ID: 1111966616

View in Genome Browser
Species Human (GRCh38)
Location 13:94867892-94867914
Sequence GGACCACCATGGCAGCCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111966612_1111966616 3 Left 1111966612 13:94867866-94867888 CCTGGCTGACCAAAAATTATTAC No data
Right 1111966616 13:94867892-94867914 GGACCACCATGGCAGCCCATAGG No data
1111966614_1111966616 -6 Left 1111966614 13:94867875-94867897 CCAAAAATTATTACTGAGGACCA No data
Right 1111966616 13:94867892-94867914 GGACCACCATGGCAGCCCATAGG No data
1111966609_1111966616 30 Left 1111966609 13:94867839-94867861 CCTGGATTACAAGCATCAGCCAT No data
Right 1111966616 13:94867892-94867914 GGACCACCATGGCAGCCCATAGG No data
1111966611_1111966616 11 Left 1111966611 13:94867858-94867880 CCATCGTGCCTGGCTGACCAAAA No data
Right 1111966616 13:94867892-94867914 GGACCACCATGGCAGCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111966616 Original CRISPR GGACCACCATGGCAGCCCAT AGG Intergenic
No off target data available for this crispr