ID: 1111954497

View in Genome Browser
Species Human (GRCh38)
Location 13:94741801-94741823
Sequence AAGGAGAAGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8450
Summary {0: 25, 1: 106, 2: 378, 3: 1647, 4: 6294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111954490_1111954497 27 Left 1111954490 13:94741751-94741773 CCAACTGCATTTTCTGGGGGCAT No data
Right 1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG 0: 25
1: 106
2: 378
3: 1647
4: 6294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111954497 Original CRISPR AAGGAGAAGGAGAAGGAGAA GGG Intergenic
Too many off-targets to display for this crispr