ID: 1111975959

View in Genome Browser
Species Human (GRCh38)
Location 13:94967792-94967814
Sequence GACTCGGGGCGCCGGCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111975951_1111975959 -2 Left 1111975951 13:94967771-94967793 CCGGCAGGGCTGCGCGGCCGAGA No data
Right 1111975959 13:94967792-94967814 GACTCGGGGCGCCGGCGCCGGGG No data
1111975950_1111975959 -1 Left 1111975950 13:94967770-94967792 CCCGGCAGGGCTGCGCGGCCGAG No data
Right 1111975959 13:94967792-94967814 GACTCGGGGCGCCGGCGCCGGGG No data
1111975945_1111975959 14 Left 1111975945 13:94967755-94967777 CCTCCTCTGCGGGCGCCCGGCAG No data
Right 1111975959 13:94967792-94967814 GACTCGGGGCGCCGGCGCCGGGG No data
1111975948_1111975959 11 Left 1111975948 13:94967758-94967780 CCTCTGCGGGCGCCCGGCAGGGC No data
Right 1111975959 13:94967792-94967814 GACTCGGGGCGCCGGCGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111975959 Original CRISPR GACTCGGGGCGCCGGCGCCG GGG Intergenic
No off target data available for this crispr