ID: 1111975950

View in Genome Browser
Species Human (GRCh38)
Location 13:94967770-94967792
Sequence CTCGGCCGCGCAGCCCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111975950_1111975965 22 Left 1111975950 13:94967770-94967792 CCCGGCAGGGCTGCGCGGCCGAG No data
Right 1111975965 13:94967815-94967837 CGGCCGGGAGCTCTGTCATTTGG No data
1111975950_1111975960 2 Left 1111975950 13:94967770-94967792 CCCGGCAGGGCTGCGCGGCCGAG No data
Right 1111975960 13:94967795-94967817 TCGGGGCGCCGGCGCCGGGGCGG No data
1111975950_1111975962 7 Left 1111975950 13:94967770-94967792 CCCGGCAGGGCTGCGCGGCCGAG No data
Right 1111975962 13:94967800-94967822 GCGCCGGCGCCGGGGCGGCCGGG No data
1111975950_1111975961 6 Left 1111975950 13:94967770-94967792 CCCGGCAGGGCTGCGCGGCCGAG No data
Right 1111975961 13:94967799-94967821 GGCGCCGGCGCCGGGGCGGCCGG No data
1111975950_1111975955 -9 Left 1111975950 13:94967770-94967792 CCCGGCAGGGCTGCGCGGCCGAG No data
Right 1111975955 13:94967784-94967806 GCGGCCGAGACTCGGGGCGCCGG No data
1111975950_1111975958 -2 Left 1111975950 13:94967770-94967792 CCCGGCAGGGCTGCGCGGCCGAG No data
Right 1111975958 13:94967791-94967813 AGACTCGGGGCGCCGGCGCCGGG No data
1111975950_1111975959 -1 Left 1111975950 13:94967770-94967792 CCCGGCAGGGCTGCGCGGCCGAG No data
Right 1111975959 13:94967792-94967814 GACTCGGGGCGCCGGCGCCGGGG No data
1111975950_1111975957 -3 Left 1111975950 13:94967770-94967792 CCCGGCAGGGCTGCGCGGCCGAG No data
Right 1111975957 13:94967790-94967812 GAGACTCGGGGCGCCGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111975950 Original CRISPR CTCGGCCGCGCAGCCCTGCC GGG (reversed) Intergenic
No off target data available for this crispr