ID: 1111975754

View in Genome Browser
Species Human (GRCh38)
Location 13:94965700-94965722
Sequence TTGGGTACACAGATGTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111975747_1111975754 6 Left 1111975747 13:94965671-94965693 CCCATCACCCTTTCTTCAGTCCT No data
Right 1111975754 13:94965700-94965722 TTGGGTACACAGATGTATCAAGG No data
1111975746_1111975754 15 Left 1111975746 13:94965662-94965684 CCAGTGCTGCCCATCACCCTTTC No data
Right 1111975754 13:94965700-94965722 TTGGGTACACAGATGTATCAAGG No data
1111975750_1111975754 -2 Left 1111975750 13:94965679-94965701 CCTTTCTTCAGTCCTTTTTATTT No data
Right 1111975754 13:94965700-94965722 TTGGGTACACAGATGTATCAAGG No data
1111975748_1111975754 5 Left 1111975748 13:94965672-94965694 CCATCACCCTTTCTTCAGTCCTT No data
Right 1111975754 13:94965700-94965722 TTGGGTACACAGATGTATCAAGG No data
1111975749_1111975754 -1 Left 1111975749 13:94965678-94965700 CCCTTTCTTCAGTCCTTTTTATT No data
Right 1111975754 13:94965700-94965722 TTGGGTACACAGATGTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111975754 Original CRISPR TTGGGTACACAGATGTATCA AGG Intergenic
No off target data available for this crispr