ID: 1111969996

View in Genome Browser
Species Human (GRCh38)
Location 13:94901970-94901992
Sequence CCGGGGTATCAGGCAGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111969987_1111969996 30 Left 1111969987 13:94901917-94901939 CCTATAGCTATCAAAGGTTTTGG No data
Right 1111969996 13:94901970-94901992 CCGGGGTATCAGGCAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111969996 Original CRISPR CCGGGGTATCAGGCAGGCTT TGG Intergenic
No off target data available for this crispr