ID: 1111976068

View in Genome Browser
Species Human (GRCh38)
Location 13:94968205-94968227
Sequence CGTCCTGCGGGGAACTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111976068_1111976084 27 Left 1111976068 13:94968205-94968227 CCACCCCAGTTCCCCGCAGGACG No data
Right 1111976084 13:94968255-94968277 GTCCTCGCCCTAACACCGCAGGG No data
1111976068_1111976083 26 Left 1111976068 13:94968205-94968227 CCACCCCAGTTCCCCGCAGGACG No data
Right 1111976083 13:94968254-94968276 TGTCCTCGCCCTAACACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111976068 Original CRISPR CGTCCTGCGGGGAACTGGGG TGG (reversed) Intergenic
No off target data available for this crispr