ID: 1111986683

View in Genome Browser
Species Human (GRCh38)
Location 13:95073055-95073077
Sequence AACTTTAAACAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111986680_1111986683 19 Left 1111986680 13:95073013-95073035 CCATAAGACTCAGAAAAAGATGT 0: 1
1: 0
2: 1
3: 26
4: 313
Right 1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG 0: 1
1: 0
2: 1
3: 22
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111986683 Original CRISPR AACTTTAAACAGATGGAGGA AGG Intronic
901723569 1:11220606-11220628 ATGTTTAATAAGATGGAGGAAGG + Intronic
901743741 1:11359082-11359104 TGCTTGGAACAGATGGAGGAGGG - Intergenic
902192247 1:14772043-14772065 AAATTTAATCTGGTGGAGGATGG + Intronic
903599462 1:24524953-24524975 AACATTAAAGAGTGGGAGGACGG - Intronic
903760103 1:25691801-25691823 AACTTTTAACAGGAGGAGGTGGG + Intronic
906508797 1:46399201-46399223 AAAACAAAACAGATGGAGGAGGG + Intronic
907492459 1:54816882-54816904 AACTCATAACAGATGGAGTAGGG + Intronic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
909168300 1:72257538-72257560 ATCTTTAAATATATGGAGGAGGG - Intronic
909942964 1:81632399-81632421 AATTTCAAACAGAGGGAAGAAGG + Intronic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
911245228 1:95509493-95509515 AACTTTAAACAGGTAGAACAAGG - Intergenic
913003159 1:114601971-114601993 AGCTTTAAACAGCAAGAGGAAGG - Intronic
916097942 1:161367811-161367833 AACGTTAAAGAAATGGAGAATGG + Exonic
916189404 1:162164551-162164573 AAATTCATAGAGATGGAGGATGG - Intronic
917968337 1:180192394-180192416 CACTTTAGAAAGGTGGAGGATGG + Intronic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
919334360 1:196213089-196213111 AGCATTAAACAGATGTAGGTGGG + Intergenic
919579728 1:199356527-199356549 AACTTTAAAAAGAAGTAGTATGG + Intergenic
922292360 1:224218999-224219021 AGCTGAAAGCAGATGGAGGAGGG + Intergenic
924673335 1:246150874-246150896 ATCCTAAAAGAGATGGAGGAAGG + Intronic
924843467 1:247739606-247739628 AATTTTAAACAGCTAGTGGATGG - Intergenic
1064045910 10:12015269-12015291 AACTTTTAGAAGATGGAAGATGG - Intronic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1065858821 10:29853191-29853213 AACTCTCAACAGATGCAGGCTGG + Intergenic
1066341913 10:34542786-34542808 AATTTTAAAAAGATGGAACAAGG + Intronic
1066538072 10:36412904-36412926 TACTTTAAACAGATGGTGCATGG - Intergenic
1067281147 10:44874105-44874127 AACTTTAAAGAAATATAGGAAGG + Intergenic
1072628843 10:97132024-97132046 TACTTTAAACATTTGGGGGATGG - Intronic
1075019597 10:118941882-118941904 AACATTAATAAGATGGCGGAGGG + Intergenic
1075630375 10:123996990-123997012 ATCTTTAAACAGTTTGAGGCTGG - Intergenic
1076092549 10:127700377-127700399 ACCTTGACACAAATGGAGGATGG - Intergenic
1077204968 11:1337620-1337642 AACGTTAAAAAGAGGGAGGGTGG + Intergenic
1079576629 11:22011571-22011593 AACATTAAACTGGTGAAGGATGG + Intergenic
1080886665 11:36374502-36374524 AACTTTAAATAGGTGGAATAGGG + Intronic
1080898966 11:36469482-36469504 AAATTTAAAAAGTTAGAGGAGGG - Intergenic
1081049481 11:38319797-38319819 AACTATAAAAAAATAGAGGAGGG + Intergenic
1082257299 11:50045006-50045028 AATTTTAAAGAGTTGCAGGAGGG - Intergenic
1083986592 11:66219774-66219796 AACTTTAAACCGCTTCAGGAGGG - Exonic
1085275873 11:75299904-75299926 AAGTTTAAAAAGATGGTGGTAGG + Intronic
1086525410 11:87719629-87719651 TACCTAAAACAGAGGGAGGAGGG + Intergenic
1086890281 11:92249769-92249791 AGCTTCCATCAGATGGAGGAGGG - Intergenic
1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG + Intronic
1087117169 11:94537831-94537853 AACTCTCTCCAGATGGAGGAAGG - Intergenic
1087344496 11:96953971-96953993 AAATTTAAACAGTTGGAAAAAGG + Intergenic
1089280995 11:117374423-117374445 TCCTCCAAACAGATGGAGGATGG - Intronic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1094034195 12:26049056-26049078 ACCTTAAAAAAGATGAAGGAGGG - Intronic
1094741428 12:33293621-33293643 ACCTCCAAAGAGATGGAGGAGGG + Intergenic
1095618533 12:44222039-44222061 TACTTTATAATGATGGAGGAGGG + Intronic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1098711779 12:73771886-73771908 TACTTTAAATAAATGAAGGATGG + Intergenic
1099642210 12:85304957-85304979 TACATAAAACAGATGGAGGCTGG - Intergenic
1100304078 12:93334446-93334468 AGCCTTAAAAAGATGGAGGCTGG - Intergenic
1100510051 12:95261705-95261727 AAATTTAAACAAATAGAGGCCGG - Intronic
1100884429 12:99054448-99054470 AACTTTAAAATGAAGGAGTAGGG - Intronic
1101960715 12:109247669-109247691 CACTGTAAACACATCGAGGAAGG + Exonic
1103821883 12:123705459-123705481 CACTTAAAACCGATGGAGGCAGG - Intronic
1104038737 12:125115811-125115833 GACTGCACACAGATGGAGGACGG + Intronic
1104154725 12:126120451-126120473 ATTTTCAACCAGATGGAGGAAGG - Intergenic
1104193351 12:126505362-126505384 TAGATTAAATAGATGGAGGATGG + Intergenic
1106264366 13:28096885-28096907 AAGATTAAAGAGATGGAGGTAGG - Intronic
1106491664 13:30229790-30229812 AACTTAAAATAGATGGTGCATGG + Intronic
1107681826 13:42859718-42859740 ATCATTACACAGATGCAGGAAGG - Intergenic
1107773040 13:43809100-43809122 AATTTCAAATGGATGGAGGAGGG - Intergenic
1108255726 13:48609282-48609304 AAAATTAAACAGTTGGGGGAGGG - Intergenic
1108529881 13:51318950-51318972 AATCATAAAAAGATGGAGGAAGG - Intergenic
1109864065 13:68239390-68239412 AACTTTAAAAAGCTGTAGGCCGG + Intergenic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1112553063 13:100440676-100440698 GACTTCAAACAGATGGGGGTGGG - Intronic
1114045573 14:18872775-18872797 AACCCTAAACAGATAGTGGAAGG + Intergenic
1114118639 14:19646693-19646715 AACCCTAAACAGATAGTGGAAGG - Intergenic
1114620127 14:24090827-24090849 AGCTTTAGGCAGATGGAGCAAGG - Intronic
1117160095 14:52980921-52980943 AAGTTTAAACAGATGGGGCTGGG - Intergenic
1118510328 14:66464915-66464937 TAATTTAAATAGATGGAGGAAGG - Intergenic
1118669697 14:68110408-68110430 ATCTTGAGACAGATGGAGAAAGG - Intronic
1120431077 14:84416812-84416834 AACTGTAAACAGAGGGACAAAGG - Intergenic
1121899858 14:97684191-97684213 AACTTTGGACAGAAGGGGGAAGG - Intergenic
1122684134 14:103491216-103491238 AACTAAAATCACATGGAGGAAGG - Intronic
1123064112 14:105607443-105607465 AACTTTAAAAAGTTGGGGGATGG - Intergenic
1123073423 14:105653086-105653108 AACTTTAAAAAGTTGGGGGATGG - Intergenic
1123093348 14:105751853-105751875 AACTTTAAAAAGTTGGGGGATGG - Intergenic
1126012979 15:44320948-44320970 AAATTTAAACAGATGGGAAAGGG - Intronic
1126140237 15:45431623-45431645 AACTTGAAACTGTTGGAGGCTGG + Intronic
1126863579 15:52912800-52912822 AACTTTAAGCTGCTGGAGAAAGG - Intergenic
1126898318 15:53284252-53284274 AAATTTAAAAAGATGGATGGGGG - Intergenic
1126904471 15:53349520-53349542 ATCTTTCAAAAGATGGAGGAAGG + Intergenic
1126981614 15:54250487-54250509 AACATGAAACAGATGGAATAAGG - Intronic
1127239628 15:57098415-57098437 TACATAAAAAAGATGGAGGAAGG - Intronic
1127364146 15:58271728-58271750 AACTATAAACACAGGAAGGATGG + Intronic
1128065618 15:64762818-64762840 AGCTCTGAGCAGATGGAGGATGG - Intronic
1128393675 15:67201424-67201446 AACCTGAAACAGATGGCAGAAGG - Exonic
1129617318 15:77108978-77109000 AATTTTAAACAGTTGCAGGGAGG + Exonic
1129640522 15:77372466-77372488 AGATTCAAACAGATTGAGGATGG - Intronic
1131938332 15:97532814-97532836 ATCCTTAAAGAGATTGAGGAAGG + Intergenic
1135122373 16:19777582-19777604 ATCTTCAAATAGAGGGAGGAAGG + Intronic
1135180167 16:20266305-20266327 AACTTTAATTATATGGTGGAGGG - Intergenic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1139084644 16:63570016-63570038 GTCTTTCAACAGATGGAGGCAGG - Intergenic
1139502490 16:67378646-67378668 AAAATTCAACAGTTGGAGGAAGG + Exonic
1139510437 16:67425194-67425216 AACTGAAACCAGATGGAGGGGGG - Intergenic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140804012 16:78516017-78516039 AACCTTAAAGAGAGGGAGCAGGG - Intronic
1143049894 17:4116362-4116384 AACTTCCAACAGATGGAGTTAGG - Intronic
1144223254 17:13119596-13119618 ATCTTTAAACAAAAGGAGAAAGG - Intergenic
1149733289 17:58968129-58968151 AACTTTAATGACATGAAGGACGG - Intronic
1152823580 17:82449768-82449790 AACTTTCAGCAGGTGGAGGAGGG - Intronic
1153229814 18:2924981-2925003 GACTCTCAAGAGATGGAGGAAGG + Intronic
1155095632 18:22552779-22552801 AACTTTGAAAGGATTGAGGATGG + Intergenic
1156783322 18:40878703-40878725 AAATGCAAACAGATGTAGGAGGG - Intergenic
1157208823 18:45723496-45723518 AAATTTAAAAAGAAGGGGGAAGG + Intergenic
1158236169 18:55317017-55317039 AAATTTAATCAGAGGCAGGAAGG + Intronic
1158339010 18:56445493-56445515 GACTTTAAAGAGGTGGAGGAGGG + Intergenic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1160582323 18:79891082-79891104 AACTTAAAGCAGGTGGGGGAAGG - Intronic
1160752851 19:742794-742816 AACTGTCTACAGATGGAAGAAGG - Intronic
1160917129 19:1502375-1502397 GTCTTTAAACAAATGGAGGCCGG + Intergenic
1162810997 19:13164251-13164273 ATCTGAAATCAGATGGAGGAGGG + Intergenic
1164092144 19:21966258-21966280 AATTCTAAAAAGAAGGAGGAAGG - Intronic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1164211686 19:23103246-23103268 AAGTTCAAACAAATGGTGGAAGG + Intronic
1164679115 19:30122157-30122179 CACTTCACACAGATGGAGGGAGG + Intergenic
1165725132 19:38107357-38107379 AACTTGAAACGGATGGAGGTTGG + Intronic
1168330871 19:55567710-55567732 AATTTTATAAAGATGGATGATGG + Intergenic
926288101 2:11506644-11506666 AACTTTCAAGACATGAAGGAAGG - Intergenic
926927161 2:17998771-17998793 AGGTTTAAACAAATGGTGGAAGG + Intronic
929279318 2:40060840-40060862 AGCTATTAACAGCTGGAGGAAGG - Intergenic
929385823 2:41405000-41405022 AACTTTATTCATATGGAGTAAGG + Intergenic
929718674 2:44342357-44342379 TACTTTAAATAACTGGAGGAAGG + Intronic
929896450 2:45964594-45964616 AACTGTGAATGGATGGAGGAGGG + Intronic
930403364 2:50921176-50921198 AACATTAAACACAATGAGGATGG + Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
930915090 2:56677054-56677076 AACTTGAAACACAAGGAAGATGG + Intergenic
930971423 2:57399078-57399100 ATCTTTAAAGAGATGAAAGATGG - Intergenic
931999577 2:67872276-67872298 AACTGTTGACAGATGGAGAATGG + Intergenic
932095720 2:68846674-68846696 ATCTTTAACCAAATGGAGCACGG + Intergenic
932299703 2:70657631-70657653 AACGTGAATCAGAAGGAGGATGG - Exonic
932556348 2:72828207-72828229 AATTCCAAACAGATGTAGGAGGG + Intergenic
932794743 2:74684599-74684621 AAGTTCAAGCAGATGGAGAAGGG + Intergenic
935473641 2:103490629-103490651 AACCTAAAACAAATGGTGGAAGG + Intergenic
936244947 2:110818617-110818639 AATTTTAAAAAGACGGGGGATGG + Intronic
937426353 2:121802504-121802526 ACCTTTAAAGAGATGATGGAGGG + Intergenic
937766545 2:125667648-125667670 AACTTTAATCAGAGGCAGCAAGG + Intergenic
937782536 2:125855452-125855474 AACTTTAAACAGAATCTGGAAGG + Intergenic
938269646 2:129958275-129958297 AACCCTAAACAGATAGTGGAAGG - Intergenic
938691646 2:133796115-133796137 AACTTTAAACAGAGAGTAGAAGG - Intergenic
939311072 2:140477993-140478015 AATTTTACCTAGATGGAGGAAGG + Intronic
940288798 2:152058122-152058144 AACTTTACAGTCATGGAGGAAGG - Intronic
940305769 2:152224747-152224769 AACTGAAAACAGATAGAGGTGGG - Intergenic
941389654 2:164895950-164895972 AACTTTAAAAAGGTGGTGGTAGG - Intergenic
942109967 2:172672218-172672240 AACTTTAAACAGCTTGAAAAGGG - Intergenic
942873428 2:180764076-180764098 GACTTTAAACACATGAAGTAGGG + Intergenic
944330841 2:198464689-198464711 AACTTTTAACAGGTGGTAGATGG + Intronic
944837553 2:203594970-203594992 AACATTAAACAGGTTCAGGAAGG + Intergenic
946346271 2:219113336-219113358 AACTCAAAACAAATTGAGGAGGG + Intronic
947112795 2:226737686-226737708 AGCTCTAGACACATGGAGGATGG + Intronic
1169896670 20:10511502-10511524 AAATTAAAACAGCTGGAGGTAGG - Intronic
1169963267 20:11186972-11186994 ATTTTTAAAGAGTTGGAGGAAGG - Intergenic
1170496194 20:16927864-16927886 AATTTTATACAGATGTAGCAAGG + Intergenic
1170843023 20:19939351-19939373 ACCTTTAAATAGATCCAGGATGG + Intronic
1171332374 20:24351802-24351824 AACATTGAATAGATGGAGAATGG - Intergenic
1172285235 20:33735612-33735634 AAATTTAAACAAATGCAGGGTGG - Intronic
1172470525 20:35190819-35190841 ATCTTTGAACATATGTAGGACGG - Intergenic
1175653051 20:60745392-60745414 AATCCTAAGCAGATGGAGGAGGG - Intergenic
1177679186 21:24341810-24341832 AATTTTTCACAGATGGGGGAAGG + Intergenic
1180464104 22:15595392-15595414 AACCCTAAACAGATAGTGGAAGG + Intergenic
1181379108 22:22485682-22485704 AAATTTAACTAGATTGAGGAGGG + Exonic
1181726701 22:24816304-24816326 GACTTGAAAAGGATGGAGGATGG - Intronic
1181845488 22:25705210-25705232 AACTTTTGAGAGGTGGAGGAAGG - Intronic
1184605402 22:45570826-45570848 TACTTTAAAGAAAAGGAGGAAGG + Intronic
1184840465 22:47049519-47049541 AACTTTACAGAGATGAAAGAAGG + Intronic
1185264525 22:49893400-49893422 AACCTTAAGCAGAGGGAGGGAGG + Intergenic
1203238073 22_KI270732v1_random:26673-26695 AAAAGTAAAAAGATGGAGGAGGG - Intergenic
949970671 3:9400423-9400445 ATGATTAAAGAGATGGAGGAAGG - Intronic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
951519142 3:23594927-23594949 ATTTTTAAAAAGATGGATGAGGG - Intergenic
951972974 3:28469057-28469079 AAAGTTAAAAAGAGGGAGGAAGG + Intronic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
953142051 3:40238170-40238192 AAATTTAAAAAGCTGAAGGATGG - Intronic
956578660 3:70784371-70784393 AACATTAAACTGAAAGAGGAGGG - Intergenic
957243054 3:77683912-77683934 AACGATCAACAGATGGAGGAAGG + Intergenic
961135400 3:124505332-124505354 AACTTTAAGCAGAAGGAGTTGGG + Intronic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962947988 3:140189785-140189807 ACTTTTAAACAAATGGATGAGGG - Intronic
962979865 3:140478763-140478785 AACTGAAAAAAGAGGGAGGAAGG + Intronic
964292568 3:155197724-155197746 AACTTTAATTTGATGGAGGTAGG + Intergenic
965275977 3:166683385-166683407 ACCTTTAAGAAGATGGAGGGTGG - Intergenic
967773905 3:193364491-193364513 AACATTAAACAGAAAGAGTATGG + Intronic
969341088 4:6541846-6541868 AACTTTAAAAAAAGGGAGGAGGG + Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970779270 4:19716255-19716277 AACCTTTCACAGATGGAGCAGGG - Intergenic
971578937 4:28309046-28309068 AACCTTAAACAGAATCAGGAAGG + Intergenic
971892993 4:32549730-32549752 AACTTTAAAATGATAGATGATGG + Intergenic
973218816 4:47702261-47702283 AATTTTAAACAAATACAGGATGG + Intronic
974662656 4:64913708-64913730 AAATTTAAACAGAAGGAATAGGG + Intergenic
979006891 4:115310325-115310347 AACTTTAAACACATATAGAAAGG + Intergenic
979049110 4:115907544-115907566 AACTTTAAAAAGCTGGAAGATGG - Intergenic
979374086 4:119924054-119924076 ATTTTGAAACAGATAGAGGAGGG - Intergenic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
980006273 4:127545626-127545648 AAATAAAAACTGATGGAGGAAGG + Intergenic
980068894 4:128221600-128221622 ATCTTAAAACACATGGAGAAAGG - Intronic
980289780 4:130830623-130830645 AACTTTCAACCAATGGAGGGTGG + Intergenic
982129562 4:152215769-152215791 AACTTAAAACACATGGTGTAGGG + Intergenic
982312383 4:153999670-153999692 AAATACAAACAGGTGGAGGAAGG - Intergenic
982356876 4:154480366-154480388 AGCTTTGAAAAGTTGGAGGACGG + Intronic
983650054 4:170028118-170028140 AATTTAAAAGAGATGGGGGAGGG - Intronic
984404427 4:179309015-179309037 AACATCAAAAAGTTGGAGGATGG + Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
985796430 5:1965507-1965529 AACTATAAACAGCTGCAGGCAGG - Intergenic
986726080 5:10598088-10598110 AACTTAGAAGAGATGGAGGCTGG - Intronic
988090204 5:26529558-26529580 AACTTTAAACACATGAAGTTAGG + Intergenic
991592615 5:68269390-68269412 AAATGTAAACTGTTGGAGGATGG + Intronic
992607850 5:78479283-78479305 AATTTTAAAAAAATTGAGGATGG + Intergenic
994008437 5:94870319-94870341 AACTTTAAAGGTATGGAGGGGGG - Intronic
994273095 5:97805389-97805411 AAGTTTAAACAAGTGGTGGAAGG - Intergenic
995339201 5:111038415-111038437 AACTTTAAAAATAAGGAGTATGG + Intergenic
995385195 5:111581076-111581098 AGCTTTAATCAGATGGAAGAGGG - Intergenic
995547436 5:113247128-113247150 TAGTTTACACATATGGAGGAAGG + Intronic
995808175 5:116077661-116077683 ACCCTTAAACAAATGGAGGGTGG - Intergenic
996370271 5:122745927-122745949 GATTTTACAAAGATGGAGGAAGG + Intergenic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1004338431 6:14785178-14785200 TGCTTTAAACAAATGGGGGAAGG + Intergenic
1004458100 6:15810253-15810275 ATCACTAAACAGATTGAGGAAGG + Intergenic
1004559972 6:16740002-16740024 AGCTGTAAAGAGATTGAGGAGGG + Intronic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG + Intergenic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1008612467 6:53197081-53197103 CACTTTAAACAGAAGGAAAATGG - Intergenic
1010338247 6:74715179-74715201 AATTTAAAACAAATGGAAGAGGG - Intergenic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1012465561 6:99513454-99513476 AAATTTAAATTGATGGAGGTAGG - Intronic
1012699731 6:102439762-102439784 AACTTTAAAGACATGGAATAAGG - Intergenic
1013699854 6:112752396-112752418 AACTTTAATCATCTGGTGGAGGG + Intergenic
1015191075 6:130472976-130472998 AACTTTCTTCAGCTGGAGGAAGG + Intergenic
1015472544 6:133621963-133621985 AACTTGAAACAGAATGAGGCAGG - Intergenic
1016056249 6:139580498-139580520 AACTTGAACCAGAAGGAGGGTGG - Intergenic
1016246202 6:141984086-141984108 AGCTTTAAAAAGGTGGAGGGGGG + Intergenic
1017414064 6:154201108-154201130 AACTTTACAATCATGGAGGAAGG - Intronic
1017562736 6:155647656-155647678 AACATTAAACAGAATGAGAAAGG + Intergenic
1018493800 6:164326476-164326498 AACTTAAAACAGAAAGAGTATGG - Intergenic
1019879849 7:3849075-3849097 AACTCTAAACAGAGAAAGGACGG - Intronic
1021025040 7:15656163-15656185 AACTTTAATCAAAAGAAGGAAGG - Intronic
1021395012 7:20136743-20136765 AAGTTCATACAGAAGGAGGAGGG + Exonic
1022496330 7:30855276-30855298 AACCTTAAACACTTGGAGAAGGG + Intronic
1024557923 7:50619656-50619678 AACTTGAAAGAGGTGGAGGAGGG + Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1027876427 7:83775489-83775511 AACTATAAATAGATGAAAGATGG + Intergenic
1028065456 7:86377925-86377947 AACATTAGACAGATGGAGACAGG + Intergenic
1028847355 7:95496987-95497009 AATATTAAACAGATAGAAGAGGG + Intronic
1031035019 7:116779493-116779515 AATTTTAAACAGATTAGGGAAGG - Intronic
1031275726 7:119720760-119720782 AATTCAGAACAGATGGAGGAAGG - Intergenic
1033203425 7:139394500-139394522 AACTTTAAAGAAGTGGAGGCAGG + Intronic
1033326148 7:140379944-140379966 AACTTTAAATAGGTGGAAAAGGG + Intronic
1034310284 7:150081734-150081756 AACTTTGAAGATATGGGGGAAGG + Intergenic
1034739440 7:153459933-153459955 AGCTTAAAAGACATGGAGGATGG - Intergenic
1034796560 7:154018919-154018941 AACTTTGAAGATATGGGGGAAGG - Intronic
1035659047 8:1333198-1333220 CACATTACAGAGATGGAGGAAGG + Intergenic
1036569731 8:9969629-9969651 AATTTTAAAAAGGAGGAGGATGG - Intergenic
1037624959 8:20598580-20598602 AACCTTAAGCAGAGTGAGGAGGG - Intergenic
1039246610 8:35615392-35615414 AACCACAAACAGATGGATGAGGG - Intronic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1040875830 8:52151033-52151055 AATTTTAAATTGATGGATGATGG - Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1044617158 8:94154477-94154499 GATTTTAAACTCATGGAGGATGG + Intronic
1044698204 8:94944066-94944088 AATTTAAAATAAATGGAGGAAGG - Intronic
1044937550 8:97307802-97307824 AATTTTAGACAGATTGAAGAGGG + Intergenic
1045284319 8:100776976-100776998 AACTTTAAACTCTTTGAGGAAGG - Intergenic
1048175827 8:132151429-132151451 AAGTTTAAACAAATGGTGGAAGG + Intronic
1050016111 9:1236200-1236222 CACTTTCAACAGCTGGAGGATGG - Intergenic
1050135511 9:2459469-2459491 CAATTTAAAAAGGTGGAGGAGGG + Intergenic
1050474494 9:6025899-6025921 AACCTAAAACAGACGGAAGACGG - Intergenic
1050565730 9:6880786-6880808 ATCTTTAAAAAAAAGGAGGAAGG - Intronic
1050824206 9:9923955-9923977 AAATCTAAACATATGAAGGATGG + Intronic
1050924512 9:11247213-11247235 AACTTTAACCAGATGGAAAAGGG - Intergenic
1051046589 9:12882761-12882783 TAGTTTATACAGATGTAGGAAGG - Intergenic
1051569705 9:18541791-18541813 AATTGGAAACAAATGGAGGATGG + Intronic
1055922220 9:81472893-81472915 AAGTTTAGCCAGATGGAGGCGGG - Intergenic
1057171875 9:92967867-92967889 AGCCTTAAACAGAAGGAGGCCGG - Intronic
1057955091 9:99401051-99401073 AAGTTGAAACAGCTGGGGGAGGG - Intergenic
1058609592 9:106761218-106761240 AACTTTAAAAAAATGAAAGATGG - Intergenic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1060394289 9:123304620-123304642 AAATTTAAAAAGAGAGAGGAAGG - Intergenic
1061639548 9:131941505-131941527 AACTTTAAGCTGAAGAAGGAAGG + Intronic
1062305390 9:135903639-135903661 ATCTTTACACAAATGGAGGATGG + Intronic
1186389147 X:9141168-9141190 CACTTTGAAAAGAGGGAGGAAGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187944412 X:24412350-24412372 ACCTAAATACAGATGGAGGAGGG + Intergenic
1188749429 X:33886429-33886451 TAATTTAATCAGCTGGAGGAGGG - Intergenic
1189011191 X:37047306-37047328 AATTGTTAAGAGATGGAGGAAGG - Intergenic
1189164189 X:38843764-38843786 AACTTTAAAATGAAGGAGGCAGG - Intergenic
1189927878 X:45975749-45975771 AAATATAAACACATGGAGGGGGG + Intergenic
1189993119 X:46613132-46613154 ATCTATAAACATATGGAAGATGG + Intronic
1195062593 X:101210743-101210765 AAGTTTAGACAGATGGTTGAGGG + Intergenic
1196201376 X:112889570-112889592 CACCTTAAACAGATGGCGGCTGG - Intergenic
1196605778 X:117655567-117655589 AAATTTAAAATGATGGTGGAAGG + Intergenic
1197714606 X:129697412-129697434 AACTTTCAACTGATGGAGGAGGG - Intergenic
1198097557 X:133395129-133395151 AAAATAAAAAAGATGGAGGATGG - Intronic
1198203194 X:134442310-134442332 CACTTGAAACAGATGTGGGATGG - Intergenic
1198412654 X:136387354-136387376 TCCTTTTAACATATGGAGGAAGG + Intronic
1198566955 X:137914842-137914864 AACTTTAAAGAGATGTGGGTAGG + Intergenic
1199034146 X:143031778-143031800 AACTTAAAAAAACTGGAGGATGG - Intronic
1199179517 X:144836804-144836826 AAAATAACACAGATGGAGGAGGG + Intergenic
1200037410 X:153341070-153341092 AAAAGTAAACAGATGGAGAATGG - Intronic
1200250342 X:154550303-154550325 GACTTTTGACAGCTGGAGGATGG + Intronic