ID: 1111950868

View in Genome Browser
Species Human (GRCh38)
Location 13:94708100-94708122
Sequence AGGGCGTAGAGAAAGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111950868 Original CRISPR AGGGCGTAGAGAAAGGCCCG GGG (reversed) Intergenic
901551262 1:9997571-9997593 AGGGCGTGGAGAGACGGCCGTGG - Intronic
902410045 1:16207098-16207120 AGGGCGCAGAGGAGGGGCCGGGG - Exonic
903638447 1:24837889-24837911 AGGGCCTAGAGAAAGCCCTAAGG - Intronic
904212293 1:28893913-28893935 GAGGCGTAAAGAGAGGCCCGGGG + Intronic
904381177 1:30112121-30112143 ATGGGGCAGAGAAAGGCCAGTGG - Intergenic
904749194 1:32730486-32730508 AATGCGTAGAAAAAGGCCAGAGG + Intergenic
904768952 1:32870562-32870584 AGGGGGCAGAGAAAGGACCAGGG + Intronic
907715791 1:56924773-56924795 AAGGGGCAGAGAAAGGCCCTTGG - Intergenic
911096839 1:94061956-94061978 GGGTGGTAGAGAAAGGGCCGGGG - Intronic
913449479 1:118983474-118983496 AGTGCGCAGAAAAAGGCCCTTGG + Intronic
914835462 1:151203063-151203085 AGGGCATAAAGTAAGGCCAGCGG - Intronic
915971577 1:160358756-160358778 AGGGCCTGGAGAAAGGACAGTGG - Exonic
916018760 1:160775149-160775171 GGGGAGTGGAGAAAGGCCTGAGG + Intergenic
918171774 1:182004250-182004272 AGCGCGTAGAGAAAGACCATAGG - Intergenic
921748510 1:218765822-218765844 AAAACCTAGAGAAAGGCCCGGGG + Intergenic
922416326 1:225426748-225426770 AGGGCGCGGAGCAAGGCCCGGGG - Intronic
1065287120 10:24196784-24196806 GGTGCGTAGAGACAGGGCCGAGG + Intronic
1067550767 10:47234303-47234325 AGGGCATAGAGAGAGGCACTAGG + Intergenic
1077524564 11:3056740-3056762 AGGGGGGAGACAAAGGCCCAAGG - Intronic
1079830071 11:25253723-25253745 AGAGTGTAGAGAAAGGCCCTGGG + Intergenic
1081749873 11:45502208-45502230 AGGGCCTAGAAAAGGGCCCATGG + Intergenic
1083248056 11:61445241-61445263 AGGGTGTAGAGAAAGGTCAGGGG + Intronic
1085531282 11:77193706-77193728 AGGGCATAGAGAAAGGCTCTTGG - Intronic
1090731115 11:129574085-129574107 AGGGCTTAGAGCATGGCCTGGGG + Intergenic
1098819330 12:75208625-75208647 AGGGAGTAGAGAGGGGTCCGGGG - Intronic
1100616416 12:96234940-96234962 AGGGAGGAGAGACAGGCCCCCGG + Intronic
1101414475 12:104497386-104497408 AGGCCGAAGAGAAAGGCCCCAGG + Intronic
1101761241 12:107660620-107660642 AGGGTGTAGAGGAAAGCGCGGGG + Intergenic
1102429134 12:112868010-112868032 AGGGCCAGGAGAAAGGCCAGAGG + Intronic
1103897923 12:124286210-124286232 ATGGGGCAGAGAAAGACCCGTGG - Intronic
1104300326 12:127559205-127559227 AGGACCTAGAGAAAGGCCAGTGG + Intergenic
1106512207 13:30421823-30421845 AGGGGGTGGAGAAGGGACCGGGG + Intergenic
1110174001 13:72535096-72535118 AGGGCATAAAGAAGGGCCAGAGG - Intergenic
1111950868 13:94708100-94708122 AGGGCGTAGAGAAAGGCCCGGGG - Intergenic
1115521068 14:34233595-34233617 AGGGCCTAGAGAAGGGTCTGGGG - Intronic
1118796933 14:69152645-69152667 AGGGGGTAGAGAAAGGGAGGGGG + Intronic
1120813096 14:88824902-88824924 AGGCCGGGGAGGAAGGCCCGAGG + Intronic
1122349038 14:101077250-101077272 AGGGGGTAGAGGAATGCCGGCGG + Intergenic
1122838716 14:104444008-104444030 AGGGCCTAGAGAAGAGCCCAGGG + Intergenic
1124942703 15:34232945-34232967 AGGGCATAAAAAAAGGCGCGGGG + Intronic
1127791952 15:62406001-62406023 AGGGCCTAGAGTAAGCCCTGGGG + Intronic
1140320506 16:73946763-73946785 TGGGGGTAGGGAAGGGCCCGGGG - Intergenic
1141195956 16:81861507-81861529 AGGACGGAGAGAAAGGCAGGTGG - Intronic
1144812066 17:18006857-18006879 AGGGAGTCGAGGAAGGCCCAGGG + Intronic
1144860930 17:18301412-18301434 AAGGGATAGAGAAAGGCCGGAGG - Intronic
1145018509 17:19413548-19413570 AGGGGGTAGGGAAAGACCCAAGG - Intronic
1145250215 17:21293341-21293363 AGGACGTAGGGAAGGGCCAGAGG - Intronic
1146000909 17:29129787-29129809 AGGGCCTAGATTAAGGCCCTTGG - Intronic
1146472906 17:33138908-33138930 AGTGGTTAGAGAAAGGCCCTGGG + Intronic
1147056899 17:37841760-37841782 CGGGAGTAGAGAAAGGCAGGGGG - Intergenic
1148394272 17:47295751-47295773 AGGGTGTAGTGAAAGGCCGGGGG + Intronic
1151341840 17:73476808-73476830 AGGGCCATGAGGAAGGCCCGTGG + Intronic
1160543501 18:79638232-79638254 CGGGCGGAGAGCAGGGCCCGAGG - Intergenic
1160672176 19:370866-370888 AGGGCGTAGAGCGAGGTCAGTGG + Intronic
1165784123 19:38451194-38451216 AGGGCGTAGAGACGGGGCCTGGG + Intronic
1167380199 19:49133964-49133986 GGGGCTTAGAGGAAGGGCCGTGG + Intronic
1168591952 19:57643728-57643750 AGAGCTTAGAAAAAGGCCTGAGG - Intergenic
925882955 2:8368291-8368313 AGGGCGAAGAGGAAGACCCCAGG - Intergenic
935061684 2:99614130-99614152 TGGGAGTAGAGAATGGCCTGGGG + Intronic
937700947 2:124862512-124862534 AGGGGGTAGAGGAAGGCCTGAGG + Intronic
941360429 2:164544785-164544807 AGGGGATAGAGTAAGGCCTGTGG - Intronic
946025996 2:216671998-216672020 AGGGGATGGAGAAAGGCCCCCGG - Intergenic
947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG + Intronic
1170765317 20:19285000-19285022 AGGGAGTAGAGGAAGGCTTGAGG - Intronic
1170859466 20:20089277-20089299 AGGGAGGAGAGCAAGGCCCATGG - Intronic
1172597056 20:36156723-36156745 AGGGCTGAGAGAAAGGGCCGTGG + Intronic
1173224778 20:41156012-41156034 AGGGAGCAGAGCAAGGCCCCAGG + Intronic
1174047880 20:47746599-47746621 AGAGGGGAGAGAAAGGCCTGGGG + Intronic
1179464797 21:41564452-41564474 AAGGCAGAGAGAAAGGCACGTGG + Intergenic
1180889720 22:19278062-19278084 GGCGCATAGAGAAAGGCGCGAGG + Intronic
1181938718 22:26458088-26458110 GGGGCAGAGACAAAGGCCCGGGG + Intronic
1184817770 22:46885058-46885080 AGCGTGTGGAGAAAGGACCGTGG + Intronic
960399656 3:117180596-117180618 AGGCCATAGAGAAGGGCCCCTGG - Intergenic
961650483 3:128414413-128414435 TGGGGGTAGAGAAAGGCAAGGGG + Intergenic
961810134 3:129517442-129517464 AGGGCATAGAGAAAGGGCTGAGG - Intronic
968460417 4:721893-721915 TGGGCGTGGAGAGAGGCCTGTGG + Intronic
970445015 4:16116152-16116174 AGGCAGTCGAGAAAGGCCTGGGG - Intergenic
973344146 4:49036287-49036309 AGGGCATAGAGAAAGGACAGAGG + Intronic
976391674 4:84511986-84512008 AGGGCCGAGAGAAAGGACCATGG + Intergenic
982176233 4:152707938-152707960 AGGAAATAGAGAAAGGCCCCAGG + Intronic
984952286 4:185016733-185016755 AGGGCGCAGAGCCAGGCCTGGGG - Intergenic
985791605 5:1931181-1931203 ACGGCGGAGGGAGAGGCCCGGGG - Intergenic
986741681 5:10710584-10710606 AGGGTGCAGAGGAAGGCACGAGG + Intronic
991558519 5:67923361-67923383 AGGGCTGAGAGAAAGACCCTAGG - Intergenic
991999311 5:72419470-72419492 ATGGCCTAGAGAAAGGTCAGAGG - Intergenic
998103962 5:139456747-139456769 GGGGCGTAGAGACAGGACCTTGG - Intronic
1001523585 5:172413145-172413167 AGGAAGTGGAGAAAGGCCTGGGG + Intronic
1002173737 5:177389830-177389852 CAGCCGTAGAGAAAGGCCCAAGG - Intronic
1005510786 6:26509899-26509921 AGGGCGCAGAGAAAGGAACAGGG - Exonic
1010995419 6:82526430-82526452 AGGGAGAAGAGAAAGGACCTGGG - Intergenic
1015830738 6:137366094-137366116 AGGGAGGAGAGAAAGGAGCGGGG - Intergenic
1022420921 7:30222752-30222774 AGGAGGTGGAGAAAGGCCCAGGG + Intergenic
1022446577 7:30475653-30475675 ATGGCGAAGAGAAGGGCCGGTGG + Intronic
1025777107 7:64569453-64569475 AGGGCGGAGAGGAGGGCCAGGGG + Intergenic
1035243881 7:157550090-157550112 CGGCCGGAGAGAAAGGCCTGGGG - Intronic
1035913947 8:3598536-3598558 AGAGCGTAGAGGAAGGCTCAGGG - Intronic
1036218843 8:6903630-6903652 AGGGGGAAGAGAAAGGACAGGGG + Intergenic
1044712700 8:95072885-95072907 TGGGGGAAGAGCAAGGCCCGAGG + Intronic
1045653983 8:104367961-104367983 CGGGCGTAGAGAGAGTCCCTTGG + Intronic
1047903604 8:129449683-129449705 AGAGGGTAGAGAGAGGCCAGGGG - Intergenic
1049469859 8:142770504-142770526 AGGGGGGACAGAAAGGCCCTTGG + Intronic
1049657578 8:143805540-143805562 AGGGCGAGGGGAAAGGCCCCAGG + Intronic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1056374227 9:85991204-85991226 AGGGAGTAGAGAGAGGCATGGGG + Intronic
1059012419 9:110476650-110476672 AGGGCATAGAGGAAGGCTTGGGG - Intronic
1061901187 9:133672872-133672894 AGGCAGGAGAGAAAGGCCTGTGG + Intronic
1187219307 X:17308237-17308259 AGGAAGTAGAGGAAGGCCCTGGG - Intergenic
1188930051 X:36097903-36097925 AGGAGGTAGAGAAAGAGCCGGGG - Intronic
1189069397 X:37847604-37847626 ATTGCGTAGGGAAAGGCCCTAGG - Exonic
1200832461 Y:7700331-7700353 AGGGCATAGAGGAAGGACCAGGG + Intergenic