ID: 1111951854

View in Genome Browser
Species Human (GRCh38)
Location 13:94713781-94713803
Sequence AGAAGGCGGCGGGCACGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111951847_1111951854 -1 Left 1111951847 13:94713759-94713781 CCTGGAATCCTCGCCGGGAGGAA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1111951854 13:94713781-94713803 AGAAGGCGGCGGGCACGAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 101
1111951849_1111951854 -9 Left 1111951849 13:94713767-94713789 CCTCGCCGGGAGGAAGAAGGCGG 0: 1
1: 0
2: 0
3: 15
4: 129
Right 1111951854 13:94713781-94713803 AGAAGGCGGCGGGCACGAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 101
1111951841_1111951854 12 Left 1111951841 13:94713746-94713768 CCCTGGTTGTGGCCCTGGAATCC 0: 1
1: 0
2: 2
3: 28
4: 498
Right 1111951854 13:94713781-94713803 AGAAGGCGGCGGGCACGAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 101
1111951842_1111951854 11 Left 1111951842 13:94713747-94713769 CCTGGTTGTGGCCCTGGAATCCT 0: 1
1: 0
2: 2
3: 21
4: 148
Right 1111951854 13:94713781-94713803 AGAAGGCGGCGGGCACGAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 101
1111951838_1111951854 27 Left 1111951838 13:94713731-94713753 CCTGGCGTGCAGCTGCCCTGGTT 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1111951854 13:94713781-94713803 AGAAGGCGGCGGGCACGAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 101
1111951846_1111951854 0 Left 1111951846 13:94713758-94713780 CCCTGGAATCCTCGCCGGGAGGA 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1111951854 13:94713781-94713803 AGAAGGCGGCGGGCACGAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111951854 Original CRISPR AGAAGGCGGCGGGCACGAGT AGG Intergenic