ID: 1111961542

View in Genome Browser
Species Human (GRCh38)
Location 13:94816132-94816154
Sequence ATGAATAAGAATTAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111961537_1111961542 27 Left 1111961537 13:94816082-94816104 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111961542 Original CRISPR ATGAATAAGAATTAGGAGGA GGG Intergenic
No off target data available for this crispr