ID: 1111947493

View in Genome Browser
Species Human (GRCh38)
Location 13:94681218-94681240
Sequence GGGAAAAAAGCAGTGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111947488_1111947493 -3 Left 1111947488 13:94681198-94681220 CCAACCAACAAGTAACTCTGGGG No data
Right 1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG No data
1111947490_1111947493 -7 Left 1111947490 13:94681202-94681224 CCAACAAGTAACTCTGGGGAAAA No data
Right 1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG No data
1111947484_1111947493 1 Left 1111947484 13:94681194-94681216 CCCACCAACCAACAAGTAACTCT No data
Right 1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG No data
1111947485_1111947493 0 Left 1111947485 13:94681195-94681217 CCACCAACCAACAAGTAACTCTG No data
Right 1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111947493 Original CRISPR GGGAAAAAAGCAGTGGAGGA TGG Intergenic
No off target data available for this crispr