTCAGCAGCTCGGCTGCCGTGG - Exonic
1166340780 19:42135361-42135383 CTTCAGCAGCGCCCAGGCCAGGG + Intronic
1166944217 19:46387282-46387304 CTTCACCAGCACATCTGCCCAGG - Intronic
1167668406 19:50836218-50836240 CTTCACCTCCACCGCGGCCTGGG + Intronic
925774976 2:7326223-7326245 CTTCAGCAGCACAGCTGTTCAGG - Intergenic
927697276 2:25246953-25246975 CTTGAGCAGAACGGAGGCCCAGG - Intronic
932770786 2:74499699-74499721 CTCCAGATCCACCGCGGCCCGGG - Exonic
933064278 2:77773897-77773919 TTTCAGCAGCACCTCGCTCCTGG + Intergenic
935594258 2:104867342-104867364 CTTCAGCAGCTCCCCCTCCCGGG - Intergenic
936047220 2:109197155-109197177 CTGCTGCAGCCCTGCGGCCCAGG + Intronic
936153567 2:110034656-110034678 CTGCAGCAGCCCCTGGGCCCAGG + Intergenic
936191114 2:110336759-110336781 CTGCAGCAGCCCCTGGGCCCAGG - Intergenic
938077359 2:128346853-128346875 CTCCAGCCGCTCCCCGGCCCGGG - Intergenic
938237404 2:129717442-129717464 CTTCAGCCGCACCCTGCCCCGGG + Intergenic
940897049 2:159090754-159090776 CTTCTGCAGCACAGTGGCGCTGG - Intronic
942329251 2:174804707-174804729 CTTCAGCAGCAGCGAGGACGAGG + Intronic
946980464 2:225208443-225208465 CTTGAGCACCACCGGAGCCCAGG + Intergenic
1172380257 20:34483767-34483789 CTTCAGCAGCACCCCACTCCTGG + Intronic
1172584673 20:36074518-36074540 TATCAGCAGCACCCCGTCCCTGG + Intergenic
1176069086 20:63216668-63216690 CTTCAGCCGCAGCGGAGCCCTGG + Intergenic
1176169876 20:63691961-63691983 CGTCAGCATCACAGCTGCCCTGG - Intronic
1176309588 21:5142582-5142604 CTTCAACAGCATGGTGGCCCTGG - Exonic
1177735716 21:25086228-25086250 CCTCAGCAGCACCGTAGCCAAGG + Intergenic
1178935708 21:36859825-36859847 CTTCAGCAGCAATGCTGCTCAGG + Intronic
1178942970 21:36922987-36923009 CACCACCAGCTCCGCGGCCCGGG + Intronic
1179421510 21:41240302-41240324 ATTCAGCAGCAGTGGGGCCCAGG - Intronic
1179847472 21:44119451-44119473 CTTCAACAGCATGGTGGCCCTGG + Exonic
1179880932 21:44293099-44293121 CTTCTGCAGCCCCGCTGCCAGGG + Exonic
1179882571 21:44299768-44299790 CTTCGCCAGCGCCGAGGCCCCGG - Intergenic
1181668667 22:24415257-24415279 CAGCAGCAGCACCCCAGCCCTGG - Exonic
1183727922 22:39599727-39599749 CCTCAGCAGCCCCGGGCCCCAGG + Intronic
1184724522 22:46335817-46335839 CCTCAGCAGCAGCGCGGCCACGG - Exonic
953623996 3:44555478-44555500 CTTCAGCAGCGCCGCTCACCTGG - Exonic
954264200 3:49460499-49460521 GGTCAGCAGCACTGAGGCCCTGG - Intergenic
956990087 3:74752271-74752293 CTGCAGCTGCACAGGGGCCCAGG + Intergenic
957362915 3:79182521-79182543 CTTCATCAGCACTGGGGCACAGG + Intronic
962708440 3:138066861-138066883 CTTCAGGTGCGCCGTGGCCCAGG - Intronic
962943353 3:140145629-140145651 CTTAAGCAGCACCTCTGCCCAGG + Intronic
965077798 3:164002000-164002022 CTTCAGCAGCTCCAGGGCTCTGG - Intergenic
966866102 3:184259972-184259994 CTTCAGCACCACGGCGGCCGCGG - Exonic
966919802 3:184604141-184604163 CTGCAGCAGCAGCGAGGCCTCGG - Intronic
967791917 3:193559046-193559068 CATCAGCATCCCCACGGCCCTGG - Intronic
968353251 3:198080402-198080424 CTTCCGCAGTTCCGCGTCCCTGG + Intergenic
973694506 4:53476823-53476845 CTGCAGCAGCCCAGCAGCCCTGG - Exonic
975216397 4:71760990-71761012 TTTCAGCAGCACCGCACTCCTGG - Intronic
977393832 4:96447850-96447872 TTTCAGCAGCACCGCAGTTCTGG - Intergenic
979540080 4:121870665-121870687 CTCCACCCTCACCGCGGCCCAGG + Intergenic
984643521 4:182196651-182196673 CTTCAGCAGAACCAGGGCACAGG - Intronic
986333702 5:6736989-6737011 CCTCAGGGGCCCCGCGGCCCAGG - Intronic
987102693 5:14606000-14606022 TTTCAGCAGCACCCCAGTCCTGG + Intronic
989173377 5:38495440-38495462 CTCCAGCAGCACTGCTGCCTGGG + Intronic
994353898 5:98774119-98774141 GTTGAGCAGCGCCGCAGCCCCGG + Exonic
998279515 5:140792103-140792125 CTTCAGAAGAAATGCGGCCCAGG - Intronic
1000285127 5:159820073-159820095 CTGCAGCAGCTCCAGGGCCCTGG + Intergenic
1001483792 5:172105656-172105678 CTCCAGCAGCTGCGCGGCACTGG + Exonic
1002163826 5:177332623-177332645 TTTCTGGAGCAGCGCGGCCCTGG + Intronic
1002194799 5:177496021-177496043 CTTCAGCCTCACTGCCGCCCAGG - Intronic
1002454183 5:179336918-179336940 CTTCAGCAGCACCCAGGCCTTGG + Intronic
1003571874 6:7261365-7261387 CCTCTGCAGCAGCGCAGCCCGGG + Intergenic
1004610700 6:17236712-17236734 CTTCAGCAGCACCGCCTGTCTGG - Intergenic
1007533538 6:42564255-42564277 CTGCAGCCTCACCTCGGCCCCGG - Exonic
1007577409 6:42934622-42934644 CTCCAGCAGCAACGCAGGCCAGG - Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1017989105 6:159470887-159470909 CTTGAGCAGCACCACCGCCGTGG + Intergenic
1018568908 6:165186498-165186520 CTTCACTGGCACCCCGGCCCTGG + Intergenic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1019527103 7:1485301-1485323 CGTCAGGAGCACCACAGCCCTGG - Exonic
1020275553 7:6622470-6622492 CTTCAGCCGCAGCACGGACCTGG + Exonic
1025155599 7:56603352-56603374 CTGCTGCAGCTCCGCGGGCCCGG - Intergenic
1028273805 7:88825599-88825621 CTTCAGCATCACTGTGTCCCTGG + Intronic
1030778376 7:113565339-113565361 CTTCCCCAGCACAGCAGCCCTGG - Intergenic
1037733465 8:21548652-21548674 CTCCAGCAGCAACGAGACCCTGG + Intergenic
1037901558 8:22692167-22692189 CTTCCCCAGCTCCCCGGCCCCGG + Intronic
1038539928 8:28383935-28383957 CTACAGCAGCTCCAAGGCCCTGG + Intronic
1039733492 8:40305306-40305328 GTTCAGCAGCACCCAGGCGCAGG + Intergenic
1040077120 8:43247276-43247298 CTTCCGCAGTTCCGCGTCCCAGG - Intergenic
1042761409 8:72275665-72275687 CTTCAGCAGCACCCCACACCTGG - Intergenic
1049180999 8:141222131-141222153 CTTCAGCAGCCCTGAGGCCCTGG - Intronic
1049250990 8:141588893-141588915 TTCCAGCAGCACCTCGCCCCAGG - Intergenic
1049283318 8:141761567-141761589 CCTCAGCAGCACCTAGGCCAGGG + Intergenic
1049388057 8:142354201-142354223 CTGCACCAGCTGCGCGGCCCTGG + Intronic
1049683578 8:143930456-143930478 CTTCAGCTGCACGACGGCCTTGG + Exonic
1056381012 9:86057506-86057528 CCTCAGCTGCACCCCGGCTCGGG - Intronic
1056475092 9:86945873-86945895 ATGCAGCAGCGCCGCTGCCCGGG + Exonic
1056532330 9:87498274-87498296 CTTCCCCAGCCCCGCGGGCCGGG + Intronic
1057762859 9:97890616-97890638 CCTCAGCAGCACTAGGGCCCTGG - Intergenic
1058604682 9:106707760-106707782 TTTCAGAAGCACCAAGGCCCTGG + Intergenic
1061378113 9:130238078-130238100 CCGCAGCAGCAGCGCAGCCCAGG - Intergenic
1061845812 9:133387391-133387413 CTGCAGAAGCACCGGGGCCTGGG + Intronic
1062283750 9:135763825-135763847 CTTCATCCTCACGGCGGCCCTGG + Intronic
1062556294 9:137114678-137114700 CAGCAGCAGGACCGGGGCCCAGG + Exonic
1187055346 X:15737526-15737548 CCTCAGCAGCAACGGGGCACTGG + Intronic
1190984413 X:55488505-55488527 CCCCACCCGCACCGCGGCCCAGG - Exonic
1191220824 X:57986054-57986076 CTTCTTCACAACCGCGGCCCTGG - Intergenic
1196782957 X:119399481-119399503 CCTCAGCCTCACCGCGCCCCTGG + Exonic
1199976519 X:152897872-152897894 CTCCAGCAGCCCCGCGGGGCGGG + Intergenic