ID: 1111954655

View in Genome Browser
Species Human (GRCh38)
Location 13:94743100-94743122
Sequence CATTATAGGCAGAATATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111954650_1111954655 28 Left 1111954650 13:94743049-94743071 CCCATTGTCAAAGGAATCTGGGA No data
Right 1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG No data
1111954651_1111954655 27 Left 1111954651 13:94743050-94743072 CCATTGTCAAAGGAATCTGGGAA No data
Right 1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111954655 Original CRISPR CATTATAGGCAGAATATGGA AGG Intergenic
No off target data available for this crispr