ID: 1111982478

View in Genome Browser
Species Human (GRCh38)
Location 13:95031423-95031445
Sequence GAGAACAGAAGGTAGATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111982478 Original CRISPR GAGAACAGAAGGTAGATTGC TGG (reversed) Intronic
900464011 1:2815242-2815264 GAGCACAGGAGGCAGATTGCAGG - Intergenic
901439218 1:9267387-9267409 AAGAACAGATGGGAGAGTGCTGG - Exonic
902648136 1:17818343-17818365 GAGAGCAGAAGAAAGATTACAGG - Intronic
903764140 1:25722423-25722445 GAAAACAGAAGATAAATTGGAGG - Intronic
903850916 1:26305529-26305551 TAGAACAGAAAGTAGATTTGTGG - Intronic
905410380 1:37764520-37764542 GCCAACAGAAGGTGGAATGCTGG - Intronic
907688444 1:56637311-56637333 GGGAAAAGAAGGGAGGTTGCGGG - Intronic
908338831 1:63155341-63155363 GAGAACAGAGGGTAGAATGGAGG + Intergenic
909166208 1:72228469-72228491 GCTAACAGAAGGTGGATTGTGGG + Intronic
910996227 1:93106959-93106981 GAGAACAGAAGTAAAAATGCAGG - Intronic
912273318 1:108231559-108231581 GAAAACACAATCTAGATTGCTGG + Intronic
912294902 1:108462763-108462785 GAAAACACAATCTAGATTGCTGG - Intronic
912987063 1:114444220-114444242 GGGAACAGAGGGTAGATAGAGGG + Intronic
913264019 1:117026898-117026920 GAGCCCAGAAGGTACATTACAGG - Intronic
913340895 1:117757369-117757391 GAGAACACAAGCCAGATTGCAGG + Intergenic
915719490 1:157973936-157973958 GATAACAGAATGTAGAATTCAGG - Intergenic
917171355 1:172178818-172178840 AAAGACAGAAGCTAGATTGCAGG + Intronic
917499450 1:175573243-175573265 CAAAACAGAAGGCAGGTTGCAGG - Intronic
917567628 1:176229510-176229532 GAGCACAGAGGGTATACTGCAGG + Intergenic
917708139 1:177655775-177655797 GACAACAGAAGCCAGATTGCAGG + Intergenic
918083752 1:181227796-181227818 GAGAAGAGAAGGAAGGATGCTGG - Intergenic
920079840 1:203364825-203364847 GAGATCAGAAGGTAGACCCCAGG - Intergenic
921372978 1:214444608-214444630 CAGCACACAAGGCAGATTGCAGG + Intronic
921428615 1:215035747-215035769 GAAAATAGAAGTGAGATTGCTGG + Intronic
922086954 1:222358663-222358685 GAAGATAGAAGGTAGAATGCTGG + Intergenic
922972853 1:229757804-229757826 GAGGACAGATGCTAGATTGATGG - Intergenic
924496968 1:244599800-244599822 GAGAAGAGAAGCCAGACTGCAGG + Intronic
924540570 1:244977095-244977117 GGAGACAGAAAGTAGATTGCTGG + Intronic
1063800184 10:9568022-9568044 GGAAACAGAAGATAGATTCCTGG + Intergenic
1065262212 10:23935961-23935983 GAGACTGCAAGGTAGATTGCAGG + Intronic
1065711988 10:28527231-28527253 GAGAACAGTAGGTAAAGTGTTGG - Intergenic
1065912527 10:30321478-30321500 GAGAAGAGAAAGCAGATTCCAGG + Intronic
1066065069 10:31755945-31755967 GAAAACAGAAGGGAGATAGGAGG + Intergenic
1069369391 10:67730568-67730590 GAGAACTGAAGGGAGATCCCAGG + Intergenic
1070281853 10:75055544-75055566 AAAAACAGAAAGTAGATTGGTGG + Intronic
1070899112 10:80012544-80012566 CAGAACAGAAAGTAGAATGGTGG + Intergenic
1072382492 10:94889927-94889949 GAGAACAGAAGGGAGGGTGGGGG - Intergenic
1074105649 10:110388032-110388054 GAGAACAGAAGGTAGAAGGTGGG + Intergenic
1074736633 10:116441255-116441277 GAAAACAGATGGCAGATGGCAGG + Intronic
1078671257 11:13367732-13367754 GAGAACACAAGGGAGATTACTGG + Intronic
1079776027 11:24528935-24528957 GTGATCAGATGGTAGAATGCTGG + Intronic
1083213832 11:61206279-61206301 GAGAGCAGAGGGTAAATTGGGGG + Intronic
1083216716 11:61225108-61225130 GAGAGCAGAGGGTAAATTGGGGG + Intronic
1083219598 11:61243934-61243956 GAGAGCAGAGGGTAAATTGGGGG + Intronic
1083326256 11:61874443-61874465 GAGAACAGAGGCCAGATTCCAGG - Intronic
1084647952 11:70471577-70471599 GAGAACAGAAGGTGGGCGGCAGG - Intronic
1084690550 11:70723112-70723134 AAGACCAGAAGGTAGAATCCAGG - Intronic
1085201473 11:74704773-74704795 GAGAAGAGAAGGTAGAGACCAGG + Intronic
1087351162 11:97034500-97034522 TAGAAAACAAGGTAGATGGCAGG + Intergenic
1087917266 11:103825402-103825424 GGGAACAGGAGGCAGACTGCTGG + Intergenic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1088637716 11:111839902-111839924 AAGAACAGAAAGTAGATTAATGG + Intronic
1088683989 11:112269676-112269698 GAAAAGAGAAGGTAGAAAGCTGG - Intronic
1089058226 11:115605021-115605043 AAAAACATAAGGTAGATTGATGG + Intergenic
1089686740 11:120154684-120154706 GAAAACAGAAAGTAGAATGGTGG - Intronic
1090206954 11:124890388-124890410 GAAGACAGCAGGTAGATTGCAGG + Intronic
1090578051 11:128130289-128130311 GAAAACAGCAGGTAGGTGGCAGG + Intergenic
1094398561 12:30035859-30035881 GAGAACAGAATATAGAATCCAGG + Intergenic
1095896885 12:47288761-47288783 GAGAAAAGAAAGTAGAATGTAGG - Intergenic
1096539075 12:52293913-52293935 GAGAACAGAAGCAGGATTGATGG + Intronic
1096858779 12:54507450-54507472 GAGAACAGGAGATAGAATCCAGG + Intronic
1097074250 12:56380843-56380865 GAGAACAGAAGGTACAGATCTGG - Intergenic
1097247909 12:57616726-57616748 GAGAAGTGAGGGTAGATTTCTGG + Intronic
1098221653 12:68276309-68276331 GTGAATAGAAGGTTAATTGCTGG + Intronic
1099007889 12:77256637-77256659 GAGAACACAAGGTAGAGTCTTGG - Intergenic
1100275238 12:93065783-93065805 GAGAACACATGGTACATTCCAGG + Intergenic
1102406133 12:112675963-112675985 GAGAAAGGAAGGTAGAGTTCAGG + Intronic
1106209214 13:27625362-27625384 GAGAAGAGAAGGTAGGTTTGAGG + Intronic
1107091221 13:36482235-36482257 GAAGATAGAAAGTAGATTGCTGG - Intergenic
1108495747 13:51023495-51023517 AGGAACAGAAGGTAGAATGCTGG + Intergenic
1108551574 13:51551028-51551050 GAGAAGAGAAGATAGAGTGAAGG - Intergenic
1109334220 13:60971780-60971802 GAGAACAGAAGGAAGGGTGGGGG - Intergenic
1109370962 13:61418280-61418302 GACACCAGAAGGTAGGTCGCAGG - Intronic
1109596080 13:64555648-64555670 CAGAACAGAAAGTAGAATGAAGG - Intergenic
1110184334 13:72655894-72655916 GAGAACAGAAGGAAGAATGTAGG + Intergenic
1111623899 13:90758773-90758795 AAGGGCAGAAGGTAGATTGCAGG - Intergenic
1111982478 13:95031423-95031445 GAGAACAGAAGGTAGATTGCTGG - Intronic
1112082509 13:95989006-95989028 AAAAACAGAAAGTAGATTGGTGG + Intronic
1112106176 13:96242193-96242215 AAAAACAGAAGGTAGAATGGTGG - Intronic
1112310240 13:98311797-98311819 AAGAACAGCAGTTACATTGCAGG - Intronic
1114802266 14:25790647-25790669 CAGAGCAGAAAGTAGATTGAAGG - Intergenic
1116422038 14:44744465-44744487 GGGAACTGAAGTTAGACTGCTGG - Intergenic
1116817309 14:49596203-49596225 GAGAAAAGAATGTAGTTTGTAGG + Intronic
1116981218 14:51172906-51172928 AAGAACAGAAAGTAGAATGGTGG - Intergenic
1117872061 14:60211370-60211392 GAGAACAAAGGTAAGATTGCTGG - Intergenic
1120052917 14:79889123-79889145 GAGTAGAGAAGGGAAATTGCAGG - Intergenic
1120974491 14:90236625-90236647 GGGAACAGAAAGTAGGTTGGTGG - Intergenic
1122420697 14:101575129-101575151 AGGAACAGAAAGTAGAATGCTGG + Intergenic
1125315572 15:38427677-38427699 GAGAAGAGAATGGAGAATGCTGG - Intergenic
1127473264 15:59309147-59309169 AAGAAGAGAAGGAAGATTGATGG + Intronic
1127554194 15:60071322-60071344 GAGAACCGAAGGTTTGTTGCCGG + Intergenic
1127939626 15:63681850-63681872 GAGAACAGAAGGAAGCCTACAGG + Intronic
1128992769 15:72274249-72274271 GAGTAGAGAAGGTAGATAGCTGG - Intronic
1129004389 15:72359998-72360020 GAGAACAGAAGGGAAATGGAGGG - Intronic
1129081394 15:73044319-73044341 GAGAAGAGAAGGTGGATAGTTGG - Intergenic
1129958117 15:79657848-79657870 GAGGACAAAAGGAAGACTGCAGG - Intergenic
1130413031 15:83663177-83663199 GAGAACTGAAGGGAGTTGGCAGG - Intronic
1130434920 15:83888166-83888188 AAGAACAGAAGGGAGATTTTAGG + Intronic
1130577069 15:85102404-85102426 GAGGGCAGAAGCCAGATTGCAGG + Intronic
1130899542 15:88196718-88196740 GAGAACAGATGGTTTATTGCTGG - Intronic
1131109312 15:89754891-89754913 GAGGAAAGAATGTAGATTGAAGG - Intergenic
1131587662 15:93713747-93713769 GAAAACAGAAGGCTGGTTGCTGG + Intergenic
1133308993 16:4830640-4830662 GAGAACAGAAGCCAGATGGCTGG - Intronic
1134234840 16:12457369-12457391 GAGAACAGAGGTTAAAGTGCAGG - Intronic
1136858846 16:33683015-33683037 GAAAACAGAATGGTGATTGCAGG + Intergenic
1137991938 16:53166329-53166351 GTGAACAGAAAGTAAATTCCAGG + Intronic
1138231968 16:55344553-55344575 CAGAACAGATGGAAGATTCCTGG - Intergenic
1138515056 16:57531331-57531353 GAGGAAAGAAGGCAGATTTCAGG - Intronic
1138753126 16:59448100-59448122 CAAAACAGAAGGTAGAATGACGG - Intergenic
1140084638 16:71783923-71783945 AAGATAAGTAGGTAGATTGCAGG - Intronic
1140161585 16:72501042-72501064 GCAAACAGATGGTAGATAGCTGG - Intergenic
1140686777 16:77441377-77441399 GGGGACAGAAGCCAGATTGCAGG - Intergenic
1140932084 16:79637048-79637070 GAGAACAGAAGATAAAGTTCTGG + Intergenic
1141838507 16:86559103-86559125 GAGAACAGCACCTAGAATGCAGG + Intergenic
1203120420 16_KI270728v1_random:1531509-1531531 GAAAACAGAATGGTGATTGCAGG + Intergenic
1144009324 17:11131270-11131292 GAAAACAGAGAGTAGATTGGTGG - Intergenic
1144427021 17:15152687-15152709 GAGAACAAAAGGGTGATGGCTGG - Intergenic
1145191801 17:20848123-20848145 GAGAACAGGAGGTGGAATCCAGG - Intronic
1145402016 17:22548156-22548178 GAGAACAGGAGGTGGAATCCAGG - Intergenic
1148716608 17:49720289-49720311 GAGAACAGAGGGGAGAGGGCTGG + Intronic
1149380503 17:56088650-56088672 GAGAACAGGAGGAAGATAGGTGG - Intergenic
1149983440 17:61329687-61329709 GAGAACAGAAGTGAGAGGGCAGG + Intronic
1151011011 17:70496011-70496033 GAAAACAGAGGGTAGAATGGGGG + Intergenic
1155128349 18:22903037-22903059 GAGAAGAGAAGGTACATTATTGG + Intronic
1155351116 18:24907230-24907252 GAGAGAAGTAGGTAGATTGAAGG - Intergenic
1155546839 18:26924414-26924436 GAGAGCTGGAGGTAGATAGCAGG + Intronic
1155846423 18:30713588-30713610 GAGAAAAGAAGGTTCATGGCTGG - Intergenic
1156105946 18:33660832-33660854 GAGAACTAAAGGTAGAGTTCTGG + Intronic
1156369762 18:36462264-36462286 GAGAACTGAAGGAAGGTAGCTGG - Intronic
1156948035 18:42858738-42858760 AAGAACAGAAAGTAGATTCGTGG - Intronic
1157453309 18:47804070-47804092 GAGAAAAGAAGGTAGATTCCTGG - Intergenic
1157843696 18:50982765-50982787 GGCAACAGAAGGCAGAATGCAGG - Intronic
1159698349 18:71590443-71590465 AAAAACAGAAGGTAGATTCATGG + Intergenic
1159790318 18:72771174-72771196 GTGAACAAAAGGCAGATGGCAGG + Intronic
1160497614 18:79384364-79384386 GAGAACAGAAAGCAGAGAGCTGG + Intergenic
1160524633 18:79527799-79527821 GACAACAGAAGGGAGGTGGCCGG + Intronic
1161211400 19:3067930-3067952 AAGAACAGAATGCAGATGGCGGG + Intergenic
1162888798 19:13716915-13716937 GGGAAAAGCAGGAAGATTGCTGG + Intergenic
1164147481 19:22520852-22520874 AGGAACAGAAGGAAGATTGCTGG - Intronic
1164159123 19:22615263-22615285 AGGAACAGAAGGAAGACTGCTGG + Intergenic
1164917127 19:32060816-32060838 GAGAACTGAATGGAGATTTCTGG + Intergenic
924962726 2:47788-47810 GAGAAGAGAAGGAAGGATGCGGG + Intergenic
925489033 2:4371232-4371254 AAGCACAGAAGGGAAATTGCTGG + Intergenic
925511315 2:4628702-4628724 GTGAGCAGAAGTTAGATTGCTGG - Intergenic
930201037 2:48552306-48552328 GAAGACAGAAGGTAGAGTGGTGG + Intronic
930209537 2:48620160-48620182 GAAAACAGAAGGTCTATTTCTGG + Intronic
931489438 2:62727508-62727530 GAGAACAGAAATTAGATTAGTGG - Intronic
932706070 2:74026081-74026103 GAGAGCAGAAGGCAGCTTCCTGG - Intronic
933099499 2:78234780-78234802 GAGGACAGAAGGAAGATAGGAGG + Intergenic
933500852 2:83109411-83109433 GGGATCAGAGGGTAGATTGTGGG - Intergenic
935137970 2:100323743-100323765 GAGAACAGAAAGAAGCTTGCCGG + Intergenic
935212045 2:100946493-100946515 GAGAACAGAAGGCAAACTGGAGG + Intronic
935924978 2:108058084-108058106 GAGAACATAATGTACATTTCTGG - Intergenic
937291145 2:120782882-120782904 TAGAACAGGAGGTTGACTGCAGG + Intronic
940012243 2:149066730-149066752 GAGAAGAGAAGGGAGAATGTTGG - Intronic
941523383 2:166577101-166577123 GAGAATAGAAAGTAGATTGGTGG - Intergenic
943177571 2:184496685-184496707 AAGAAAAGAAGGAAAATTGCAGG + Intergenic
943803226 2:192088802-192088824 AAGAACAGAAGGTATTTTGGAGG - Intronic
944687192 2:202127988-202128010 GATAACAGAAAGTAGAATGGTGG - Intronic
945595386 2:211784281-211784303 GAAAACAGAATGTAGAATGGTGG - Intronic
946056767 2:216909774-216909796 GGAAACAGAAGGGAGATGGCTGG - Intergenic
947219520 2:227779181-227779203 GAAAAGAGAAGATGGATTGCAGG + Intergenic
947606357 2:231488541-231488563 GAGGACAGGAGGTAGGATGCTGG + Intergenic
1169054851 20:2612076-2612098 GAGAGCAGAAGCTAGATGGTAGG + Intronic
1169315369 20:4586005-4586027 GAGAAGAGAAGGAAGCTGGCTGG + Intergenic
1169335165 20:4749875-4749897 GAGAAAGGAAGGTAGATGGTGGG - Intergenic
1169532702 20:6502683-6502705 AAGAACAAAAGCTAGATTTCTGG - Intergenic
1169636750 20:7700882-7700904 GAGAACAGTAGGTAGATGCTTGG + Intergenic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1171009665 20:21502036-21502058 GAGCAGAGAAGATAGAGTGCAGG - Intergenic
1171016551 20:21547386-21547408 AAAAACAGAAGGTAGAATGATGG + Intergenic
1171235678 20:23522571-23522593 GAGCCCAGAAGGTAGCTTGAAGG + Intergenic
1172423709 20:34839927-34839949 GAGGCCAGAAGGTGGATTGATGG - Intergenic
1173288820 20:41696484-41696506 AAGAACAGAAGGAATATTGAGGG - Intergenic
1173422550 20:42915376-42915398 CAGATCAGAAGGCAGCTTGCTGG - Intronic
1175597190 20:60244547-60244569 GAGAAGAAAAGGTAGAAGGCTGG + Intergenic
1176185208 20:63774650-63774672 GAGACCAGAAGGCAGCTGGCTGG + Intronic
1177634544 21:23770705-23770727 GAGACCAGAAGGTGAATTGGGGG - Intergenic
1177858639 21:26427052-26427074 GAGAAGAGAAGGTGGCTTCCTGG + Intergenic
1178635695 21:34300524-34300546 GAGAAAAGAAGGTAGACTAGAGG - Intergenic
1178777891 21:35569517-35569539 GGGAAAAGAAGGTACAATGCTGG + Intronic
1179105551 21:38397297-38397319 CAGAAGAAAAGGTAGATTGGGGG + Intronic
1179340154 21:40500132-40500154 GAGGAGAAAAGGGAGATTGCAGG + Intronic
1179352993 21:40631099-40631121 AAGCACAGAAGGTTCATTGCTGG - Intronic
1180656461 22:17425340-17425362 CAGAACAGAAGGCAGTTTGACGG - Intronic
1180763405 22:18226187-18226209 GAGAACAGAATGGTGGTTGCTGG + Intergenic
1180772240 22:18398357-18398379 GAGAACAGAATGGTGGTTGCTGG - Intergenic
1180803619 22:18647973-18647995 GAGAACAGAATGGTGGTTGCTGG - Intergenic
1180807146 22:18721474-18721496 GAGAACAGAATGGTGGTTGCTGG + Intergenic
1180925497 22:19551057-19551079 GAAGACAGAAAGTAGATTGGTGG - Intergenic
1181218100 22:21347291-21347313 GAGAACAGAATGGTGGTTGCTGG + Intergenic
1181828884 22:25542960-25542982 GAGAACCTAAGGTAGATTCCAGG - Intergenic
1184414672 22:44345398-44345420 GTGAACAGATGGTAGATGGGGGG + Intergenic
1184574806 22:45354872-45354894 GACAACAGAGGGGAGATTGTTGG + Intronic
1203234079 22_KI270731v1_random:139346-139368 GAGAACAGAATGGTGGTTGCTGG - Intergenic
953492092 3:43361228-43361250 CACAACAGAAGGAAGAATGCAGG - Intronic
954901283 3:54022168-54022190 GAGAACAGAAGGAAGAGTCAGGG + Intergenic
955506953 3:59641894-59641916 GGGTACAGAAGGTGGAGTGCTGG + Intergenic
957396575 3:79646867-79646889 AAAGACAGAAAGTAGATTGCTGG + Intronic
957555009 3:81755780-81755802 GAAGACAGAAAGTAGATTGGAGG + Intronic
958722652 3:97863924-97863946 GAGCACAGAAGGTAACTTGGGGG - Intronic
959010552 3:101070695-101070717 GAGAAAAGGAGGTAAAATGCTGG + Intergenic
959017950 3:101157324-101157346 GAAGACAGAAAGTAGATTGGTGG + Intergenic
959473610 3:106783223-106783245 GAGCCCTCAAGGTAGATTGCTGG + Intergenic
960047988 3:113215308-113215330 GAGAAGAGGAGGTGGAATGCAGG + Intronic
960218215 3:115069590-115069612 GAGAAAAAAAGGTAGGTTGGAGG + Intronic
960316448 3:116184069-116184091 GAGAACAGAAAGTAGAATCTGGG + Intronic
963267885 3:143257037-143257059 GAGAACAGAATGGAGATTTCTGG - Intergenic
968520382 4:1032371-1032393 GAGCACAGTAGGTTGGTTGCCGG + Intergenic
968762973 4:2451819-2451841 GAGGACAGAAGGTTGATGGATGG + Intronic
968814871 4:2817130-2817152 GAGCACAGAAGGTAGAGGGCAGG + Intronic
969554702 4:7898466-7898488 GAGAGTGGAAGGTAGAATGCAGG - Intronic
971026594 4:22594830-22594852 GAGAGCTGGAGGTAGATAGCAGG + Intergenic
971566781 4:28154359-28154381 GAGAACAGAATGGAGGTTGGTGG - Intergenic
972564986 4:40261654-40261676 GAGAACAAAAGGCAGATAACAGG - Intergenic
974668099 4:64992005-64992027 TAAAACAGAAAGTAGAATGCTGG + Intergenic
974687224 4:65245739-65245761 GATAACACAGGGTAGATTGATGG + Intergenic
974709354 4:65570069-65570091 GAGAAAAGAAGCTAGATCACTGG + Intronic
978070630 4:104463712-104463734 GAGAAGGTAAGGAAGATTGCTGG - Intergenic
979663954 4:123290285-123290307 GAAAACCTAAGGAAGATTGCTGG - Intronic
981705190 4:147651783-147651805 AGAAACAGAAAGTAGATTGCTGG + Intronic
981881304 4:149616393-149616415 GAAAACAGAAAGTAGAATGGTGG + Intergenic
983071595 4:163274219-163274241 GAGAATAGTATGTAGCTTGCAGG + Intergenic
983508336 4:168580057-168580079 TAAAACAGAAGGTAGAATGGTGG - Intronic
983676690 4:170302842-170302864 GAGAACAGGAGGTAGGGTGCTGG + Intergenic
983955215 4:173689600-173689622 GAGATCAGTAGCTAGAATGCAGG + Intergenic
983998192 4:174211391-174211413 GAAAACAGTAGGTAGAGTTCTGG - Intergenic
984392176 4:179150289-179150311 GAGAAAAGAAGGTATTTTTCTGG + Intergenic
985310284 4:188590050-188590072 CAGAAAAGAAGGTAGCTTGATGG + Intergenic
986937985 5:12915695-12915717 GAGGAGCGAAAGTAGATTGCTGG + Intergenic
988913755 5:35871855-35871877 AAGAACAGAAGTTAGGTTGGTGG - Intronic
989617694 5:43354008-43354030 GAGCACATAAGCTAGATTGGAGG - Intergenic
990844104 5:60117907-60117929 GTGAACAGAAGTCAGATTGAGGG - Intronic
991156535 5:63443341-63443363 GGGAACAAAAGCTAGATTGCAGG + Intergenic
991472642 5:66985342-66985364 GTGAGTAGAAGGTAGAATGCAGG + Intronic
993307254 5:86288522-86288544 GAAAACACAATCTAGATTGCTGG - Intergenic
993800226 5:92324283-92324305 GAGAACACAAGGTGGATTTAAGG - Intergenic
994336584 5:98573928-98573950 TATAACAGAAAGTAGATTGTAGG + Intergenic
995176787 5:109187392-109187414 GAGAACAGAATTTAGAATGGAGG - Intronic
999001561 5:147929343-147929365 GAGCACAGAAGGAAGATTAGAGG + Intergenic
1000216539 5:159162756-159162778 GAGCACAGGAGTTAGATGGCAGG - Intronic
1000501002 5:162049785-162049807 AAGAAGAGAAGGTAGAGTCCAGG - Intergenic
1003225112 6:4197481-4197503 GAGAAAAAAAGGTAGAAAGCAGG - Intergenic
1004060949 6:12197595-12197617 TAGAGCAGAAGGGAGATGGCAGG + Intergenic
1004064616 6:12231000-12231022 GAGAACTGCAGACAGATTGCTGG - Intergenic
1004954622 6:20715566-20715588 ATGCCCAGAAGGTAGATTGCTGG + Intronic
1005220882 6:23587100-23587122 AAGAGCAGAAGGTAGATTTTAGG - Intergenic
1005844331 6:29765788-29765810 GAGTACAGAGGGAAGATTTCTGG - Intergenic
1006726076 6:36200031-36200053 CAGAATGAAAGGTAGATTGCTGG + Intronic
1008640323 6:53455733-53455755 GTGAACAGAAAGCAGATTGATGG - Intergenic
1009307710 6:62111894-62111916 GAAAACAAAAGTCAGATTGCTGG + Intronic
1012647728 6:101709146-101709168 GAGAACACAAGGTAAAATGGAGG + Intronic
1013141846 6:107344650-107344672 GAGAAGAGAAAGTAGAATGGGGG + Intronic
1015706858 6:136097491-136097513 GAGAAAAGATGGTAGTTTGTAGG - Intronic
1016664063 6:146614442-146614464 GAAAACAGAAGGGTGGTTGCTGG - Intronic
1017270936 6:152504440-152504462 GAAAACAGAGAGTAGATTGGTGG + Intronic
1018359728 6:163055010-163055032 GAGAACAGAAAGGAGATTCAAGG + Intronic
1018778013 6:167036268-167036290 GAGAACAGAAGGGAGATCCCGGG + Intronic
1019601884 7:1888911-1888933 GAGAACTGCAGGGTGATTGCGGG - Intronic
1019877797 7:3830361-3830383 CAGAAGGGAAGGTAGATTGGAGG - Intronic
1020524558 7:9242358-9242380 GAGACCAGAAATTAGATTCCTGG - Intergenic
1021188438 7:17592619-17592641 GAGAACAGAAGAGACAATGCAGG + Intergenic
1022447250 7:30480449-30480471 GAGAAAAGAAGGTAGAGACCCGG - Intergenic
1024579227 7:50788371-50788393 GACAAGAGAAGGTAGAAAGCGGG + Intronic
1024625608 7:51206837-51206859 GAGAACAGAAGAGTGGTTGCAGG + Intronic
1026447136 7:70494659-70494681 GAGAACAGACTGGAGACTGCTGG + Intronic
1027185094 7:75966334-75966356 GAAAACAGAAAGTGGTTTGCTGG - Intronic
1027375441 7:77543698-77543720 GGAAACAGAAGGTAGATTTGTGG - Intronic
1029028205 7:97440591-97440613 GGAGACAGAAGGTAGATTGGTGG + Intergenic
1030184831 7:106751266-106751288 GAGAACAAAAGTTAGATTTGTGG - Intergenic
1030462602 7:109859199-109859221 GAGAAAAGAAGGAATATAGCTGG - Intergenic
1030808522 7:113946081-113946103 GACAAAAGAATCTAGATTGCAGG + Intronic
1032683254 7:134207337-134207359 GAGAAAAGAAAGTAGATTCGAGG - Intronic
1034217873 7:149421985-149422007 GAGAAAAGTGGGTAGAATGCAGG + Intergenic
1034297681 7:149988761-149988783 GAGAAAAGAAGGTAGAGAACAGG + Intergenic
1034808342 7:154108092-154108114 GAGAAAAGAAGGTAGAGAACAGG - Intronic
1035148969 7:156850470-156850492 AAAAACAGAAAGTAGATTGGTGG - Intronic
1036762069 8:11516217-11516239 GAGAACAGAAAGTAGAACGGGGG + Intronic
1037563117 8:20092539-20092561 GAGAACAAGAGGGAGCTTGCTGG - Intergenic
1037735913 8:21566017-21566039 GTGAACAGAGGGTGGAGTGCGGG + Intergenic
1039595927 8:38789676-38789698 GAGACCTGAAGGCAGATTGAGGG + Intronic
1039756787 8:40531797-40531819 GAGAAAAGAATGTATATTTCTGG + Exonic
1041527804 8:58827372-58827394 GGAAACAGAAGGGAGAGTGCAGG + Intronic
1041804911 8:61839485-61839507 GAGAACAGAATCTTGATTGGGGG - Intergenic
1044297803 8:90548663-90548685 GAGAATAGAAGGATGGTTGCTGG + Intergenic
1045236902 8:100359968-100359990 GAGAACAGAAGCCGGATTGCAGG + Intronic
1045467473 8:102483716-102483738 GAGGAGAAAAAGTAGATTGCAGG - Intergenic
1045708443 8:104955676-104955698 TACCACAGAAGGTGGATTGCTGG + Intronic
1046056983 8:109090631-109090653 GAGAAAAGAAGGAAAATTACTGG + Intronic
1047140271 8:122130850-122130872 TATAACAGAAGTAAGATTGCTGG - Intergenic
1047600938 8:126425398-126425420 AAGAACAGAAAGAAGATTCCAGG + Intergenic
1047840093 8:128742244-128742266 GAGAAAAGAAGGTATATTGGGGG + Intergenic
1050036490 9:1441265-1441287 CAGCACAGAAGGAAGAATGCAGG - Intergenic
1050822146 9:9892424-9892446 GAGAACAGAAAGTAGATCTAGGG + Intronic
1056055852 9:82823224-82823246 GAACACAGAAGGTAGATTTCAGG - Intergenic
1059167368 9:112091187-112091209 AAGAAAAGAAGGTAGACTTCAGG + Intronic
1059383039 9:113943351-113943373 GGGAAGAGAAGGGAGAGTGCTGG + Intronic
1060208130 9:121694425-121694447 CAGAACAGAAGCTTGATTGCTGG + Intronic
1185923172 X:4116430-4116452 GAGAACAGAGGGTAGAATTAGGG + Intergenic
1186012956 X:5157485-5157507 GAGAAGAGAATATAGATTGAAGG + Intergenic
1186146876 X:6633499-6633521 GAGAACAGAAGGTAGGATGGGGG - Intergenic
1186346988 X:8703769-8703791 GTAAATAGAAAGTAGATTGCAGG + Intronic
1186649720 X:11545974-11545996 AAAAACAGAAGGTCAATTGCAGG - Intronic
1188515972 X:30986262-30986284 GAGAAAAGAAGGTGGATTGGAGG + Intergenic
1189481186 X:41393536-41393558 GACAACAGAAAGTAGAATGGTGG + Intergenic
1191665705 X:63700403-63700425 GTGAACAGAGGGTAGATTAGGGG + Intronic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194198344 X:90924498-90924520 GAAAACATAAGTTAGAATGCTGG - Intergenic
1194829187 X:98599426-98599448 GAAAATAGAGGGCAGATTGCTGG + Intergenic
1194875452 X:99181877-99181899 GTGAATAGAAGCTAGATTACAGG + Intergenic
1195657304 X:107344452-107344474 GAACAGAAAAGGTAGATTGCAGG + Intergenic
1195754191 X:108184827-108184849 GTGAACAGAAGGAAGCTTGCAGG - Intronic
1195932012 X:110087893-110087915 GAGAGCAGGAGGTGCATTGCTGG + Intronic
1195964124 X:110414709-110414731 CAGAATGGAAGGTAGATTGTAGG - Intronic
1195970406 X:110466933-110466955 CAGACAAGAAGGTAGATTGGTGG - Intergenic
1197281211 X:124538460-124538482 GTGAACAGAAGGTATATTTGAGG + Intronic
1198411158 X:136369938-136369960 GAGAACAGAAAGTTGTTTGCAGG + Intronic
1198486557 X:137093066-137093088 GAGAACAGAATTTAGATGTCAGG - Intergenic
1198844179 X:140892068-140892090 GAGAACAGCTGGAAGATGGCAGG + Intergenic
1199254548 X:145704036-145704058 GAGAACAGAATAAAGAGTGCAGG + Intergenic
1199712528 X:150480257-150480279 GATAGCAGAGGGTAGAATGCTGG + Intronic
1199931577 X:152528826-152528848 GTAAACAGAAGGTAGAATGGTGG - Intergenic
1200140841 X:153902267-153902289 GAGGACAGGAGGCAGATTGGGGG - Intronic
1200543393 Y:4488331-4488353 GAAAACATAAGGTAGAATGCTGG + Intergenic
1201419913 Y:13787230-13787252 AAGGACAGAAAGTAGATTGCAGG - Intergenic
1201628060 Y:16036973-16036995 GAGAACAGACGGTAGGATGGGGG - Intergenic