ID: 1111988095

View in Genome Browser
Species Human (GRCh38)
Location 13:95085652-95085674
Sequence CTGGTGGGTCAAGATGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111988095_1111988101 -2 Left 1111988095 13:95085652-95085674 CCACCTGCATCTTGACCCACCAG 0: 1
1: 0
2: 2
3: 19
4: 202
Right 1111988101 13:95085673-95085695 AGCCCAGCATCTGGCCTACTAGG 0: 1
1: 0
2: 0
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111988095 Original CRISPR CTGGTGGGTCAAGATGCAGG TGG (reversed) Intronic
902677963 1:18022104-18022126 CAGGTGGGTGAAGATCCAGCCGG + Intergenic
902799482 1:18820340-18820362 CTGATGGGACAGGAAGCAGGAGG - Intergenic
904009619 1:27382400-27382422 CTGGTGAGAGAAGGTGCAGGGGG + Intronic
904351064 1:29907089-29907111 CAGGGTGGTCAAAATGCAGGGGG - Intergenic
905927814 1:41764402-41764424 CTGATGGGACAAGGTGCGGGTGG + Intronic
906098122 1:43237924-43237946 CTGGTGGGGAAAGAGGCAGGTGG + Intronic
913301824 1:117378693-117378715 ATGGTTTGTTAAGATGCAGGTGG - Intronic
913487145 1:119341984-119342006 CTGGTTGGTCAGGATGGAGATGG + Intergenic
915043975 1:152995638-152995660 CTAGTGGTTCGAGATACAGGGGG + Intergenic
916490880 1:165301250-165301272 CAGGTGGGACGAGAGGCAGGTGG - Intronic
917170698 1:172170382-172170404 CAGGAGGGTAAAGATGCACGGGG + Intronic
920504182 1:206505214-206505236 CTGGTGGGGCAAGAAGCAGCAGG - Intergenic
921067183 1:211631354-211631376 CTGGCGGATCCAGAGGCAGGGGG + Intergenic
923342068 1:233016138-233016160 CAGGTGGGAGAAGAAGCAGGTGG - Intronic
923628499 1:235633818-235633840 GTGGTGGGTGAAGAAGCAGCTGG + Intronic
923674243 1:236065761-236065783 CTGGCGGGGAAAGCTGCAGGTGG + Intergenic
1063161475 10:3421812-3421834 CTGGGGTGGCAAGATGGAGGAGG - Intergenic
1063361455 10:5462924-5462946 CTGGTGGGACAAGGTGAAGGAGG - Intergenic
1064536934 10:16366791-16366813 CTGGTGGGTGATGATGCATTTGG + Intergenic
1064731377 10:18334402-18334424 CTGGAGAGGCAAAATGCAGGAGG - Intronic
1067288818 10:44926893-44926915 CTGGTGTCTCAAGCTGAAGGGGG - Intronic
1067726712 10:48776169-48776191 TTGGAGGCCCAAGATGCAGGTGG + Intronic
1067913416 10:50370823-50370845 CTGGTGGGACAAGATGTGGAAGG - Intronic
1068746658 10:60539774-60539796 ATGGTGGGTGAAGACCCAGGTGG - Intronic
1070552586 10:77502376-77502398 TTGGTGGATCCAGAGGCAGGTGG - Intronic
1071517869 10:86310976-86310998 CTCGTGGGTCAAGATGGAGGAGG + Intronic
1072577520 10:96713796-96713818 CTGGTGAGGCAGGATCCAGGGGG - Intronic
1072683396 10:97522738-97522760 CTGGTGGGTGAAGGTGAGGGTGG + Intronic
1072710728 10:97714211-97714233 CTGGTCGCTCATGATGCCGGTGG - Exonic
1074288521 10:112120779-112120801 CCTGTGGCTGAAGATGCAGGTGG - Intergenic
1076318510 10:129561304-129561326 GGGGTGGGTCAGGGTGCAGGCGG + Intronic
1077520829 11:3032951-3032973 CTGGTGGGTGCGGATGCTGGGGG + Intronic
1078610295 11:12813858-12813880 CTGGTGACTCAAGGTGTAGGAGG - Intronic
1080250496 11:30228334-30228356 GTGGTGGGTGCAGATGCTGGTGG - Intergenic
1080343825 11:31298406-31298428 CTGCTGGGTTAGGATGCAGGTGG + Intronic
1084250896 11:67898056-67898078 GTGCTGGGTTAGGATGCAGGAGG + Intergenic
1084293219 11:68190539-68190561 CCAGTGGGACAAGATGCAGAGGG + Intronic
1086155916 11:83665965-83665987 ATAGTGGGTCAAGTTGGAGGGGG - Intronic
1087987423 11:104701070-104701092 ACAGTGGGTCAAGATGAAGGAGG + Intergenic
1088994286 11:114982913-114982935 CTGATGTTTCAACATGCAGGTGG - Intergenic
1091665172 12:2413731-2413753 ATGGTGAGCAAAGATGCAGGTGG - Intronic
1094042857 12:26135466-26135488 GAGCTGGGGCAAGATGCAGGAGG + Intronic
1096476206 12:51910786-51910808 CGGGAGGGGCAAGAGGCAGGAGG + Intronic
1101916810 12:108902294-108902316 CTCCTGGGCCAAGATGCACGAGG - Intergenic
1102471747 12:113163329-113163351 CTGGTGGGTAGGGAGGCAGGGGG - Intronic
1103149252 12:118622781-118622803 ATGGTCGGTCAAGAGGCAGAGGG - Intergenic
1103505486 12:121440076-121440098 CTGGTGGGGCAGGAAGGAGGGGG + Intronic
1103992509 12:124808541-124808563 CTGGTGGATGAAGATGCCAGAGG - Intronic
1108275374 13:48804084-48804106 CTGGTTGGGGAAGATGGAGGAGG - Intergenic
1109769478 13:66952283-66952305 GTGGTGGCTGTAGATGCAGGAGG - Intronic
1111627266 13:90805146-90805168 CTCGTGGGTGAAGATGAAAGAGG - Intergenic
1111988095 13:95085652-95085674 CTGGTGGGTCAAGATGCAGGTGG - Intronic
1112131260 13:96526195-96526217 AAGGTGGGTAAAGATCCAGGGGG + Intronic
1114185048 14:20394719-20394741 CAGGTGGATCACGAGGCAGGTGG - Intronic
1117642017 14:57810144-57810166 CTGCTGGCTCAGGATGGAGGAGG - Intronic
1118313530 14:64709599-64709621 CTGGAAGGGAAAGATGCAGGAGG + Intronic
1120050648 14:79861768-79861790 CAGGAGGATCAAGATGCAGAGGG - Exonic
1121258885 14:92552280-92552302 CTCGTGCTTCAGGATGCAGGTGG + Intronic
1122298725 14:100719883-100719905 CTGGTGGGGAAAGAACCAGGTGG + Intergenic
1122356895 14:101128426-101128448 CTAGTGGGTCAGGAGGCATGTGG + Intergenic
1124922720 15:34042142-34042164 CTGGTTGCTCAAAATGCAGGAGG - Intronic
1124956353 15:34362985-34363007 CAGGTGGGTGAATATGCAGTTGG + Intronic
1126106281 15:45149006-45149028 CTGGTGGGGCAGGAAGTAGGGGG - Intronic
1126362546 15:47861247-47861269 CTGATGGGTCACAAGGCAGGGGG + Intergenic
1127540275 15:59930844-59930866 CTGGTGGGTGAAGATGGAGAAGG - Intergenic
1128944013 15:71809517-71809539 CTGGTGTGGCAAGAGGCAGGCGG + Intronic
1130012205 15:80160559-80160581 CTGGTGGGGGGAGATGGAGGAGG + Intronic
1130112570 15:80977782-80977804 CTCCAGGTTCAAGATGCAGGAGG + Exonic
1130902380 15:88216677-88216699 GTGGTGGGTCAAGATGGTGATGG + Intronic
1131467565 15:92667906-92667928 CTGGAGGGTGAAGATACAGGAGG - Intronic
1131907311 15:97157098-97157120 ATGGTGGGTCAAGAGGCAACTGG + Intergenic
1132180395 15:99748541-99748563 CTGGACGTTCAAGATGAAGGTGG - Intergenic
1133140949 16:3743685-3743707 CTGGCGCGTCAAGCTGCAGAAGG + Intronic
1135325648 16:21523822-21523844 CTGGAGCGTGAAGATGGAGGCGG + Intergenic
1136055087 16:27682507-27682529 CAGGTGGTTCAAGATGTAGAGGG + Intronic
1137704803 16:50527078-50527100 GGGGTGGGTCAGGATGGAGGCGG + Intergenic
1139248105 16:65468057-65468079 CTGGTAGGTCAAGAATGAGGGGG + Intergenic
1139422565 16:66857531-66857553 CTGGTTGGTCAAGACTCGGGGGG + Intronic
1139441446 16:66969757-66969779 CTGGTGAGACAAGAGGCAGGAGG + Exonic
1142038659 16:87878464-87878486 CTGGAGTGTGAAGATGGAGGCGG + Intergenic
1144131458 17:12250971-12250993 CAGGTGGGTCAGGAGGCAGAGGG + Intergenic
1146446470 17:32936645-32936667 CAGATGGGTCATGCTGCAGGTGG - Intronic
1152003575 17:77662697-77662719 CTGGAAGTTCAAGATGAAGGTGG - Intergenic
1152375293 17:79915717-79915739 CTGGAGGGTCGAGGGGCAGGTGG + Intergenic
1156456917 18:37299948-37299970 CTGGAGGGTCTAGATGGTGGGGG - Intronic
1157125222 18:44950280-44950302 TTGGTGGATCAAGATGGAGGAGG + Exonic
1160100671 18:75916818-75916840 CAGGTGGGGCATGAGGCAGGTGG - Intergenic
1160353193 18:78202665-78202687 CTGGTGGGACCAGATGGACGTGG + Intergenic
1160660131 19:294179-294201 TTGCTGGGTCAAGATGTAGAAGG + Intergenic
1162095302 19:8306580-8306602 CTGGTGGGTAAAGGTGGAAGAGG - Intronic
1162467783 19:10852858-10852880 GTTATGGGTCAAGAAGCAGGAGG + Intronic
1163303918 19:16465269-16465291 CGGGTGGTCCAAGCTGCAGGAGG - Intronic
1165697795 19:37914120-37914142 CTGATGGGGCAAGATGGCGGTGG + Intronic
1166214475 19:41326199-41326221 CTGGCCGCTCATGATGCAGGCGG + Intronic
1167238532 19:48329547-48329569 GGGGTGTGTCAAGATGCTGGGGG + Intronic
1167523796 19:49971773-49971795 CTGGAGGGTCCCCATGCAGGCGG + Intergenic
1167557872 19:50206715-50206737 CTGTTGGGACCAGATCCAGGGGG + Intronic
926749365 2:16186219-16186241 CTGGTGGGTGCAGATGCAGCTGG + Intergenic
927917456 2:26946155-26946177 CTCGTGGGTCTGGCTGCAGGAGG - Intronic
928454637 2:31408247-31408269 CTGATAAGTCAAAATGCAGGTGG - Intronic
929031225 2:37651687-37651709 CAGGTGGGAGAGGATGCAGGAGG + Intronic
929642065 2:43591440-43591462 CTGGAGGGTAAAGAGGGAGGTGG - Intronic
931946114 2:67309433-67309455 CTGGTTGCTCAACATGCATGAGG - Intergenic
932631164 2:73344645-73344667 CTGGTGGGACAAGAGGCAAGAGG - Intergenic
933760311 2:85667944-85667966 CTGGCGGGTCCAGGAGCAGGTGG - Intronic
934490077 2:94756458-94756480 CTGGTGGGACAACGGGCAGGTGG - Intergenic
935111099 2:100094909-100094931 TTGGTGGGACAAGAAGCAAGTGG + Intronic
936123876 2:109770253-109770275 TTGGTGGGACAAGAAGCAAGTGG - Intergenic
936220812 2:110601211-110601233 TTGGTGGGACAAGAAGCAAGTGG + Intergenic
937950700 2:127385618-127385640 CTAGAGGGTCAAGATACAAGTGG + Intronic
941013921 2:160333119-160333141 CTGCTGGGTGATGATGGAGGTGG + Intronic
942183965 2:173406760-173406782 GTGGTGGGTGAAGAACCAGGAGG - Intergenic
945974476 2:216259556-216259578 CTGGAGGATCAAAAGGCAGGAGG - Exonic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
1168953935 20:1821121-1821143 GTGTTGGGACAAGAGGCAGGAGG - Intergenic
1170069785 20:12353763-12353785 CACTTGGGTCAAGATGAAGGTGG - Intergenic
1171724376 20:28602815-28602837 CGTTTGGGTCAAGATGAAGGCGG - Intergenic
1172795672 20:37535547-37535569 CTGGTGGGTGGGGAGGCAGGGGG - Intergenic
1172960539 20:38796068-38796090 CTGGTGAGTCTAGGTGAAGGGGG - Intergenic
1173943096 20:46928787-46928809 CTGCTGAGTCAGGATGCAGATGG + Intronic
1174134350 20:48368754-48368776 CTGGTTTGCCAGGATGCAGGAGG - Intergenic
1175600389 20:60267946-60267968 CTGGTCAGACAGGATGCAGGTGG - Intergenic
1175788026 20:61724082-61724104 CGGGTGGGTCCCCATGCAGGGGG + Intronic
1176342162 21:5709253-5709275 CGGGTGGGTCACGCAGCAGGTGG + Intergenic
1176474416 21:7141405-7141427 CGGGTGGGTCACGCAGCAGGTGG + Intergenic
1176502665 21:7615203-7615225 CGGGTGGGTCACGCAGCAGGTGG - Intergenic
1176536483 21:8107322-8107344 CGGGTGGGTCACGCAGCAGGTGG + Intergenic
1178129208 21:29551083-29551105 CTGGTCTGTCAAGATGCTGTGGG + Intronic
1182825345 22:33260191-33260213 AGGGTGGGTCAGGAGGCAGGGGG - Intronic
1183690381 22:39384714-39384736 CTGCAGGGTCCAGCTGCAGGAGG - Exonic
1183716334 22:39535547-39535569 CTGATGGGTCAAGCTGGGGGAGG + Intergenic
1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG + Intergenic
1183718404 22:39547925-39547947 CTGGGGGGTCAGGGTGCAAGGGG + Intergenic
1203241428 22_KI270733v1_random:23734-23756 CGGGTGGGTCACGCAGCAGGTGG + Intergenic
949406351 3:3718752-3718774 ATGGTTGGTCTAGATGTAGGTGG - Intronic
952885236 3:38007859-38007881 CTGGTGGGTGGACAGGCAGGAGG + Intronic
955697918 3:61655136-61655158 CTGGTGAGTCATCCTGCAGGTGG + Intronic
956012407 3:64845501-64845523 GTAGTGGGTAAAGGTGCAGGAGG - Intergenic
960610618 3:119551909-119551931 CTGCTGGGTAGAGGTGCAGGAGG - Intronic
961329714 3:126131380-126131402 CTGGTGTGACAAGATCCAGGTGG - Exonic
961660675 3:128467298-128467320 ATGGTGGGTGGAGATGGAGGTGG + Intergenic
963084277 3:141422290-141422312 GAGGTGGGGCAGGATGCAGGAGG - Intronic
968843988 4:3029594-3029616 CTGCTGGGCCAAGACACAGGTGG - Intronic
968844011 4:3029700-3029722 CTGCTGGGCCAGGAGGCAGGTGG - Intronic
975834474 4:78407747-78407769 CTGCTGGGTGAAGGTGCTGGTGG - Exonic
980106310 4:128591795-128591817 CTAGTGGGGCAAGACGAAGGAGG - Intergenic
983130578 4:164013935-164013957 CAGGTGGATCAGGATGCAGGTGG + Intronic
983130580 4:164013951-164013973 CAGGTGGATCATGATGCAGGTGG + Intronic
983139832 4:164136478-164136500 CTGGTGGGGCAAGAAAGAGGTGG - Intronic
983605510 4:169578854-169578876 TTTCTGGGTCAAGATGCAGTTGG - Intronic
984287062 4:177744393-177744415 CCTATGGGTCAAGATGGAGGGGG - Intronic
985294015 4:188415225-188415247 CCCGTGGGACAAGATGGAGGTGG + Intergenic
985493906 5:193795-193817 CAGGTGGGTGCAGGTGCAGGTGG + Intronic
986691401 5:10316632-10316654 GTGGTGGGTCAAGAAGCAGAAGG - Intergenic
986715954 5:10523703-10523725 CTGGTGCATCAAGAGGGAGGTGG + Intergenic
988030388 5:25756329-25756351 CTGGGGGATCAAGAAGCAGTAGG + Intergenic
992905011 5:81337314-81337336 CTGGTGGAACAAGATGGAGTGGG + Intronic
997184319 5:131866397-131866419 ATGGTGTGTAAAGATGCTGGCGG + Intronic
999572037 5:152930044-152930066 CCGGTGGAGCAAGATGCAGCTGG - Intergenic
1000293609 5:159893805-159893827 CTGATGGGTCAGGAAGCAAGCGG + Intergenic
1003473346 6:6458658-6458680 CTGGAGGGTCAAGAGCTAGGGGG - Intergenic
1003873454 6:10418732-10418754 ATGGTGGGTGAGGAGGCAGGGGG - Intronic
1007272921 6:40651819-40651841 CTGGTGTTTGAAGATGCAGTGGG - Intergenic
1007729888 6:43939437-43939459 CTGGTGGGGCAAGGGGCAGGGGG - Intergenic
1008071964 6:47107044-47107066 CTGGTTGGTCATGGTGGAGGAGG - Intergenic
1013796221 6:113892076-113892098 CTGGTGGGGCTAAATGCAGCTGG + Intergenic
1018030450 6:159837183-159837205 CTGGGGGACCAAGATGCAGCAGG + Intergenic
1019286593 7:226320-226342 CTGGAGGGTCACAGTGCAGGGGG + Intronic
1019890291 7:3941022-3941044 CTGGTGGGTCAGGAGGGAGAAGG - Intronic
1022152918 7:27627335-27627357 CTGATTGGTCAAGAAGCAAGGGG - Intronic
1022308615 7:29174142-29174164 TTGGTGGCACAGGATGCAGGAGG + Intronic
1023548613 7:41344936-41344958 CTGGTGGATAAAGCTGAAGGTGG + Intergenic
1025946141 7:66106351-66106373 CTAGTGGGTCAAGATAAAGCTGG + Intronic
1026628484 7:72017323-72017345 CTGGTGGGAGAATATGCAGCAGG - Intronic
1026776102 7:73231914-73231936 CTGGTGGGTCATCAGGTAGGAGG + Intergenic
1026806506 7:73432654-73432676 CTGATGGGGCAAGATGGGGGTGG + Intergenic
1027016959 7:74785285-74785307 CTGGTGGGTCATCAGGTAGGAGG + Exonic
1027071068 7:75160651-75160673 CTGGTGGGTCATCAGGTAGGAGG - Intergenic
1027793556 7:82662293-82662315 CTGCTGGGTCAGCATGTAGGTGG - Intergenic
1029668116 7:102008866-102008888 CTGGTGGGCACAGATGTAGGTGG + Intronic
1032822063 7:135533054-135533076 CTGGTAGGTGAAAAGGCAGGGGG + Intergenic
1033455139 7:141496249-141496271 CTCCTGGGGCAAGATGGAGGAGG + Intergenic
1033472938 7:141665413-141665435 CTGGTGCTTCAGGATCCAGGTGG + Intronic
1034425247 7:151010574-151010596 CTGGCGGGGCAGGATGCAGTGGG - Intronic
1035691261 8:1561634-1561656 CCTGTGGGTCACGGTGCAGGTGG - Intronic
1035708656 8:1696114-1696136 CTGGTGGGTCAACATTCAACTGG - Intronic
1036157386 8:6355204-6355226 CTGTGAGGCCAAGATGCAGGAGG - Intergenic
1036481074 8:9140107-9140129 CTGTGGGGTCAAGAAGCGGGAGG + Exonic
1036592498 8:10181705-10181727 TTGCTGGGTCATGATGGAGGTGG + Intronic
1036607183 8:10317953-10317975 CTGGTGGGTCCTGAAGCTGGTGG - Intronic
1037625158 8:20600233-20600255 CAGATGGGTCCACATGCAGGTGG - Intergenic
1037939980 8:22944042-22944064 CTGGTAGGTCAGGAGGCAGGAGG - Intronic
1044666542 8:94639487-94639509 CTGGTAGGAGAAGGTGCAGGCGG - Intergenic
1045413709 8:101945320-101945342 ATGGTGGGTGGAGATGAAGGTGG + Intronic
1047122524 8:121921974-121921996 CTGGTGTGTCATAAGGCAGGAGG - Intergenic
1047868141 8:129051835-129051857 CTGGTGTTTTTAGATGCAGGTGG + Intergenic
1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG + Intergenic
1049426547 8:142540457-142540479 CTGGTGGATCCACATGCAGCTGG + Intronic
1049533898 8:143169221-143169243 CTGGTGGGACAAGATCCACATGG - Intergenic
1051535694 9:18154988-18155010 CTGGTGGGTGGTGATGGAGGTGG + Intergenic
1053015026 9:34657021-34657043 CTGGAGGGTCTAGAGGCAGAGGG - Exonic
1053421599 9:37983373-37983395 CTGGTGGGAGATGATGCTGGAGG + Intronic
1054703357 9:68436374-68436396 CTGGTAGGTCAAGATGATCGTGG + Intronic
1056285646 9:85085037-85085059 CTGCTGGGTGAAGTTTCAGGTGG + Intergenic
1056471281 9:86906287-86906309 CTGGAAGGTCAAGATGCATAGGG - Intergenic
1056803212 9:89708435-89708457 CTGGAGGGTAAAGAAGGAGGTGG - Intergenic
1057179698 9:93023123-93023145 CTGCTGTGCCCAGATGCAGGAGG + Intronic
1058198019 9:102002471-102002493 CTGGTGGGTGAAGAGAAAGGTGG + Intergenic
1059760095 9:117329530-117329552 CTGGTGGGTGAAGATGAATTAGG + Intronic
1060253030 9:122001482-122001504 GTGGTGAGCCAAGAGGCAGGGGG + Intronic
1060888795 9:127175181-127175203 CTGGTGCCACCAGATGCAGGTGG + Intronic
1060997891 9:127885425-127885447 CTGGAGGGACCAGATGGAGGAGG - Exonic
1061257309 9:129460324-129460346 CTGGAGGGGGGAGATGCAGGCGG - Intergenic
1062566665 9:137166708-137166730 CTGGAGGCTCAAGGAGCAGGTGG + Intronic
1203457749 Un_GL000220v1:6807-6829 CGGGTGGGTCACGCAGCAGGTGG + Intergenic
1187050140 X:15687645-15687667 GTGGTGGGGCAAGATGCAGAGGG + Intergenic
1187058416 X:15762724-15762746 GTGGTGGGGCGAGATGCAGAGGG + Intronic
1187764864 X:22630362-22630384 AAGGTGGGTGAAGAGGCAGGCGG + Intergenic
1189500958 X:41558134-41558156 CTGGGGGATGCAGATGCAGGTGG + Intronic
1189528853 X:41857285-41857307 TTGGTGGTTAAAGCTGCAGGGGG - Intronic
1191946813 X:66543597-66543619 CTGGAGGGTCCTGATGCTGGTGG + Intergenic
1197854659 X:130902458-130902480 CTGGTGGGGGAAGTGGCAGGTGG + Intronic
1199706441 X:150429396-150429418 CTTCAGGGTCCAGATGCAGGGGG - Intronic
1199988310 X:152968504-152968526 CTGGTGGTGAAAGAAGCAGGAGG + Intronic