ID: 1111985888

View in Genome Browser
Species Human (GRCh38)
Location 13:95066745-95066767
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 508}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111985888_1111985898 18 Left 1111985888 13:95066745-95066767 CCTCTTGCCCATTCTGCCGATGG 0: 1
1: 0
2: 0
3: 9
4: 508
Right 1111985898 13:95066786-95066808 AGCCTGGCTCTGTATTCCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 253
1111985888_1111985895 2 Left 1111985888 13:95066745-95066767 CCTCTTGCCCATTCTGCCGATGG 0: 1
1: 0
2: 0
3: 9
4: 508
Right 1111985895 13:95066770-95066792 TCCCAATCACTTGGATAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 82
1111985888_1111985893 -7 Left 1111985888 13:95066745-95066767 CCTCTTGCCCATTCTGCCGATGG 0: 1
1: 0
2: 0
3: 9
4: 508
Right 1111985893 13:95066761-95066783 CCGATGGCCTCCCAATCACTTGG 0: 1
1: 0
2: 1
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111985888 Original CRISPR CCATCGGCAGAATGGGCAAG AGG (reversed) Intronic
902117018 1:14129510-14129532 CCAGTGGGAGAATTGGCAAGAGG + Intergenic
903332970 1:22606363-22606385 CCATGGGGAGGATGGGGAAGTGG + Intergenic
903785809 1:25860508-25860530 CCTGCTGCAGACTGGGCAAGAGG - Intergenic
905320477 1:37113168-37113190 ACATGGACAGGATGGGCAAGTGG + Intergenic
907336497 1:53703038-53703060 CACTCGCCAGCATGGGCAAGTGG + Intronic
910674624 1:89804126-89804148 TCATCTGCAAAATGGGAAAGAGG - Intronic
911063335 1:93766082-93766104 CGATTGGCAGAAGGGGAAAGGGG - Intronic
913722795 1:121616835-121616857 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913722935 1:121618701-121618723 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913722949 1:121618969-121618991 CCTTCGGCAGAATCTGCAAGTGG - Intergenic
913722977 1:121619505-121619527 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723124 1:121621370-121621392 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723138 1:121621638-121621660 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723296 1:121623507-121623529 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723446 1:121625373-121625395 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723459 1:121625641-121625663 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723769 1:121629373-121629395 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723814 1:121630047-121630069 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913723972 1:121631916-121631938 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913724136 1:121633782-121633804 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913724466 1:121637520-121637542 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913724797 1:121641258-121641280 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913724959 1:121643127-121643149 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725124 1:121644995-121645017 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725285 1:121646861-121646883 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725446 1:121648727-121648749 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725615 1:121650592-121650614 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725783 1:121652458-121652480 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913725943 1:121654323-121654345 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913726111 1:121656188-121656210 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913726278 1:121658054-121658076 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913726440 1:121659920-121659942 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913726605 1:121661786-121661808 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913726767 1:121663651-121663673 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913727099 1:121667381-121667403 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913727935 1:121676710-121676732 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913728761 1:121686040-121686062 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913728914 1:121687904-121687926 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913729511 1:121695363-121695385 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913729664 1:121697229-121697251 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913729821 1:121699095-121699117 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913729977 1:121700961-121700983 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730135 1:121702827-121702849 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730289 1:121704693-121704715 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730445 1:121706559-121706581 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730599 1:121708425-121708447 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730751 1:121710291-121710313 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913730902 1:121712157-121712179 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731060 1:121714023-121714045 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731211 1:121715889-121715911 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731362 1:121717755-121717777 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731511 1:121719620-121719642 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731666 1:121721486-121721508 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731816 1:121723351-121723373 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913731974 1:121725217-121725239 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913732126 1:121727083-121727105 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913732276 1:121728948-121728970 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913732433 1:121730813-121730835 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913732581 1:121732678-121732700 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913732955 1:121736711-121736733 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913733102 1:121738575-121738597 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913733302 1:121741287-121741309 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913735409 1:121777865-121777887 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913735785 1:121782272-121782294 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913735959 1:121784133-121784155 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736125 1:121785998-121786020 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736282 1:121787863-121787885 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736434 1:121789731-121789753 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736585 1:121791600-121791622 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736767 1:121793788-121793810 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913736941 1:121795654-121795676 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913737218 1:121798794-121798816 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913737468 1:121801630-121801652 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913737630 1:121803494-121803516 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913737780 1:121805184-121805206 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913737944 1:121807046-121807068 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913738161 1:121809575-121809597 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913738321 1:121811405-121811427 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913738517 1:121813800-121813822 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913738823 1:121817220-121817242 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913738984 1:121819086-121819108 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913739321 1:121822816-121822838 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913739457 1:121824671-121824693 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739471 1:121824939-121824961 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739626 1:121826921-121826943 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739640 1:121827189-121827211 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739655 1:121827457-121827479 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739669 1:121827725-121827747 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739855 1:121829961-121829983 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739869 1:121830229-121830251 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913739897 1:121830765-121830787 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740046 1:121832630-121832652 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740060 1:121832898-121832920 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740213 1:121834759-121834781 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740368 1:121836628-121836650 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740381 1:121836896-121836918 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740685 1:121840628-121840650 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740732 1:121841302-121841324 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913740891 1:121843170-121843192 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913741050 1:121845035-121845057 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913741222 1:121847078-121847100 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913741385 1:121848947-121848969 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913741552 1:121850815-121850837 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742555 1:121864091-121864113 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742696 1:121865957-121865979 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742710 1:121866225-121866247 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742838 1:121867825-121867847 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742852 1:121868093-121868115 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742867 1:121868361-121868383 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913742881 1:121868629-121868651 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913743413 1:121874442-121874464 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913743897 1:121880030-121880052 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744065 1:121881899-121881921 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744222 1:121883766-121883788 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744387 1:121885632-121885654 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744523 1:121887497-121887519 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744685 1:121889363-121889385 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913744839 1:121891179-121891201 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745050 1:121893791-121893813 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745205 1:121895657-121895679 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745362 1:121897523-121897545 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745580 1:121900216-121900238 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745735 1:121902082-121902104 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745770 1:121902693-121902715 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913745926 1:121904559-121904581 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913746085 1:121906425-121906447 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913746233 1:121908289-121908311 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913746565 1:121912367-121912389 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913746882 1:121915870-121915892 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913747050 1:121917917-121917939 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913747380 1:121921649-121921671 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913747678 1:121925014-121925036 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913747848 1:121926934-121926956 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913748483 1:121934332-121934354 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913748873 1:121939134-121939156 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913749131 1:121942057-121942079 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913749343 1:121944561-121944583 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913749494 1:121946430-121946452 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913749924 1:121951956-121951978 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750057 1:121953718-121953740 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750215 1:121955584-121955606 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750290 1:121956666-121956688 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750304 1:121956934-121956956 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750319 1:121957202-121957224 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750333 1:121957470-121957492 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750419 1:121958678-121958700 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750574 1:121960544-121960566 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750730 1:121962410-121962432 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913750857 1:121964078-121964100 CCTTCTGCAGAATCTGCAAGTGG - Intergenic
913751556 1:121973313-121973335 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913751826 1:122026543-122026565 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913751984 1:122028407-122028429 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752143 1:122030274-122030296 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752295 1:122032139-122032161 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752456 1:122034007-122034029 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752617 1:122035873-122035895 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752786 1:122037740-122037762 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913752949 1:122039609-122039631 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753109 1:122041475-122041497 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753277 1:122043340-122043362 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753439 1:122045206-122045228 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753600 1:122047073-122047095 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753619 1:122047413-122047435 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753777 1:122049279-122049301 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913753938 1:122051144-122051166 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754097 1:122053014-122053036 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754263 1:122054880-122054902 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754421 1:122056748-122056770 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754572 1:122058696-122058718 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754731 1:122060562-122060584 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913754887 1:122062428-122062450 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913755042 1:122064294-122064316 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913755374 1:122068029-122068051 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913755542 1:122069894-122069916 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913755706 1:122071759-122071781 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913755860 1:122073624-122073646 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756013 1:122075492-122075514 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756179 1:122077357-122077379 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756337 1:122079222-122079244 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756498 1:122081088-122081110 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756654 1:122082954-122082976 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756814 1:122084823-122084845 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913756823 1:122084993-122085015 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913757634 1:122094323-122094345 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913757960 1:122098058-122098080 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913758118 1:122099923-122099945 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913758290 1:122101793-122101815 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913758483 1:122104198-122104220 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913758809 1:122107933-122107955 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913758999 1:122110053-122110075 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913759168 1:122111921-122111943 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913759320 1:122113789-122113811 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913759475 1:122115654-122115676 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913759624 1:122117522-122117544 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913759781 1:122119389-122119411 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913760104 1:122123122-122123144 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913760270 1:122124990-122125012 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913760487 1:122127191-122127213 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913760809 1:122130925-122130947 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913761126 1:122134654-122134676 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913761296 1:122136521-122136543 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913761455 1:122138387-122138409 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913761618 1:122140253-122140275 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913761779 1:122142123-122142145 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913761935 1:122143989-122144011 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762097 1:122145853-122145875 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762263 1:122147719-122147741 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762431 1:122149585-122149607 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762592 1:122151450-122151472 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762757 1:122153316-122153338 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913762904 1:122155182-122155204 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913763230 1:122158913-122158935 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913763556 1:122162645-122162667 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913763718 1:122164511-122164533 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913763874 1:122166376-122166398 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913764036 1:122168242-122168264 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913764201 1:122170112-122170134 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913764515 1:122173845-122173867 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913764701 1:122175917-122175939 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765007 1:122179650-122179672 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765339 1:122183382-122183404 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765445 1:122184736-122184758 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765604 1:122186605-122186627 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765763 1:122188470-122188492 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913765930 1:122190506-122190528 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766089 1:122192372-122192394 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766255 1:122194239-122194261 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766425 1:122196105-122196127 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766584 1:122197970-122197992 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766740 1:122199836-122199858 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913766903 1:122201702-122201724 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767066 1:122203571-122203593 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767224 1:122205440-122205462 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767389 1:122207310-122207332 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767542 1:122209176-122209198 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767701 1:122211042-122211064 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913767868 1:122212908-122212930 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913768021 1:122214774-122214796 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913768357 1:122218511-122218533 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913768516 1:122220377-122220399 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913768838 1:122224113-122224135 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913768947 1:122225571-122225593 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769092 1:122227438-122227460 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769228 1:122229305-122229327 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769550 1:122233547-122233569 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769681 1:122235414-122235436 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769814 1:122237280-122237302 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913769958 1:122239230-122239252 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770097 1:122241095-122241117 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770235 1:122242962-122242984 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770378 1:122244828-122244850 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770518 1:122246694-122246716 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770657 1:122248560-122248582 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770798 1:122250426-122250448 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913770941 1:122252293-122252315 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771080 1:122254160-122254182 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771220 1:122256026-122256048 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771360 1:122257892-122257914 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771500 1:122259757-122259779 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771640 1:122261623-122261645 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771821 1:122264163-122264185 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913771960 1:122266029-122266051 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772098 1:122267895-122267917 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772235 1:122269760-122269782 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772371 1:122271625-122271647 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772513 1:122273492-122273514 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772654 1:122275358-122275380 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772794 1:122277224-122277246 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913772932 1:122279090-122279112 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773072 1:122280957-122280979 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773208 1:122282823-122282845 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773348 1:122284688-122284710 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773491 1:122286554-122286576 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773630 1:122288420-122288442 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773770 1:122290286-122290308 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913773908 1:122292152-122292174 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774051 1:122294018-122294040 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774188 1:122295884-122295906 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774326 1:122297750-122297772 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774465 1:122299616-122299638 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774607 1:122301482-122301504 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774746 1:122303348-122303370 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913774885 1:122305214-122305236 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775024 1:122307080-122307102 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775161 1:122308946-122308968 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775299 1:122310812-122310834 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775578 1:122314544-122314566 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775716 1:122316410-122316432 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775854 1:122318277-122318299 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913775994 1:122320144-122320166 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776137 1:122322010-122322032 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776421 1:122325745-122325767 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776561 1:122327610-122327632 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776704 1:122329476-122329498 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776844 1:122331341-122331363 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913776985 1:122333208-122333230 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777123 1:122335074-122335096 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777263 1:122336939-122336961 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777403 1:122338805-122338827 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777538 1:122340657-122340679 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777680 1:122342523-122342545 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777817 1:122344392-122344414 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913777957 1:122346258-122346280 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778101 1:122348124-122348146 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778242 1:122349986-122350008 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778380 1:122351851-122351873 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778523 1:122353717-122353739 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778663 1:122355583-122355605 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778798 1:122357448-122357470 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913778937 1:122359314-122359336 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779076 1:122361179-122361201 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779221 1:122363047-122363069 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779363 1:122364913-122364935 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779499 1:122366780-122366802 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779632 1:122368645-122368667 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779776 1:122370511-122370533 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913779918 1:122372378-122372400 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780057 1:122374244-122374266 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780193 1:122376109-122376131 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780335 1:122377975-122377997 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780613 1:122381706-122381728 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780752 1:122383574-122383596 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913780894 1:122385439-122385461 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781187 1:122389177-122389199 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781322 1:122391043-122391065 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781460 1:122392909-122392931 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781597 1:122394775-122394797 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781737 1:122396641-122396663 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913781877 1:122398507-122398529 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782018 1:122400373-122400395 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782156 1:122402237-122402259 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782297 1:122404104-122404126 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782441 1:122405971-122405993 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782584 1:122407838-122407860 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913782722 1:122409704-122409726 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783006 1:122413437-122413459 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783146 1:122415303-122415325 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783274 1:122417001-122417023 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783284 1:122417171-122417193 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783423 1:122419037-122419059 CCTTCTGCAGAATCTGCAAGAGG + Intergenic
913783558 1:122420903-122420925 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783699 1:122422770-122422792 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783837 1:122424635-122424657 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913783973 1:122426501-122426523 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913784373 1:122431760-122431782 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913784514 1:122433627-122433649 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913784652 1:122435493-122435515 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913784789 1:122437358-122437380 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913784926 1:122439224-122439246 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785207 1:122442956-122442978 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785348 1:122444822-122444844 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785486 1:122446688-122446710 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785630 1:122448556-122448578 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785771 1:122450422-122450444 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913785925 1:122452459-122452481 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786204 1:122456191-122456213 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786339 1:122458056-122458078 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786484 1:122459922-122459944 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786626 1:122461788-122461810 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786775 1:122463851-122463873 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913786913 1:122465717-122465739 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787050 1:122467584-122467606 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787184 1:122469449-122469471 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787325 1:122471314-122471336 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787462 1:122473179-122473201 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787602 1:122475044-122475066 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787740 1:122476910-122476932 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913787878 1:122478777-122478799 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788015 1:122480644-122480666 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788157 1:122482508-122482530 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788300 1:122484373-122484395 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788439 1:122486239-122486261 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788577 1:122488106-122488128 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788715 1:122489971-122489993 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913788855 1:122491837-122491859 CCTTCTGCAGAATCTGCAAGAGG + Intergenic
913788994 1:122493703-122493725 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913789133 1:122495569-122495591 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913789266 1:122497462-122497484 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913789409 1:122499328-122499350 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913789552 1:122501195-122501217 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913789692 1:122503061-122503083 CCTTCTGCAGAATCTGCAAGTGG + Intergenic
913918988 1:124809083-124809105 CTTTTGGCAGAATTGGCAAGGGG + Intergenic
913919784 1:124818266-124818288 CTTTTGGCAGAATCGGCAAGGGG + Intergenic
913925366 1:124885865-124885887 CTTTTGGCAGAATCGGCAAGGGG + Intergenic
915463927 1:156084950-156084972 CCAGCTGCTGAATGGGGAAGGGG + Intronic
915523776 1:156464036-156464058 CCCTCTGGAGAATGGGGAAGAGG + Exonic
915892159 1:159782372-159782394 CCATCGACAACATGGGGAAGGGG - Exonic
917210999 1:172631933-172631955 CCACCGGCAGAATGGCAGAGTGG + Intergenic
917944719 1:179956972-179956994 TCATCAGCATAAGGGGCAAGTGG - Intronic
917949921 1:180020931-180020953 CCATGGGAAGAATTGGCAAAGGG + Exonic
923390292 1:233508040-233508062 CTATAGGCAGAGTGGGGAAGTGG + Intergenic
923544404 1:234913844-234913866 TCATATGCAGAATGGGCAGGAGG - Intergenic
1065963401 10:30752397-30752419 TCATCTGCAGAATGACCAAGGGG - Intergenic
1074929487 10:118109300-118109322 CCATGGGAAGAATGGACATGGGG - Intergenic
1075023857 10:118969578-118969600 ACATGGGCAGAATGGGCCTGAGG + Intergenic
1078746511 11:14120559-14120581 CCATTGGGAGGGTGGGCAAGTGG - Intronic
1079141349 11:17812063-17812085 CCATCTGCAGAAGGGGCAGGAGG + Intronic
1079322688 11:19464548-19464570 TCATCTGCAGAATGGAGAAGTGG + Intronic
1080238522 11:30099616-30099638 CCTCCAGCACAATGGGCAAGAGG + Intergenic
1082868441 11:57920740-57920762 CCACTGGCAGAATGCTCAAGTGG - Intergenic
1083756936 11:64796890-64796912 CCATCTGCAGAGGAGGCAAGAGG + Exonic
1084403205 11:68956597-68956619 CCCTCGGCAGAGGGGCCAAGAGG + Intergenic
1090065802 11:123502413-123502435 CCACCGGATTAATGGGCAAGGGG - Intergenic
1096618123 12:52846109-52846131 CCATGAGGAGAATGGCCAAGAGG - Intronic
1102454543 12:113063552-113063574 CCATCAGCAGAAGGGGCAGGAGG - Intronic
1106329237 13:28723924-28723946 CGATCAGCAGCATGGACAAGAGG + Intergenic
1107024782 13:35789146-35789168 TCGTGGGCAGAATGGGGAAGCGG - Intronic
1111079599 13:83285823-83285845 CCAGAGGCAGAATTGGCAAAAGG - Intergenic
1111985888 13:95066745-95066767 CCATCGGCAGAATGGGCAAGAGG - Intronic
1113380683 13:109802822-109802844 TCATTGGCATAATGGGCTAGAGG - Intergenic
1113828627 13:113276646-113276668 CCAGCTGCAGAAGGGGCAACAGG + Intergenic
1114699530 14:24663192-24663214 CCATGGGCAGGATGGCCACGGGG + Intergenic
1117855406 14:60025964-60025986 TCATTGGGAGATTGGGCAAGAGG + Intronic
1128244970 15:66126821-66126843 CCAAAGCCAGAACGGGCAAGGGG + Intronic
1130204696 15:81865321-81865343 CCAGCTGCAGAAAGGGAAAGAGG + Intergenic
1132552142 16:557944-557966 CCATCTGCAGAATGGGCAGTGGG - Intergenic
1133908757 16:10045617-10045639 CCATGGCCAGAATGGGCCATTGG - Intronic
1135135268 16:19882618-19882640 CCATGGGCAGAATGGAAAGGGGG + Intronic
1136024178 16:27459365-27459387 CCTTGGGCAGAATGGGGATGTGG + Intergenic
1136556712 16:31011264-31011286 CCATCTGCAGATGGGCCAAGAGG - Intergenic
1136745412 16:32584959-32584981 CCATTAGCAGAATGGACAAAAGG - Intergenic
1137957973 16:52852482-52852504 CCATAGGTAGCATGGGCAGGTGG + Intergenic
1139669195 16:68480248-68480270 CCATAGGCAGAAAGGGTATGTGG + Intergenic
1140478323 16:75249968-75249990 CCATCCGTATAATGGGAAAGGGG + Intronic
1140965122 16:79958524-79958546 CCATTGGCTGTTTGGGCAAGGGG - Intergenic
1141937256 16:87249161-87249183 CCATTTGCAGAAAGGGCATGGGG - Intronic
1203047538 16_KI270728v1_random:844164-844186 CCATTAGCAGAATGGACAAAAGG - Intergenic
1143167157 17:4902482-4902504 CCATCTGCAGAATGAAAAAGAGG - Exonic
1144669069 17:17121598-17121620 CCATCGGCAGCAGGGGAAGGGGG + Intronic
1144727759 17:17510464-17510486 CAATGGGCAGCATGGGCAGGAGG + Intronic
1145126555 17:20304894-20304916 CAACAGTCAGAATGGGCAAGAGG + Intronic
1145500847 17:23972308-23972330 CTATCTGTAGAATGTGCAAGTGG + Intergenic
1145569095 17:24964833-24964855 CTATCTGTAGAATGTGCAAGTGG + Intergenic
1145598685 17:25395405-25395427 CTATCTGTAGAATGTGCAAGTGG + Intergenic
1145623985 17:25764302-25764324 CTATCTGTAGAATGTGCAAGTGG + Intergenic
1145916160 17:28575318-28575340 CCCTAGGCAGCATGGCCAAGCGG - Exonic
1146912370 17:36657061-36657083 CCCTCCGCAGACTGGGAAAGGGG - Intergenic
1151784576 17:76269217-76269239 TCGTCAGCAGCATGGGCAAGAGG - Intronic
1152159872 17:78661087-78661109 CCATCGGGCGAATGGCCATGTGG - Intergenic
1157286058 18:46378289-46378311 CCATCTGTAGTATGGGCAAAGGG - Intronic
1159692064 18:71500640-71500662 CCATCCGGAGAAAGAGCAAGTGG + Intergenic
1163584774 19:18157630-18157652 CAATCTGCAGAATGGGGAGGGGG - Intronic
1163784942 19:19270163-19270185 CCATCTGCAGAAGGTGCAGGAGG - Exonic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
928721194 2:34123648-34123670 CCTTCAGGAGAATGGGCATGGGG - Intergenic
943684918 2:190808459-190808481 CCATGGGCAGTATGCACAAGTGG - Intergenic
946089404 2:217207605-217207627 CCATCTGCAAAATGAGCACGAGG - Intergenic
946209708 2:218137697-218137719 CCAAATGCAGAATGGGGAAGTGG + Intergenic
946396394 2:219445692-219445714 CCAGGGGCAGATGGGGCAAGGGG + Intronic
1169409560 20:5356066-5356088 CCATCTGTACAATGGGCAGGTGG - Intergenic
1170941827 20:20854368-20854390 CCACAGGAAGTATGGGCAAGGGG + Intergenic
1171164214 20:22956361-22956383 CCATGGGCAGAATGGCAAAGTGG + Intergenic
1172252745 20:33490802-33490824 CCATCTGCAAAATGGGGATGTGG + Intronic
1172282749 20:33719739-33719761 CCATCTGCACAATGGGGAACTGG - Intronic
1177530672 21:22354469-22354491 CCATCAGAAGAATGGAAAAGGGG - Intergenic
1179094484 21:38299996-38300018 TCATGGGCAGAATGAGGAAGGGG - Exonic
1180356650 22:11848859-11848881 CCCTTGGCAGAATGTGCAACAGG + Intergenic
1180381611 22:12143472-12143494 CCCTTGGCAGAATGTGCAACAGG - Intergenic
1180977491 22:19856294-19856316 CCATCAGCAGAGTGGGCAGTGGG + Intergenic
1183590241 22:38775717-38775739 CCATCTGCAGTATGGGGAGGAGG - Intronic
1185205511 22:49535781-49535803 CCCCCGGGAGGATGGGCAAGGGG + Intronic
1185348096 22:50319437-50319459 CCAACTGCAGTCTGGGCAAGAGG - Intronic
950288281 3:11762435-11762457 CCATCGGCATACTAGGTAAGAGG - Intergenic
952519420 3:34141291-34141313 CCACCTACAAAATGGGCAAGAGG - Intergenic
953472724 3:43180706-43180728 CCATGGGCAGCATCTGCAAGGGG + Intergenic
957159998 3:76598546-76598568 CCATTGGGGGAATGGGCAAAGGG + Intronic
957637689 3:82807923-82807945 CGATCAGCAGCATGGACAAGAGG + Intergenic
958865575 3:99498181-99498203 CCATTGGCATAAAAGGCAAGTGG - Intergenic
959016641 3:101142228-101142250 CCATGAGCAAAATGGGCAAGAGG + Intergenic
961205248 3:125076440-125076462 CCATTGTCAGAGTGGGCTAGGGG + Intergenic
962560781 3:136604359-136604381 CCCTCAACAGAATGGGGAAGGGG - Exonic
966160982 3:176968068-176968090 ACATCTGCAGAAAGGCCAAGAGG + Intergenic
968012786 3:195297379-195297401 GCATCTGCAGAATGTGTAAGGGG - Intronic
970815485 4:20151296-20151318 CCTTAGGCAGCCTGGGCAAGTGG - Intergenic
971949376 4:33324917-33324939 ATATCTGCAGAATGGGCAGGAGG + Intergenic
975102587 4:70531343-70531365 TCATCTGCAGAATGGAAAAGAGG + Intronic
982976900 4:162075211-162075233 CAATCAACAGAATGGACAAGGGG - Intronic
984256217 4:177392933-177392955 CCACAGGCAGAATGGGAGAGTGG - Intergenic
984807558 4:183765603-183765625 CCATCGGCTGAATGAGCTACAGG - Intergenic
989859976 5:46359499-46359521 CTATCTGCAGAATCTGCAAGAGG - Intergenic
990322091 5:54640100-54640122 CCCCTGGCAGAATGGGCAAAGGG + Intergenic
991498179 5:67248743-67248765 CCATTAGCAAAATAGGCAAGTGG - Intergenic
991958445 5:72018625-72018647 CAATGGGCAGAAGGGGAAAGAGG - Intergenic
995793238 5:115915860-115915882 CCAACAGCAAAATGGGCAAGAGG + Intergenic
996358945 5:122624403-122624425 CCAAATACAGAATGGGCAAGTGG - Intergenic
997184330 5:131866449-131866471 CCATTGGCAGAATGCTCAGGTGG + Intronic
998920097 5:147058672-147058694 CCACATGCAGAATGGGCAAGAGG + Intronic
1007297244 6:40834115-40834137 ACATGGGCAGAATGGGTCAGGGG - Intergenic
1012527511 6:100196263-100196285 TCATCTGCAGACTTGGCAAGTGG - Intergenic
1013285418 6:108677199-108677221 CAATCTGCAGAAAGGGAAAGTGG + Intronic
1021262670 7:18477834-18477856 CCATTGGCAGAAAGGGCAGATGG - Intronic
1025579379 7:62692265-62692287 CCATTTGCAGAATGGACAATTGG + Intergenic
1026289837 7:68996651-68996673 CAATAGCCAGAATAGGCAAGAGG - Intergenic
1028240979 7:88420288-88420310 CCATCCACAGAATGGGCTAATGG - Intergenic
1028556814 7:92134250-92134272 CGATCAGCAGCATGGACAAGAGG + Exonic
1029357805 7:100065700-100065722 TCATAGGCAGAAGGGTCAAGTGG - Intronic
1034745845 7:153523510-153523532 CCATCGGGAGCCTGGGCATGGGG + Intergenic
1036228816 8:6982524-6982546 GCCTCAGCAGAATGGACAAGTGG + Intergenic
1036231268 8:7001634-7001656 GCCTCAGCAGAATGGACAAGTGG + Intronic
1038778646 8:30552457-30552479 CCAGCGACAGGATGGGAAAGTGG + Intronic
1040535701 8:48307719-48307741 CCAAAGGCAAAATGAGCAAGAGG - Intergenic
1041793521 8:61722569-61722591 CCTTCCACAGAATGGGCTAGAGG - Intergenic
1049463237 8:142739692-142739714 CCAGCGGCACAATGGGGATGAGG - Intergenic
1049626774 8:143626909-143626931 CCATCACCAGAATCGGGAAGAGG + Intergenic
1052804735 9:33002623-33002645 CAAACAGCAGCATGGGCAAGTGG - Intronic
1057309594 9:93933730-93933752 CCAGCGACAAAATGGTCAAGTGG - Intergenic
1058832920 9:108835400-108835422 GCATAGGCAGAATGGGCATGGGG + Intergenic
1059434497 9:114267900-114267922 CCAACAGCAGAATGGGGAGGGGG - Intronic
1061785159 9:133023420-133023442 CCCTGGGCAGCAGGGGCAAGCGG - Intergenic
1061806713 9:133141039-133141061 CCATCTGTCAAATGGGCAAGGGG - Intronic
1062543140 9:137050329-137050351 GCATCGGGAGAAGGGGCAGGAGG + Exonic
1203409483 Un_KI270538v1:90762-90784 TCATTTGTAGAATGGGCAAGTGG - Intergenic
1187045652 X:15646162-15646184 GCAGCTGCAGAAGGGGCAAGTGG - Intronic
1187051684 X:15702599-15702621 GCAGCTGCAGAAGGGGCAAGTGG - Intronic
1189123856 X:38425036-38425058 CCATAGGCTGAATGGGGAACGGG + Intronic
1189192026 X:39118445-39118467 ACAACGGAAGAATGGGCAAATGG + Intergenic
1193655326 X:84190256-84190278 CAATAGGCAGAATTGGGAAGAGG - Intergenic
1196220384 X:113107235-113107257 CCATTGTCAGAGTTGGCAAGTGG - Intergenic