ID: 1111955936

View in Genome Browser
Species Human (GRCh38)
Location 13:94758505-94758527
Sequence AAAGATAGAACAGACTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111955936_1111955941 29 Left 1111955936 13:94758505-94758527 CCTCCCCAGTCTGTTCTATCTTT 0: 1
1: 0
2: 0
3: 31
4: 340
Right 1111955941 13:94758557-94758579 TGAAGTCTATGCTCTGCTTCAGG 0: 4
1: 0
2: 2
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111955936 Original CRISPR AAAGATAGAACAGACTGGGG AGG (reversed) Intergenic
900110877 1:1005092-1005114 AAGGAGAGAACAGACAGGGGAGG - Intergenic
901328826 1:8388613-8388635 TAAGATTGCACAGACTGGGCCGG - Intronic
901371513 1:8802211-8802233 AAAGAAGGAACAGACTGGTTTGG - Intronic
902108566 1:14058726-14058748 AAATAAAGAACAGAAAGGGGAGG + Intergenic
902274308 1:15328222-15328244 AAAGATGTAACATACAGGGGTGG - Intronic
902852401 1:19170401-19170423 GAAGAGAGAAGAGAGTGGGGAGG + Intronic
905230404 1:36511642-36511664 AAGGATACAACGGACTTGGGGGG + Intergenic
905844469 1:41216936-41216958 GAAGATAGAAGAGACAGGGAAGG - Intronic
906594964 1:47067724-47067746 AAAAACAGCACAGACTGGTGGGG + Intronic
906672811 1:47669229-47669251 AAGGCGAGAATAGACTGGGGAGG - Intergenic
906935329 1:50209521-50209543 AAGGATAGAACAGACTTGGACGG + Intergenic
907347079 1:53791052-53791074 AAAGATAACAGAGACTGGGAAGG - Intronic
908584734 1:65555171-65555193 AAAAAAAGAACAGGCGGGGGTGG - Intronic
908832344 1:68191836-68191858 AAAGAGAGAAAAGCCTGGTGAGG - Intronic
910148713 1:84114700-84114722 ATAGATAGCAGAGACTGGGAAGG - Intronic
910611231 1:89144531-89144553 AAAAATAGCACATACTGGTGAGG - Intronic
912602660 1:110953235-110953257 GAAGACAGAACAGATTGAGGGGG - Intronic
913172984 1:116249071-116249093 AAAGATATAGCAGAATGGGAGGG - Intergenic
913445262 1:118944175-118944197 AAAGACAGGAGAGACTTGGGAGG - Intronic
914311080 1:146467585-146467607 AGGGAGAAAACAGACTGGGGGGG - Intergenic
916824471 1:168430636-168430658 AAAGATTGAGCCAACTGGGGTGG + Intergenic
917304140 1:173609474-173609496 AAATATAAAACAGAATGGGAGGG + Intergenic
917874361 1:179272179-179272201 AAAGATAAAACAGACTAAGTGGG + Intergenic
918437846 1:184534852-184534874 AAATATGGAAGAGATTGGGGCGG + Intronic
919111827 1:193229613-193229635 AGAAATAGCACAGACTGGGGTGG - Intronic
919755055 1:201061484-201061506 GAAGAGAGGACAGACTGGGTGGG + Intronic
919854179 1:201694430-201694452 AAAGATAGATGACCCTGGGGAGG + Intronic
920624794 1:207586431-207586453 AAAGATAGAACAAAATAGGCTGG - Intronic
920655622 1:207872495-207872517 CAAGATAGGAAAGAATGGGGTGG + Intergenic
921309647 1:213830265-213830287 AAAGAAAAAACATACTGGGCGGG + Intergenic
921347529 1:214202501-214202523 ATAGTTAGAACCTACTGGGGAGG + Intergenic
924579788 1:245313893-245313915 CATGAAAGAAGAGACTGGGGAGG - Intronic
924719669 1:246610305-246610327 AAATATAAAAAAGAATGGGGAGG - Intronic
1063858938 10:10287764-10287786 AAAGAATGAACAGTCTGGTGGGG - Intergenic
1064374199 10:14780889-14780911 AAAGATGGAACAGTGTTGGGAGG + Intergenic
1064602696 10:17009529-17009551 AAGGCTAGAACAGCCTGGAGGGG + Intronic
1064880569 10:20048376-20048398 GAATATAGAAAAAACTGGGGTGG - Intronic
1065660752 10:28002062-28002084 CAAGGTATCACAGACTGGGGCGG + Intergenic
1069026584 10:63549275-63549297 AAAGAAAGAACAGCCAGGTGTGG + Intronic
1070127857 10:73636224-73636246 AAAGAAAGAGGAGACTGGAGAGG - Intronic
1070647412 10:78211341-78211363 ACAGATAGAAAAGACTGGGAGGG - Intergenic
1070807785 10:79280632-79280654 AAAAAAAGAACAGAGTGGGTAGG - Intronic
1071278803 10:84080734-84080756 AAAGAAAGAACAGATGGGTGCGG - Intergenic
1071290870 10:84188136-84188158 ACAGATAGGACAGGCTAGGGCGG - Intergenic
1071950121 10:90693704-90693726 AAACAATCAACAGACTGGGGAGG - Intergenic
1072133617 10:92521539-92521561 AAAGACATATCAGACTGGAGTGG + Intronic
1072519095 10:96214500-96214522 AAAGAAAGCCCAGACTAGGGTGG + Intronic
1073430354 10:103482272-103482294 AAAGAAAGAACTGTCAGGGGAGG - Intergenic
1074992756 10:118725175-118725197 AAAGAAAGAACAGCCGGGAGTGG + Intronic
1075767983 10:124909806-124909828 AAAGATACAACAGCCAGGCGCGG + Intergenic
1076485950 10:130817218-130817240 AAGCACAGAACAGCCTGGGGTGG + Intergenic
1080264716 11:30388653-30388675 GAAGAGGAAACAGACTGGGGAGG - Intronic
1080726828 11:34906389-34906411 ACTGAAAGAGCAGACTGGGGAGG + Intronic
1080855983 11:36111891-36111913 AAAGATGAACCAGACTGGGCCGG - Intronic
1081225347 11:40514720-40514742 AGAGATAGAAGAAAGTGGGGAGG - Intronic
1081715291 11:45245878-45245900 GAAGAGAGAAGAGACTGGGGTGG + Intronic
1082921212 11:58496347-58496369 AAAGGTAGAACATGATGGGGAGG + Intergenic
1083466864 11:62853351-62853373 ACACATTGATCAGACTGGGGCGG + Intergenic
1084503637 11:69552084-69552106 AATGATAAACCAGGCTGGGGTGG + Intergenic
1085205577 11:74730386-74730408 AAAGAGAGAAAAGAATGGGAAGG + Intronic
1085209993 11:74767831-74767853 AAAAATAAAAAAGAATGGGGAGG - Intronic
1089820405 11:121220638-121220660 ATAGAAAGGCCAGACTGGGGAGG - Intergenic
1090259198 11:125306438-125306460 AAAGAAAGGACAGAGTGGGAAGG - Intronic
1091157380 11:133386197-133386219 AAAGAAAGAAAAAACTGGGTTGG - Intronic
1091704546 12:2685036-2685058 AAAAATAGAACAGACTAAAGTGG + Intronic
1091711117 12:2741373-2741395 AAAAATAGAACAGACTAAAGTGG + Intergenic
1091912654 12:4244428-4244450 GAAGTTAGAAAAGACTGGGAAGG + Intergenic
1093461671 12:19412838-19412860 AAAGAAATAAAAGAATGGGGAGG + Intronic
1094478845 12:30864056-30864078 AAAGGCAGGACTGACTGGGGGGG - Intergenic
1094569299 12:31627733-31627755 AAAGAGAGAAAAGAATGAGGGGG + Intergenic
1096033630 12:48443827-48443849 AAAGATAGAGCAGAATAGGAAGG - Intergenic
1096264098 12:50110260-50110282 AAAGGTCGCACAGAGTGGGGAGG - Exonic
1096302927 12:50447860-50447882 AAAAATAGAAAAAAATGGGGGGG - Intronic
1096693674 12:53335771-53335793 AAAGTTAGAAGGGACCGGGGTGG + Intronic
1098574022 12:72020414-72020436 AAAGATGGAACAGAGTAAGGAGG + Intronic
1099119047 12:78665033-78665055 AAAGATAAAACCGTGTGGGGTGG - Intergenic
1099192997 12:79580028-79580050 AAAGATACTAGAGACTGGGAAGG + Intronic
1099306038 12:80957363-80957385 AAACAAGGAACAGACTGGGATGG - Intronic
1099684443 12:85866635-85866657 CAAGAAAGTACAAACTGGGGTGG - Intergenic
1099947421 12:89260336-89260358 AAAGATAGAAGATACTGGCTAGG - Intergenic
1101059967 12:100960492-100960514 ATAAATATAACAGACTGAGGAGG + Intronic
1102096475 12:110245493-110245515 AAAGAGAGATCAGACTGGAAGGG - Intergenic
1102874966 12:116442167-116442189 AGAGAGAGAGCAGAGTGGGGAGG + Intergenic
1102929602 12:116852150-116852172 AATAAGAGAACAGACTTGGGAGG - Intronic
1103685936 12:122731898-122731920 AAAGAAAGAAGAAAATGGGGTGG + Intergenic
1104071390 12:125349250-125349272 AAAGACAGCACAGAGTGGGGAGG - Intronic
1104399822 12:128466083-128466105 AAAGACAGAACAGGGTGGGGAGG + Intronic
1104663557 12:130630893-130630915 TAAGAAAGAACAGGCTGCGGAGG - Intronic
1105784303 13:23733445-23733467 AAAGGAAGGACAGACTGGGCTGG + Intronic
1106632046 13:31484697-31484719 ACACAAAGAACAGAGTGGGGTGG - Intergenic
1109862150 13:68214000-68214022 AAAGGAAGAACAAAGTGGGGAGG - Intergenic
1111249111 13:85580323-85580345 AAAGATAGAACAGATTGCAGAGG + Intergenic
1111955936 13:94758505-94758527 AAAGATAGAACAGACTGGGGAGG - Intergenic
1112488293 13:99839629-99839651 AGAGACAGAACAGAGTGGTGGGG + Intronic
1112620728 13:101051446-101051468 TAAGACAGAAAAGAATGGGGAGG + Intergenic
1112809468 13:103200828-103200850 AAAGATGGCAGAGACTGGAGTGG + Intergenic
1114288908 14:21271713-21271735 AAAGAAAGAAAAGACAGGGCTGG - Intergenic
1114343360 14:21768806-21768828 AAAGATAGAACAGAATTCCGAGG + Intergenic
1115027865 14:28764927-28764949 AAAGAGAGAAAAGGTTGGGGGGG - Intergenic
1115196003 14:30800005-30800027 ATACGTAGAACAGACTGGTGAGG - Intergenic
1115404722 14:33001653-33001675 AAAGAAAGAACAGGCTGAAGAGG - Intronic
1115692254 14:35856859-35856881 AAAAATAGGCCAGGCTGGGGCGG - Intronic
1117772373 14:59147289-59147311 AACAATAGAACAGAGTGTGGTGG + Intergenic
1117967577 14:61221498-61221520 AAGGAGAGAAAAGAATGGGGAGG - Intronic
1118697700 14:68400645-68400667 ACAGATAGAACACACTGTGGGGG + Intronic
1120368238 14:83598010-83598032 AAATAGATAACAGACTGGGCAGG + Intergenic
1120817105 14:88872679-88872701 TAAGATAGGGTAGACTGGGGAGG - Intronic
1121577628 14:95001369-95001391 AAAGAAGGAACAGATTGGTGGGG + Intergenic
1123111459 14:105869413-105869435 TAAGATAGAAATGACTGTGGGGG - Intergenic
1126006694 15:44264696-44264718 ACAGAGATAACAGAGTGGGGAGG - Intergenic
1126172043 15:45703181-45703203 CAAAACACAACAGACTGGGGTGG - Intergenic
1126731802 15:51691220-51691242 AAAAAGAGAAGAGACTGGGGAGG + Intronic
1128533369 15:68470499-68470521 GAAGTCAGAACAGGCTGGGGAGG + Intergenic
1129667135 15:77585480-77585502 CAGGATAGAACAGACTGGGAGGG - Intergenic
1130004255 15:80079514-80079536 AAAGAAAGAACAGAGTAGGCCGG - Intronic
1130197482 15:81794213-81794235 AAATCTAGAACAGAGTGGTGAGG + Intergenic
1130221181 15:82020921-82020943 AAAGATTGCTCAGAGTGGGGAGG - Intergenic
1130335674 15:82955070-82955092 AAAAATAGAACAGAATGGGCCGG - Intronic
1130385837 15:83411175-83411197 AAAGATAGAACAGACAGGCTGGG - Intergenic
1131995454 15:98128529-98128551 ACAGACAGAACACAATGGGGTGG - Intergenic
1132084028 15:98891834-98891856 AAATATAAAACAAACTGGTGAGG - Intronic
1134076218 16:11293327-11293349 AAAAATAGACGAGACTGAGGAGG + Intronic
1134095181 16:11414293-11414315 ACAGAGAGAACAGAATGTGGAGG + Intronic
1134134942 16:11671773-11671795 AAAGGAAGAACAGACAGGTGGGG + Intronic
1137926444 16:52546509-52546531 AAAGGTAGAAGAGACATGGGAGG + Intronic
1142618748 17:1152297-1152319 AAAGACAGGACAGGCTGGGCTGG + Intronic
1144142213 17:12360668-12360690 AAAGAGAGAAGACACTGGAGAGG + Intergenic
1146644323 17:34567044-34567066 AGGGAAAGAACAGGCTGGGGAGG - Intergenic
1148915943 17:50978890-50978912 AGGCAGAGAACAGACTGGGGTGG + Intronic
1149180590 17:53931919-53931941 AAAGAGAGAAGAGAGTGGGAAGG - Intergenic
1150222870 17:63507207-63507229 AAAGAGAGGAGAGGCTGGGGTGG - Intronic
1150750021 17:67852837-67852859 AAAAATAGATCAGAATGGGCCGG + Intronic
1151175748 17:72286705-72286727 AAAAATAAAAAAGACTTGGGTGG + Intergenic
1152300890 17:79494965-79494987 AAAGATGGGGCAGACTTGGGTGG - Intronic
1153144676 18:2017457-2017479 AAATAGAGAACAGACATGGGTGG + Intergenic
1154268880 18:12902117-12902139 AAAGAAAGAGCTGGCTGGGGTGG - Intronic
1154955530 18:21250783-21250805 AAAAATAGAACAGACTGTATGGG - Intronic
1155086570 18:22464545-22464567 ACAGATAGATTAGAGTGGGGAGG - Intergenic
1156054971 18:32991452-32991474 AAAGATAAAAAAGTCTGTGGAGG + Intronic
1156418783 18:36927774-36927796 AAAGAAAGAAATGAGTGGGGTGG + Intronic
1156486106 18:37466693-37466715 AAAGAGAGCACAGTCTAGGGTGG + Intronic
1158479280 18:57805883-57805905 AAAAATAGAACAGGCTGGACTGG + Intergenic
1158721074 18:59925242-59925264 CAAAATATCACAGACTGGGGGGG - Intergenic
1158815866 18:61096140-61096162 AAAGATGAAAAAGATTGGGGTGG - Intergenic
1158825346 18:61212422-61212444 AAAGATAGAACTGACAGAAGAGG + Intergenic
1159776438 18:72608338-72608360 AAAGGAAGAACAGAGCGGGGAGG - Intronic
1160032879 18:75278136-75278158 AAAGACAGAGTAAACTGGGGTGG - Intronic
1160322514 18:77909730-77909752 AAAGATAGTACAGAATCAGGAGG + Intergenic
1160492776 18:79351859-79351881 AGAGACAGGACAGCCTGGGGAGG + Intronic
1160976398 19:1794794-1794816 AAAGAGAGACCAGGCTGGAGAGG + Intronic
1161033782 19:2072767-2072789 AAAAATGGAAGAGATTGGGGAGG + Exonic
1161943986 19:7423007-7423029 AAAGTTAAAACAGCCTGGTGGGG - Intronic
1162273545 19:9635596-9635618 ACAGCTAGAACAGAATGGTGGGG + Intronic
1162719521 19:12654013-12654035 AAAAAAAGAAAAGGCTGGGGTGG - Intronic
1164408985 19:27981646-27981668 ACAGACAGAACAGAATGTGGGGG - Intergenic
1164451317 19:28367856-28367878 AAGGATAGAACAGACTCTGAAGG - Intergenic
1166636141 19:44453131-44453153 AGAGATGGAACACATTGGGGAGG + Intergenic
1167289983 19:48619173-48619195 AAAGAGAGAACGGGCTGGGGTGG + Exonic
1168024844 19:53636564-53636586 AGAGAGAGAAGAGAATGGGGTGG - Intronic
1168091409 19:54087727-54087749 AAAAAAAAAACAGAGTGGGGTGG - Intergenic
1168210294 19:54885204-54885226 AAAGAAAGCCCAGACTGAGGTGG - Intronic
1168414408 19:56159553-56159575 AAGGACAGCACAGGCTGGGGTGG - Intronic
1168573349 19:57488345-57488367 CAAGTCAAAACAGACTGGGGTGG + Intronic
1168574766 19:57500475-57500497 CAAGTCAAAACAGACTGGGGTGG + Intronic
925186522 2:1850247-1850269 AAAGAGAGAAAAGACAGGGAAGG - Intronic
926041632 2:9678247-9678269 TAATATACAACAAACTGGGGGGG - Intergenic
926914763 2:17880397-17880419 AAAGAAAGAACAGACTAGACTGG - Intronic
929031612 2:37654523-37654545 AAAGATGGAATGGGCTGGGGTGG + Intronic
931023278 2:58075729-58075751 AAAGCTAGAAGAGGCTGGAGTGG + Intronic
932918755 2:75885558-75885580 AAAGATAGAACATCTTGGGTAGG + Intergenic
933234260 2:79847570-79847592 AAAGCTAGAACAAATTGGAGTGG + Intronic
933392587 2:81690705-81690727 AAAGTAAGAACAGATTGGGAAGG - Intergenic
934094345 2:88585298-88585320 AATGCTAGAACAGGCTGGGGAGG + Intronic
934615669 2:95769203-95769225 AAAGGTTGAACACACAGGGGAGG + Intergenic
935550070 2:104443360-104443382 AAAGAGAGACCAAACTGGAGAGG + Intergenic
937358813 2:121214675-121214697 TAAGAGATAAGAGACTGGGGTGG + Intergenic
937552228 2:123108196-123108218 AAAGAGAGAAAAGAGTGAGGAGG - Intergenic
937612035 2:123873525-123873547 TAAGATAGAGTTGACTGGGGTGG - Intergenic
937788838 2:125935283-125935305 AAAGCTAGAAAAGGCAGGGGAGG + Intergenic
937921841 2:127136698-127136720 CAAGATGGAACAGACAGGGCTGG + Intergenic
938744722 2:134266509-134266531 AAAGAAATAACAGGCTGGCGCGG - Intronic
938946279 2:136214896-136214918 AAAGAGAGAACTGACTGGATAGG + Intergenic
939593044 2:144089747-144089769 AAAGATAACAAAGACTGGGAAGG + Intronic
939628136 2:144503588-144503610 AAAGTTAGAAGAGACGGGGAAGG + Intronic
940649441 2:156426734-156426756 ATAGAGAGAACAAACTGGAGAGG + Intergenic
942876389 2:180804809-180804831 GAAGAAAGAACAAAGTGGGGTGG + Intergenic
943276595 2:185875924-185875946 AAGGATAGCAGAGACTGTGGTGG - Intergenic
943446266 2:187991945-187991967 AAAGAAAGAACAGAGATGGGAGG + Intergenic
943637318 2:190320014-190320036 GAGGATAGAACGGACTAGGGCGG + Exonic
945195389 2:207232677-207232699 AAAGCTAGAAAAGACTGAAGAGG + Intergenic
945626048 2:212206882-212206904 AAGAATAGAACAGACTAGGCCGG - Intronic
946490432 2:220144123-220144145 AAAGGTGGGACAGACTGGGGAGG - Intergenic
946926392 2:224631365-224631387 GAAGGTAGAACAGACTCAGGTGG + Intergenic
947143668 2:227043256-227043278 AAGGATAGAAAAGAATAGGGTGG - Intronic
947513737 2:230783121-230783143 AAAGAAAGAGCAGTCTGGGCCGG - Intronic
948767550 2:240231134-240231156 TAAGATTGAACAGGCTGGGCCGG + Intergenic
1168808785 20:689158-689180 AAAGATGGAGCAGGCAGGGGAGG + Intergenic
1169813155 20:9629385-9629407 CAAAATAACACAGACTGGGGTGG + Intronic
1169951871 20:11053666-11053688 AAAGGTAGTAGAGGCTGGGGAGG + Intergenic
1172359237 20:34300822-34300844 GGAGAGAGACCAGACTGGGGTGG + Intronic
1172914043 20:38430637-38430659 AAATAAATAACAGACTGGGCTGG + Intergenic
1173280414 20:41621909-41621931 CAAGAGAGAACAGATTCGGGTGG - Intergenic
1173599130 20:44280258-44280280 AAAGTGAGACCCGACTGGGGTGG - Exonic
1173647461 20:44642389-44642411 AAAGAAAAATCACACTGGGGTGG + Intronic
1173705331 20:45106141-45106163 ACAGATAGAGCTGACTGGGTTGG + Intergenic
1174066058 20:47866860-47866882 AAAAAAAGAATAGACTGAGGTGG - Intergenic
1174213985 20:48902018-48902040 AAAAATAAAACAGGCTGGGGTGG - Intergenic
1176552491 21:8232984-8233006 ACAGAGAGAACAGACAGGGAGGG - Intergenic
1179675910 21:42982000-42982022 ACAGATGGAACAGACAGTGGAGG - Intronic
1180590078 22:16930130-16930152 CAAGATAGAATTGGCTGGGGAGG + Intergenic
1180661726 22:17473348-17473370 AAAGAGAGAAAAGGTTGGGGTGG + Intronic
1183007201 22:34913389-34913411 AAAGATATCACAGCTTGGGGTGG - Intergenic
950520901 3:13497158-13497180 AAAGAAAGAAAAAACTGGTGAGG - Intronic
951520490 3:23606501-23606523 AAAGATGGGACAGACTGGAGGGG + Intergenic
951731895 3:25818953-25818975 AAAGATAGAACAGGCTCTGTTGG + Intergenic
952118942 3:30218148-30218170 AAATATGAAACAGCCTGGGGAGG - Intergenic
952804244 3:37331977-37331999 AATGGTAGCACAGACTGTGGTGG - Intronic
953154316 3:40355073-40355095 AAAGAAGGAGAAGACTGGGGAGG + Intergenic
956116900 3:65928017-65928039 AAAAAAAGAACAGAGTGAGGGGG - Intronic
956473129 3:69590010-69590032 AAAGAGAGAACGGCCTGGGGTGG + Intergenic
956906191 3:73767815-73767837 ACAGATCAAACAAACTGGGGAGG - Intergenic
957142778 3:76382717-76382739 AAAGAAAGAACAGCCAGGGAAGG + Intronic
960574441 3:119216185-119216207 ATTGACAGAACAGACTAGGGAGG + Intronic
961207448 3:125096284-125096306 AAAGAGAGACCAGGGTGGGGAGG - Intronic
961621338 3:128227312-128227334 AAAAAAAGAACGGAGTGGGGGGG - Intronic
964074962 3:152682712-152682734 AAAGAAAGCAAAAACTGGGGAGG - Intergenic
964492064 3:157247574-157247596 AAAAATAAAAGTGACTGGGGTGG - Intergenic
965012665 3:163114947-163114969 AAAGAAAGAATAGACAAGGGTGG - Intergenic
965215639 3:165861304-165861326 AAAGAAAGAAAAGACCCGGGAGG - Intergenic
966877295 3:184330091-184330113 TAAGAAAGAAAAGACTGGGCCGG + Intronic
968598696 4:1498872-1498894 AAGGAAAGAAGAGACTGGTGAGG - Intergenic
968880975 4:3299991-3300013 AGAGTTAGAAAAGACTGTGGGGG - Intronic
970782806 4:19759061-19759083 AAAAATAGAGCACACTGGGCAGG - Intergenic
971468650 4:26994295-26994317 TGAGATAGAAAAGAATGGGGAGG - Intronic
972837551 4:42891906-42891928 AAACATAGCACAGACAGGGCAGG + Intergenic
975104367 4:70550973-70550995 AAAGATAAAAAAGACTAAGGAGG + Intergenic
975638180 4:76471535-76471557 AAAGAAAGAACAAACTGGCTGGG - Intronic
977690546 4:99903777-99903799 AAAGGTAGAAAAGAGTGTGGAGG - Exonic
978083827 4:104625348-104625370 CAAGATACCACAGACTGAGGGGG - Intergenic
978419189 4:108511910-108511932 AGAGTGAAAACAGACTGGGGAGG - Intergenic
978971946 4:114819135-114819157 AAAGATAGAGCAGTATGTGGTGG - Intergenic
980114016 4:128662051-128662073 TAAGATAGAAAAGACTGAGATGG - Intergenic
980819797 4:137999347-137999369 AAACCTAGAACAAACTGGGCAGG + Intergenic
981045059 4:140257053-140257075 AAAGATGGTAGAGTCTGGGGAGG - Intergenic
982302864 4:153898042-153898064 AAAGAGAGAACAGAGGGAGGAGG - Intergenic
982832317 4:160078114-160078136 AAACAGAGAACAGAATGGTGGGG + Intergenic
982935143 4:161464196-161464218 AAGGCTAGAGAAGACTGGGGAGG - Intronic
983771023 4:171549194-171549216 AAAAATAAAACTCACTGGGGAGG + Intergenic
984837088 4:184032342-184032364 AGAGAGAGAAAAGACTGGAGGGG - Intergenic
985047370 4:185953606-185953628 AAAGATGAAAGAGACTGGCGAGG + Intronic
985344499 4:188988710-188988732 AAACATACCACAGACTGGGTGGG - Intergenic
985696984 5:1346235-1346257 GAAGCGAGAACAGACTGAGGGGG - Intergenic
985835690 5:2270305-2270327 AAGCATAGAACAGGCTGGGGTGG - Intergenic
986074642 5:4323321-4323343 ATAAATAGAACAGAATAGGGAGG + Intergenic
986285133 5:6353740-6353762 TAAGTCAGAACAGGCTGGGGAGG + Intergenic
988214960 5:28260118-28260140 ATAGAGAGAACTGACAGGGGTGG - Intergenic
989301975 5:39905207-39905229 AAATATAGAGCAGAGTGTGGAGG + Intergenic
989648600 5:43664367-43664389 AAAAATAGAACAGAATGAAGTGG + Intronic
990046417 5:51437751-51437773 AAAGATACAAAAGATTTGGGGGG - Intergenic
990128612 5:52551007-52551029 AAAAATAGAACAGAGTGGATGGG - Intergenic
992191534 5:74296716-74296738 ACAGATTGAACAGTTTGGGGTGG - Intergenic
992867540 5:80972768-80972790 AAACAGAGAACAGGCTGGTGCGG - Intronic
993589219 5:89773496-89773518 TAAGATAAAAGAGACTAGGGAGG + Intergenic
994512881 5:100729585-100729607 AAAGAAAGAACAGAATGTTGAGG + Intergenic
994991802 5:107006189-107006211 AAAGATAGAGAAAACTGCGGAGG + Intergenic
995426896 5:112034616-112034638 AAAGATAGAAGAGAATGGAATGG + Intergenic
997240641 5:132304324-132304346 ATAGAAAGATCAGACTGGCGTGG + Intronic
998058101 5:139096565-139096587 GAAGAGAGAAAAGAGTGGGGAGG + Intronic
999226453 5:150028862-150028884 AAATAAAGAAGACACTGGGGAGG - Intronic
1001750551 5:174127398-174127420 AGAGATAGAACAGAATTGGAGGG - Intronic
1001909531 5:175504040-175504062 AAAGAAAGAAAAGAGGGGGGTGG + Intronic
1002961657 6:1920787-1920809 AAGGGCAGAACAGGCTGGGGTGG + Intronic
1002970446 6:2012092-2012114 AAAGATATCACAGACTTGGAAGG + Intronic
1003707270 6:8546806-8546828 AGAGACAGAACTGACTGGGATGG + Intergenic
1003986382 6:11439636-11439658 AAAGATAAAATAGACTGGTGTGG - Intergenic
1004087131 6:12461202-12461224 GAAGATATAAGAGACTGGGAAGG - Intergenic
1005849707 6:29812501-29812523 AAAGAGAGAACATGCTGGTGAGG + Intergenic
1006402951 6:33828391-33828413 AAAAATACAACAGAATGAGGAGG - Intergenic
1006591899 6:35164355-35164377 AGAGAGAGAACAGACTGGGCAGG - Intergenic
1006627259 6:35406217-35406239 AAAGATAGCACAGGCTGGGCTGG - Intronic
1008955327 6:57209758-57209780 TAAGATAAAACAGATTTGGGAGG - Intronic
1010060584 6:71617965-71617987 AAAGCTAGAAAAGAATGAGGTGG + Intergenic
1010351016 6:74874384-74874406 ATAGAAAGAACAGGCTGTGGGGG - Intergenic
1012138726 6:95593750-95593772 AAAGATGGAAAAGACTGGCTGGG + Intronic
1012310348 6:97716330-97716352 AAAGATTGCAAAGACTGTGGGGG + Intergenic
1012540050 6:100352067-100352089 AGAGAAAGAACTGAATGGGGAGG + Intergenic
1012605327 6:101151445-101151467 AAAGGGAGAAGAGACTGGGAGGG + Intergenic
1012975619 6:105778357-105778379 AGAAATAGAACAGACTCGGCCGG + Intergenic
1013062721 6:106652628-106652650 ATAGAGAGCACAGACTTGGGAGG + Intronic
1013224564 6:108111299-108111321 AAAGATAAGACAGAGTGGGCTGG + Intronic
1014106777 6:117573421-117573443 AAAGAAAGAAGAGGCTGGGTGGG + Intronic
1016525853 6:145000836-145000858 AAAATTAGACCAGAGTGGGGAGG - Intergenic
1018090133 6:160339200-160339222 GAAGATAGAGCAGACCTGGGAGG + Intergenic
1018356930 6:163027756-163027778 GATGATAAAACAGAATGGGGAGG + Intronic
1018505423 6:164462733-164462755 AAAGGTAGTACAGAATGGGTAGG - Intergenic
1020140508 7:5608954-5608976 AAAGAAAGGAGAGACTGGGCTGG + Intergenic
1020635803 7:10694516-10694538 AATGAGAGTACAGACTTGGGAGG - Intergenic
1021033829 7:15772148-15772170 AAAGATAGCATATATTGGGGAGG + Intergenic
1021694049 7:23259135-23259157 AGACATAAAACAGAATGGGGTGG - Intronic
1022070419 7:26908457-26908479 AAAGAAAGAAAAGAAAGGGGAGG + Intronic
1022798273 7:33750302-33750324 AAAAATAGCAGAGGCTGGGGAGG - Intergenic
1027127443 7:75566817-75566839 TGAGATAGAAAAGAATGGGGAGG + Intronic
1027839914 7:83296405-83296427 GAAGAAAGAACATTCTGGGGAGG - Intergenic
1028064816 7:86370253-86370275 AAAGATAGAATATACTGTGTTGG - Intergenic
1028619687 7:92811455-92811477 GAAGGAAGAACAAACTGGGGTGG + Intronic
1028898179 7:96065347-96065369 AAAAAAAGAAAAGAGTGGGGAGG - Intronic
1031275674 7:119719839-119719861 AAAAAAAGAAAAAACTGGGGTGG + Intergenic
1032843352 7:135732131-135732153 TAAGAAAGAACAGACTGTGAAGG + Intronic
1033435373 7:141329015-141329037 AAAGACATTATAGACTGGGGGGG - Intronic
1033807281 7:144969164-144969186 AAAGATAGCAGATACTGGCGAGG - Intergenic
1036259609 8:7229311-7229333 AAAGACAGGGGAGACTGGGGAGG + Intergenic
1036307008 8:7610213-7610235 AAAGACAGGGGAGACTGGGGAGG - Intergenic
1036311652 8:7687881-7687903 AAAGACAGGGGAGACTGGGGAGG + Intergenic
1036357856 8:8058200-8058222 AAAGACAGGGGAGACTGGGGAGG - Intergenic
1036358920 8:8064342-8064364 AAAGACAGGGGAGACTGGGGAGG - Intergenic
1036612699 8:10363655-10363677 AAAGGAAGAACACACAGGGGTGG + Intronic
1036893093 8:12608746-12608768 AAAGACAGGGGAGACTGGGGAGG + Intergenic
1036900654 8:12666732-12666754 AAAGACAGGGGAGACTGGGGAGG + Intergenic
1038769679 8:30465877-30465899 AAAGATTGAACATAGTGGTGTGG + Intronic
1039158529 8:34590523-34590545 AAAGATAACAAATACTGGGGAGG - Intergenic
1040462584 8:47662991-47663013 AAAAATACCACAGACTGGGTGGG - Intronic
1041117372 8:54553267-54553289 AAACATACCATAGACTGGGGTGG + Intergenic
1041198467 8:55425605-55425627 ACAGATAGAAGATACAGGGGAGG - Intronic
1041451671 8:58012874-58012896 AAGGGAAGAACAGACTGGGGAGG - Intronic
1041714882 8:60923846-60923868 ATAGAATGAACAGAGTGGGGAGG - Intergenic
1041804884 8:61839230-61839252 AAAGTTAAAACAGAATGAGGTGG + Intergenic
1041849256 8:62369747-62369769 AAAAAAACAACAGACTTGGGGGG - Intronic
1042419385 8:68567714-68567736 AAAAATACAAAAGACTCGGGAGG - Intronic
1043733978 8:83721531-83721553 AAGGATAAAACAGACAGGAGAGG + Intergenic
1043981330 8:86643443-86643465 AAAGATAACAGAGACTGGGAAGG - Intronic
1045262130 8:100585417-100585439 AGAGAAAGCACAGGCTGGGGTGG + Intronic
1045344178 8:101279863-101279885 AAAGATGGAAGAAACAGGGGAGG - Intergenic
1046231992 8:111370154-111370176 AAAGATAGAACAGTCGGGCATGG - Intergenic
1047275153 8:123400181-123400203 AAAGAAAGATCAGTCTGAGGAGG + Intronic
1047297035 8:123580047-123580069 AAAGAGAGAACACTGTGGGGTGG + Intergenic
1047991319 8:130289539-130289561 AAGAATGGAAAAGACTGGGGAGG + Intronic
1048973828 8:139659995-139660017 ATGGAAAGAACAGAGTGGGGTGG + Intronic
1050606082 9:7302552-7302574 AAAGATAGCAGAGACTGGGAAGG - Intergenic
1050697732 9:8297993-8298015 AAAGACAGAAAAGGCTGAGGAGG - Intergenic
1051305541 9:15704914-15704936 ACAGAGAAAACAGACTGAGGGGG - Intronic
1051592838 9:18793945-18793967 AAAGAAAAAACAGACTTGGGTGG + Intronic
1053187576 9:36031389-36031411 AAAGAGAGTAAAGAATGGGGGGG + Intergenic
1055467774 9:76582541-76582563 AAAGAAAGAAAAGACTGTGGAGG - Intergenic
1055762505 9:79624037-79624059 GAAGAGAGGACAGATTGGGGAGG + Intronic
1058469158 9:105258993-105259015 AAAGAGAGAACAAACAGGCGTGG - Intronic
1058599860 9:106657592-106657614 ATAGATAGAAAAGTCTTGGGAGG - Intergenic
1059077661 9:111211161-111211183 AGAGATGGAAGAGATTGGGGAGG - Intergenic
1059282154 9:113144205-113144227 AAAGAAAGAAAAAAATGGGGAGG - Intergenic
1059684016 9:116617050-116617072 AGAGACAGAACAGACTGGAGTGG - Intronic
1059962380 9:119577834-119577856 AAAGAAAGAATAGACAGAGGAGG + Intergenic
1060634781 9:125191312-125191334 AAAAATACAAAATACTGGGGAGG + Intergenic
1060777195 9:126383681-126383703 AAAGAGAGAACAGATGGGGGAGG + Intronic
1061053223 9:128208039-128208061 AAAGAAAAAAAAGAATGGGGAGG - Intronic
1062079717 9:134617420-134617442 ACAGATACATCAGAGTGGGGAGG + Intergenic
1185543277 X:921095-921117 AAAGATTGAACAGATTGGCTGGG - Intergenic
1185921403 X:4096938-4096960 AAAGAAAGAAAAGAAAGGGGGGG + Intergenic
1186283978 X:8024426-8024448 AAAGATAGAAAAGAATATGGTGG + Intergenic
1187107302 X:16257138-16257160 CAAAGTATAACAGACTGGGGTGG + Intergenic
1187320178 X:18230748-18230770 AAAGACAGAAGAGACGGGCGGGG + Intergenic
1190466909 X:50734384-50734406 AAAGAAAGATGAGACTGGGTGGG - Intronic
1193455262 X:81724339-81724361 AAAGATAGTGAACACTGGGGTGG + Intergenic
1193702001 X:84774372-84774394 AGAGATAGAGCAGGCTGGTGGGG + Intergenic
1193915439 X:87357065-87357087 GAAGAGAGAAAAGAGTGGGGAGG + Intergenic
1194469450 X:94273986-94274008 AAAAATAGACCTGACTTGGGTGG - Intergenic
1194666817 X:96685055-96685077 AAAGATGGAGCAGCCCGGGGCGG + Exonic
1194681545 X:96859992-96860014 AAGGATAGAAAATAATGGGGAGG + Intronic
1196508461 X:116476976-116476998 GAGGAGAGAAAAGACTGGGGAGG - Intergenic
1198405894 X:136311981-136312003 AAAGATAGACCAGGCAGGGTGGG - Intronic
1198747721 X:139907183-139907205 AAAGGAAGAACAGATTTGGGAGG - Intronic
1199411978 X:147534769-147534791 AAAGATAAAACAGACAAGGGAGG - Intergenic
1199841335 X:151652615-151652637 AAAGATAGAACAGGATGAGGAGG + Intronic
1200330933 X:155297288-155297310 AGAGATAACAGAGACTGGGGAGG + Intronic