ID: 1111989699

View in Genome Browser
Species Human (GRCh38)
Location 13:95104282-95104304
Sequence TTTTGGGTTTTTAGTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376914
Summary {0: 1, 1: 258, 2: 13954, 3: 218117, 4: 144584}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111989696_1111989699 -8 Left 1111989696 13:95104267-95104289 CCACTCCCAGCTAATTTTTGGGT 0: 2
1: 78
2: 3015
3: 47903
4: 115846
Right 1111989699 13:95104282-95104304 TTTTGGGTTTTTAGTAAAGATGG 0: 1
1: 258
2: 13954
3: 218117
4: 144584
1111989689_1111989699 26 Left 1111989689 13:95104233-95104255 CCTCCCAAGTAGCTGGGATTACA 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
Right 1111989699 13:95104282-95104304 TTTTGGGTTTTTAGTAAAGATGG 0: 1
1: 258
2: 13954
3: 218117
4: 144584
1111989693_1111989699 -5 Left 1111989693 13:95104264-95104286 CCACCACTCCCAGCTAATTTTTG 0: 795
1: 36661
2: 100031
3: 172447
4: 200784
Right 1111989699 13:95104282-95104304 TTTTGGGTTTTTAGTAAAGATGG 0: 1
1: 258
2: 13954
3: 218117
4: 144584
1111989691_1111989699 23 Left 1111989691 13:95104236-95104258 CCCAAGTAGCTGGGATTACAGGT 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
Right 1111989699 13:95104282-95104304 TTTTGGGTTTTTAGTAAAGATGG 0: 1
1: 258
2: 13954
3: 218117
4: 144584
1111989692_1111989699 22 Left 1111989692 13:95104237-95104259 CCAAGTAGCTGGGATTACAGGTG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
Right 1111989699 13:95104282-95104304 TTTTGGGTTTTTAGTAAAGATGG 0: 1
1: 258
2: 13954
3: 218117
4: 144584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111989699 Original CRISPR TTTTGGGTTTTTAGTAAAGA TGG Intronic
Too many off-targets to display for this crispr