ID: 1111963208

View in Genome Browser
Species Human (GRCh38)
Location 13:94834023-94834045
Sequence CTCATCTCTGCTGATTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111963208_1111963209 -9 Left 1111963208 13:94834023-94834045 CCTCTTCAATCAGCAGAGATGAG No data
Right 1111963209 13:94834037-94834059 AGAGATGAGCTGAATGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111963208 Original CRISPR CTCATCTCTGCTGATTGAAG AGG (reversed) Intergenic
No off target data available for this crispr