ID: 1111975948

View in Genome Browser
Species Human (GRCh38)
Location 13:94967758-94967780
Sequence GCCCTGCCGGGCGCCCGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111975948_1111975960 14 Left 1111975948 13:94967758-94967780 CCTCTGCGGGCGCCCGGCAGGGC No data
Right 1111975960 13:94967795-94967817 TCGGGGCGCCGGCGCCGGGGCGG No data
1111975948_1111975957 9 Left 1111975948 13:94967758-94967780 CCTCTGCGGGCGCCCGGCAGGGC No data
Right 1111975957 13:94967790-94967812 GAGACTCGGGGCGCCGGCGCCGG No data
1111975948_1111975953 -4 Left 1111975948 13:94967758-94967780 CCTCTGCGGGCGCCCGGCAGGGC No data
Right 1111975953 13:94967777-94967799 GGGCTGCGCGGCCGAGACTCGGG No data
1111975948_1111975955 3 Left 1111975948 13:94967758-94967780 CCTCTGCGGGCGCCCGGCAGGGC No data
Right 1111975955 13:94967784-94967806 GCGGCCGAGACTCGGGGCGCCGG No data
1111975948_1111975952 -5 Left 1111975948 13:94967758-94967780 CCTCTGCGGGCGCCCGGCAGGGC No data
Right 1111975952 13:94967776-94967798 AGGGCTGCGCGGCCGAGACTCGG No data
1111975948_1111975962 19 Left 1111975948 13:94967758-94967780 CCTCTGCGGGCGCCCGGCAGGGC No data
Right 1111975962 13:94967800-94967822 GCGCCGGCGCCGGGGCGGCCGGG No data
1111975948_1111975959 11 Left 1111975948 13:94967758-94967780 CCTCTGCGGGCGCCCGGCAGGGC No data
Right 1111975959 13:94967792-94967814 GACTCGGGGCGCCGGCGCCGGGG No data
1111975948_1111975961 18 Left 1111975948 13:94967758-94967780 CCTCTGCGGGCGCCCGGCAGGGC No data
Right 1111975961 13:94967799-94967821 GGCGCCGGCGCCGGGGCGGCCGG No data
1111975948_1111975954 -3 Left 1111975948 13:94967758-94967780 CCTCTGCGGGCGCCCGGCAGGGC No data
Right 1111975954 13:94967778-94967800 GGCTGCGCGGCCGAGACTCGGGG No data
1111975948_1111975958 10 Left 1111975948 13:94967758-94967780 CCTCTGCGGGCGCCCGGCAGGGC No data
Right 1111975958 13:94967791-94967813 AGACTCGGGGCGCCGGCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111975948 Original CRISPR GCCCTGCCGGGCGCCCGCAG AGG (reversed) Intergenic
No off target data available for this crispr