ID: 1111946059

View in Genome Browser
Species Human (GRCh38)
Location 13:94667260-94667282
Sequence GACTCCCCCATGTCTCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111946058_1111946059 8 Left 1111946058 13:94667229-94667251 CCTATTTTTTTTGTAACACTGTT No data
Right 1111946059 13:94667260-94667282 GACTCCCCCATGTCTCTGAGTGG No data
1111946056_1111946059 16 Left 1111946056 13:94667221-94667243 CCTTGGTCCCTATTTTTTTTGTA No data
Right 1111946059 13:94667260-94667282 GACTCCCCCATGTCTCTGAGTGG No data
1111946057_1111946059 9 Left 1111946057 13:94667228-94667250 CCCTATTTTTTTTGTAACACTGT No data
Right 1111946059 13:94667260-94667282 GACTCCCCCATGTCTCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111946059 Original CRISPR GACTCCCCCATGTCTCTGAG TGG Intergenic
No off target data available for this crispr