ID: 1111983800

View in Genome Browser
Species Human (GRCh38)
Location 13:95044942-95044964
Sequence TAGAGTTGTGCAGTCATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111983800_1111983803 12 Left 1111983800 13:95044942-95044964 CCTGCAATGACTGCACAACTCTA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1111983803 13:95044977-95044999 AATCACTGAATCACTTCTAAGGG 0: 1
1: 0
2: 1
3: 12
4: 244
1111983800_1111983802 11 Left 1111983800 13:95044942-95044964 CCTGCAATGACTGCACAACTCTA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1111983802 13:95044976-95044998 AAATCACTGAATCACTTCTAAGG 0: 1
1: 0
2: 2
3: 24
4: 228
1111983800_1111983804 13 Left 1111983800 13:95044942-95044964 CCTGCAATGACTGCACAACTCTA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1111983804 13:95044978-95045000 ATCACTGAATCACTTCTAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111983800 Original CRISPR TAGAGTTGTGCAGTCATTGC AGG (reversed) Intronic
902541238 1:17156734-17156756 TAGAGTTCTGCAGTCTTTATAGG + Intergenic
905961684 1:42048168-42048190 TAGAGTTGTGATGTGATTCCTGG + Intergenic
906309894 1:44746353-44746375 TAGAATTGTGACCTCATTGCAGG + Intronic
906463596 1:46056808-46056830 TTTACTTGTTCAGTCATTGCTGG - Intronic
906513736 1:46425907-46425929 TAGAGCTGTGCAGACTATGCAGG + Intergenic
913000351 1:114574214-114574236 TAGTGTTTTGCAGTCATTCATGG + Intronic
915966195 1:160310838-160310860 CAGAGTTGTGCACTTTTTGCTGG + Intronic
923657798 1:235933289-235933311 TTGAGTTTGGCAGTCATTTCAGG + Intergenic
1064207012 10:13333041-13333063 CAGAGTTGTACAGCCATTACCGG - Intronic
1075930675 10:126292681-126292703 CAGAGTTGAGCAGTCATGACAGG - Intronic
1080377832 11:31735040-31735062 TACAGTTGTGCATTTATTTCTGG - Intronic
1082124554 11:48416429-48416451 TAAAATTGTGCAGTCAGTGGAGG + Intergenic
1082558216 11:54587671-54587693 TAAAATTGTGCAGTCAGTGGAGG + Intergenic
1084757171 11:71246936-71246958 AAAAGCTGTACAGTCATTGCTGG - Intronic
1091466143 12:686320-686342 TAGAATTGTGAAGTGATGGCCGG - Intergenic
1094598393 12:31886461-31886483 TAGAATTGTGAAATCATTGTAGG - Intergenic
1095721630 12:45407497-45407519 TGCAGTTTTGCAGTCATTCCGGG - Intronic
1096144731 12:49270572-49270594 TAGAATGGAGCAGTCATGGCTGG - Intronic
1096544289 12:52327118-52327140 TAGAGTTGTTCAGTGAATTCAGG + Intergenic
1099463477 12:82953019-82953041 CAGAGATGTGCAGTCCTTGCTGG + Intronic
1100815980 12:98387694-98387716 TGGAGTTTTGCAATCTTTGCAGG + Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1104754008 12:131257759-131257781 CAGAGCTGTGCAGTCTCTGCAGG - Intergenic
1104811176 12:131621195-131621217 GAGAGCTGTGCAGTCACTGTGGG + Intergenic
1108843343 13:54649022-54649044 TGCAGTGGTGCAGTCACTGCAGG - Intergenic
1109189081 13:59304268-59304290 TAGAGTAGAGAAGCCATTGCTGG - Intergenic
1109894329 13:68664401-68664423 TTTAGATGTGCAGTCATTGTTGG + Intergenic
1111983800 13:95044942-95044964 TAGAGTTGTGCAGTCATTGCAGG - Intronic
1127232157 15:57008428-57008450 TATAGTGGTGCAGTTATAGCTGG + Intronic
1129114525 15:73357838-73357860 TAGAGTTCTGCAGTCCCTGGGGG - Intronic
1135921956 16:26658598-26658620 TAGAGATGTGACATCATTGCAGG - Intergenic
1136121429 16:28137991-28138013 TACAGTTGGGGAGTCATTGCTGG - Intronic
1143552463 17:7639296-7639318 TACAGTGGTGCAATCATGGCTGG + Intergenic
1143809247 17:9457384-9457406 GAGACTCGAGCAGTCATTGCTGG - Intronic
1149956263 17:61054186-61054208 TTGAGTTTTTCTGTCATTGCTGG + Intronic
1161464597 19:4421719-4421741 TGCAGTGGTGCAGTCATAGCTGG - Intronic
1164050300 19:21580427-21580449 TAGAGTTAGGAAGTCAATGCTGG + Intergenic
1164435780 19:28228192-28228214 TAAATATGTGCAGTCATTTCTGG - Intergenic
1165493407 19:36138735-36138757 TGGGGTTGTGCAGTTATTACAGG + Intergenic
1167466770 19:49654342-49654364 AAGAGAAGTGCAGTCACTGCAGG - Exonic
933800789 2:85958848-85958870 TAGGGTGGTGCAGGCACTGCGGG - Intergenic
934158926 2:89229993-89230015 TGGAGTGGTGCACCCATTGCTGG - Intergenic
934208349 2:89952435-89952457 TGGAGTGGTGCACCCATTGCTGG + Intergenic
939496350 2:142932221-142932243 AAGAGTTGTGGAGTCTTTGGAGG + Intronic
940214275 2:151288861-151288883 CAGTGTTGTGCAGTCATGGCTGG - Intronic
942901005 2:181118572-181118594 TAAAGATGTGCAGTCATCACTGG - Intergenic
945866929 2:215186625-215186647 GATAGTTTTGCAGTCATTTCTGG + Intergenic
1170164475 20:13347090-13347112 CAGTGTTTTGCAGTCATTTCAGG - Intergenic
1174491611 20:50901924-50901946 TATAGCGGTGCAGTGATTGCGGG - Intronic
1174913307 20:54630021-54630043 GAGAGTTGCGTAGTCATTGGAGG + Intronic
949234058 3:1787181-1787203 TAGACTTGAACAGCCATTGCAGG - Intergenic
949978142 3:9479431-9479453 TACAGTGGAGGAGTCATTGCAGG + Intergenic
956450653 3:69371444-69371466 CAGAGTTGGGAAGTCATTGAAGG + Intronic
957193958 3:77043689-77043711 TAGGGTTTTGCAGTCATTTATGG + Intronic
957209680 3:77243611-77243633 CAAAGCTGTGCAGTCATTGAAGG + Intronic
960041920 3:113158604-113158626 CAGAGGTGTGCAGTGTTTGCTGG - Intergenic
963846893 3:150168309-150168331 AAGAGTTGTGCAGCCATTCCTGG + Intergenic
964947481 3:162243949-162243971 TAGAGTTGTCCCGCCATTCCGGG + Intergenic
965318831 3:167226032-167226054 TATAGTTGTGCAGTTTGTGCTGG - Intergenic
971394133 4:26213195-26213217 TAGAGGTGTCCTGTCATTTCAGG - Intronic
975439674 4:74396710-74396732 TAGGATTATGCAGTCATGGCCGG - Intergenic
977872180 4:102105446-102105468 TTGAGTTGTGGAGGTATTGCCGG - Intergenic
978829737 4:113069801-113069823 TAGACTAATGCAGTCCTTGCGGG - Intronic
984973657 4:185210790-185210812 TATAGTTGTGCAGTCCCCGCTGG + Intronic
985209725 4:187579784-187579806 TAGAATTGTGCATTCTTTGATGG - Intergenic
987691886 5:21277890-21277912 TAGAGTAGTGAATTCATTTCTGG - Intergenic
987746776 5:21984470-21984492 CAGAGCTGTGCCTTCATTGCTGG + Intronic
991748500 5:69772204-69772226 TAGAGTAGTGAATTCATTTCTGG + Intergenic
991766949 5:69994231-69994253 CAGAGCTGTGCCTTCATTGCTGG + Intergenic
991800080 5:70352049-70352071 TAGAGTAGTGAATTCATTTCTGG + Intergenic
991828520 5:70657990-70658012 TAGAGTAGTGAATTCATTTCTGG - Intergenic
991846181 5:70869308-70869330 CAGAGCTGTGCCTTCATTGCTGG + Intergenic
991892435 5:71351480-71351502 TAGAGTAGTGAATTCATTTCTGG + Intergenic
993321952 5:86481624-86481646 TAGAGTAGGTTAGTCATTGCTGG - Intergenic
996431054 5:123377469-123377491 TAGAGTCCTGCAGTTCTTGCAGG + Exonic
1000965792 5:167654630-167654652 TAGCATTATGCAGTGATTGCAGG + Intronic
1003682490 6:8269691-8269713 TGGAGTTCTGCTGTCATTGCTGG + Intergenic
1007353387 6:41291969-41291991 TAGAGTTTTCCAGTGACTGCTGG + Intergenic
1007598992 6:43070247-43070269 TAGAGTTGTGCAGTGAGTGTTGG + Intronic
1015184934 6:130404965-130404987 TATAGTTGTGCGGTTATTTCTGG + Intronic
1016376471 6:143426017-143426039 TAGAGTTATCCAGTGTTTGCTGG - Intronic
1017617324 6:156259144-156259166 TGCAGTGGTGCAGTCATGGCTGG + Intergenic
1018250230 6:161862263-161862285 GAGACTTGTGCATTCATTTCAGG - Intronic
1023641209 7:42261057-42261079 TACAGTTCTGCAGGCTTTGCAGG + Intergenic
1024383041 7:48721887-48721909 TACAGTTCTGCAGTCTTTACAGG + Intergenic
1030874715 7:114799454-114799476 TAGTATTGAGCAGGCATTGCAGG - Intergenic
1032636510 7:133714820-133714842 TAGTCTAGTGCAGTCATTCCTGG - Intronic
1039011331 8:33096634-33096656 TATAGCTGTGCAGTCACTGCTGG - Intergenic
1043552317 8:81388147-81388169 TAGAGATGTTCACCCATTGCTGG + Intergenic
1044180534 8:89188218-89188240 TAGATTTGTGCAGGCATTGACGG - Intergenic
1045005774 8:97915409-97915431 TTGAGTTGTACAAACATTGCAGG - Intronic
1047611908 8:126529343-126529365 ATGAGTTGTGGAGTTATTGCAGG - Intergenic
1049522624 8:143102036-143102058 TAGAGCATTGCAGTCATTGTGGG - Intergenic
1051156935 9:14158471-14158493 TCAAGTCTTGCAGTCATTGCTGG + Intronic
1052164044 9:25300173-25300195 TAGAATTGTGCAGTCTTTCAGGG + Intergenic
1188817070 X:34728798-34728820 AGGAGTTGTGCAGTAATCGCTGG - Intergenic
1190373415 X:49764812-49764834 TGGAGCTGGGCAGTCATTGTTGG + Intergenic
1194695677 X:97046546-97046568 TATAGTGTTGCTGTCATTGCTGG + Intronic
1197944263 X:131821733-131821755 TAGAGTTTTGCCGTCATCTCAGG - Intergenic
1202183747 Y:22161590-22161612 TAAAGTTGAGCAGTCAATGGGGG - Intergenic
1202207612 Y:22424811-22424833 TAAAGTTGAGCAGTCAATGGGGG + Intergenic