ID: 1111989962

View in Genome Browser
Species Human (GRCh38)
Location 13:95106700-95106722
Sequence TTTTATATTAAGATAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 672}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111989962 Original CRISPR TTTTATATTAAGATAAAGGA GGG Intronic
900033580 1:388830-388852 TTTCAAGTTAAGATAAAAGATGG - Intergenic
900054415 1:618720-618742 TTTCAAGTTAAGATAAAAGATGG - Intergenic
900966343 1:5961413-5961435 TTTTAAATTAAGGTAAAATAAGG - Intronic
901369189 1:8781827-8781849 TTTTATATTAAGATGTTGCATGG - Intronic
902464133 1:16604461-16604483 TTTTATATGTACATAAAGGGAGG + Intronic
903156965 1:21452217-21452239 TTTTATATGTATATAAAGGGAGG - Intronic
903522452 1:23961018-23961040 TTCTGTATTGAGACAAAGGAAGG + Exonic
903549164 1:24145725-24145747 ATTTATATTAAGGGAAAGCAAGG + Intergenic
904550652 1:31314211-31314233 TTATATATTACTATCAAGGATGG + Intronic
904792397 1:33033233-33033255 TTATAAATTAAAAGAAAGGATGG + Intronic
905047802 1:35021885-35021907 TTTAACATTAAAAAAAAGGATGG - Intronic
905779483 1:40695303-40695325 TTTTATTTTCAGAGAAATGAAGG + Intronic
906913198 1:49979044-49979066 TTTTAAATTAAGAAAAAGTTAGG + Intronic
907215234 1:52858098-52858120 TATAATATTAAGATACAGGCTGG + Intronic
907749674 1:57250476-57250498 TTTTATAATGTGATAGAGGAAGG - Intronic
908619930 1:65966857-65966879 TTTTATATAAGGTTTAAGGAAGG - Intronic
908709598 1:67000296-67000318 TTTTTTTTTAAAAAAAAGGAGGG + Exonic
908861029 1:68490011-68490033 TTTTATATTAAAATAAAAGGAGG - Intronic
909104855 1:71394510-71394532 TTTTATTTTAAAATATGGGAAGG + Intergenic
909294232 1:73926164-73926186 TTTTATATTTATCTAAAGGCTGG - Intergenic
909346020 1:74588599-74588621 TTTTATCTTAAAATCAAGAATGG + Intronic
909433210 1:75614200-75614222 TTTGATATTATGATAAAGAGAGG + Intergenic
909839244 1:80297715-80297737 CTTAATATTAATATAAATGAGGG + Intergenic
910456066 1:87398701-87398723 TTTAAAAATAAGATAAAAGATGG - Intergenic
910539316 1:88337144-88337166 TTCTACATCAAGATGAAGGAGGG + Intergenic
910577020 1:88776272-88776294 TTTTAGATTGAAATGAAGGATGG - Intronic
911204984 1:95083277-95083299 CTTTATATGAAGAAAAAGCATGG + Intergenic
911573201 1:99542722-99542744 TCTTAGATTAAGATACAGGTAGG + Intergenic
911768552 1:101709712-101709734 ATTTACAGTAAGTTAAAGGATGG - Intergenic
912108589 1:106312357-106312379 TTTTATATAACGTGAAAGGAAGG + Intergenic
912126614 1:106546806-106546828 TTTTGTATTAAGTGTAAGGAAGG + Intergenic
912250100 1:108002507-108002529 TGTTATATTAATATAAATCATGG + Intergenic
912840903 1:113038258-113038280 TTTTAAATTAAGAAAAAGTTGGG + Intergenic
913342985 1:117778619-117778641 TTCTGTATTGAGACAAAGGAAGG - Intergenic
914436102 1:147660614-147660636 TTCTACAATAAGATAATGGAAGG - Intronic
917838684 1:178960262-178960284 TTTTAGATTAAAATAAAGAATGG + Intergenic
918335927 1:183512904-183512926 TTATATATTAAATTAATGGAAGG + Intronic
918600513 1:186353492-186353514 GTTTCTATTAAGATAGAAGAGGG - Intronic
918808939 1:189090564-189090586 GTTTATATTAAAAGAAAGAATGG + Intergenic
918870664 1:189969631-189969653 TTATATATTAAAATACAGCATGG - Intergenic
918885333 1:190186077-190186099 TTTTAAATTAAAGTAAAGGCTGG + Intronic
919027408 1:192194458-192194480 TTTTATTTTAAGATAAGCAATGG - Intergenic
919095447 1:193029011-193029033 TGTTATATTAATATATAGGAAGG - Intronic
919500028 1:198326774-198326796 GTTTACATTAACATACAGGAAGG + Intergenic
920745976 1:208628946-208628968 TTTAAACATAAGATAAAGGAGGG - Intergenic
922056540 1:222047577-222047599 TTTCATATGAGGACAAAGGAAGG + Intergenic
922125677 1:222720011-222720033 TTTTATAAAAACAGAAAGGAAGG + Intronic
922255939 1:223892985-223893007 TTTCAAGTTAAGATAAAAGATGG - Intergenic
922288703 1:224192197-224192219 TTTTTTTTTAAGAGAGAGGAGGG + Intronic
922313312 1:224417019-224417041 TAATATTTTAAGATAAAGTAAGG + Intronic
922582559 1:226709644-226709666 TTTCATATTTAGACAAAGGAAGG - Intronic
923048399 1:230372361-230372383 TTTTGTATGAAGATCAAGAACGG - Intronic
923346733 1:233060890-233060912 TTTTGTATTAACATAAAAGAGGG - Intronic
923726932 1:236514228-236514250 CATAATATTAAAATAAAGGATGG - Intergenic
924337138 1:242995852-242995874 TTTCAAGTTAAGATAAAAGATGG - Intergenic
924484583 1:244468614-244468636 AGTGATATTAAGAGAAAGGAAGG + Intronic
924891920 1:248291903-248291925 TTTTGTATAAAGTTGAAGGAAGG - Intergenic
1063014973 10:2066951-2066973 CTTTATATTGAGTGAAAGGAAGG + Intergenic
1063429960 10:5979260-5979282 TTTAATATTAAAATAATAGAGGG - Intergenic
1063760909 10:9074979-9075001 TTTTATTTAAATATAAAGCATGG - Intergenic
1064159789 10:12935171-12935193 TTTAATATAAAGACAAAGGCAGG - Intronic
1065050481 10:21786904-21786926 TTATATTTTACAATAAAGGAGGG + Intronic
1065157378 10:22884418-22884440 TTTTGTATAAAGTGAAAGGAAGG - Intergenic
1066108154 10:32173655-32173677 TTTTCTTTTAAGAAAAAGAAAGG - Intergenic
1066120208 10:32278700-32278722 TTTTATATTAAAATAATGTTTGG - Intronic
1066705929 10:38177622-38177644 TTTTTTTTTTAAATAAAGGAGGG + Intergenic
1067035955 10:42916872-42916894 TTTTACAATAAAATAAATGATGG - Intergenic
1067370938 10:45681491-45681513 TTTTTTTTTTAAATAAAGGAGGG + Intergenic
1067388842 10:45844653-45844675 TTTTTTTTTTAAATAAAGGAGGG - Intronic
1067445423 10:46339907-46339929 TTTTTTTTTTAAATAAAGGAGGG + Intergenic
1067484107 10:46630081-46630103 TTTTATGTTAAGATCAAACAGGG - Intergenic
1067502637 10:46819187-46819209 TTTTTTTTTTAAATAAAGGAGGG + Intergenic
1067591951 10:47520826-47520848 TTTTTTTTTTAAATAAAGGAGGG - Intronic
1067610652 10:47711567-47711589 TTTTATGTTAAGATCAAACAGGG + Intergenic
1067639068 10:48028899-48028921 TTTTTTTTTTAAATAAAGGAGGG - Intergenic
1068277673 10:54823528-54823550 TTTTATGTTAAATTAAATGAAGG + Intronic
1069239356 10:66120182-66120204 TTTTAAATTATGATAAACCATGG + Intronic
1070004367 10:72408859-72408881 TTTTAAATTGAGATAATGAACGG - Intronic
1070136058 10:73695063-73695085 TTTTTTTTTTAAATAAAGGAGGG - Intronic
1071109721 10:82141620-82141642 TTTTATTTTAAGAGAAATGCAGG - Intronic
1071445031 10:85737546-85737568 TGTCATATTAAGAGCAAGGATGG + Intronic
1071626067 10:87171816-87171838 TTTTATGTTAAGATCAAACAGGG + Intronic
1071872795 10:89813882-89813904 TTTTATACAAAAATACAGGAAGG - Intergenic
1072976646 10:100064707-100064729 TTTTATATTAATATATAAAATGG - Intronic
1073740914 10:106405959-106405981 TTTCAGATGAAGATAAAGAATGG + Intergenic
1074001415 10:109377374-109377396 TTTTATACTCAGATTAAAGAAGG + Intergenic
1074170385 10:110928562-110928584 TTTTATGATATGAAAAAGGATGG + Intronic
1074334032 10:112550700-112550722 TTATATCTTAAGATACAGAAGGG - Intronic
1074625739 10:115183766-115183788 TTTTAGAGAATGATAAAGGAAGG + Intronic
1074646888 10:115464790-115464812 TTTTTTATGAAAGTAAAGGATGG - Intronic
1074731839 10:116386540-116386562 TTTTATATTTACATAAATGAAGG - Intergenic
1075977386 10:126707538-126707560 AATTATATTAAGATAAAGACCGG + Intergenic
1076378375 10:130008164-130008186 TTTAATATCAAGATAGATGAGGG + Intergenic
1078033529 11:7779408-7779430 GTTTAAATTTAGAAAAAGGAAGG - Intergenic
1078458343 11:11493254-11493276 TTTTTTTTTGAGATGAAGGATGG - Intronic
1079433661 11:20422670-20422692 TTTTTTAGTCAGAAAAAGGAAGG - Intronic
1079579922 11:22051312-22051334 TTTTATATAAAGTGTAAGGAAGG + Intergenic
1079712000 11:23696525-23696547 TTTTGTATTAATATTAAAGATGG - Intergenic
1079920704 11:26430711-26430733 TTTTATATTATGCTAAATAATGG - Intronic
1080375971 11:31711781-31711803 TTTTAAATAAAGTGAAAGGAAGG - Intronic
1080871952 11:36244111-36244133 TTTTATAATAAGATAAAAGCCGG + Intergenic
1080954123 11:37073019-37073041 TTTAAGGTTAAGAGAAAGGAAGG + Intergenic
1081076575 11:38681807-38681829 TTTAAAATAAAGATAAAAGATGG + Intergenic
1081106530 11:39077354-39077376 TATTACATTAAAATAAAGAATGG + Intergenic
1081196497 11:40167689-40167711 TTTGATATTGAGATTAAGGCAGG + Intronic
1082203641 11:49404707-49404729 TGTTTTATTAAAATAAAGAAGGG + Intergenic
1084024433 11:66438957-66438979 TGTTTTATGCAGATAAAGGAAGG + Intronic
1084923316 11:72490671-72490693 TTAGATATTAAGAAAAATGATGG + Intergenic
1085431491 11:76454273-76454295 TTTTATGTTAAGTAAAATGAGGG - Intronic
1085469072 11:76745316-76745338 TTTTATTTTAAAATAAAGTATGG - Intergenic
1086030793 11:82352763-82352785 TTTTATATAAAGTGTAAGGAAGG + Intergenic
1086118294 11:83278257-83278279 TTTTATATTCAGTTAAATTAAGG + Intronic
1086209450 11:84301161-84301183 GTTTATATTAACTTAAAGAAAGG + Intronic
1086288185 11:85273074-85273096 TTTTGTATTAAGTGTAAGGAAGG - Intronic
1086651447 11:89295725-89295747 TGTTTTATTAAAATAAAGAAGGG - Exonic
1086667502 11:89501403-89501425 GCTTATATTAAGTTAAGGGAAGG + Intergenic
1087140752 11:94763432-94763454 TTTTATATTTAGAAAAAGGCAGG + Intronic
1087148964 11:94841133-94841155 TTTTATGTTAAGAAAAGAGAAGG + Intronic
1087567579 11:99881638-99881660 TTTTAAAATAAAATAAAGGGGGG + Intronic
1087822328 11:102726514-102726536 ATTTATATTAATACAAAGAATGG - Intronic
1088507989 11:110544624-110544646 TTTTATATTAAAATATAGCAGGG + Intergenic
1088901655 11:114122519-114122541 TTTAATATCATAATAAAGGAAGG + Intronic
1088935113 11:114391916-114391938 TTTTTTTTTAAAATAAAGCATGG + Intronic
1089545194 11:119219042-119219064 TTTTTTTTTAAAATAAAGAAGGG - Intronic
1089908462 11:122070813-122070835 TTTTCTATTCAGCAAAAGGAAGG + Intergenic
1090158685 11:124468325-124468347 ATTTATATTAAGTTCAAGGACGG - Intergenic
1091824143 12:3497466-3497488 TTTTAGAATAACATAAACGAAGG - Intronic
1092115543 12:5999521-5999543 TTCTATACTAATAGAAAGGAGGG + Intronic
1092498160 12:9018747-9018769 TTGTATATCAAGAGAGAGGAGGG - Intergenic
1093023459 12:14223418-14223440 TGTGTTATTAAGATAGAGGAAGG - Intergenic
1093446618 12:19267215-19267237 TTTCATTTTAAGAGAAAAGAGGG + Intronic
1094320542 12:29178296-29178318 TTTTGTTTTAAGAAAAAGGAGGG + Intronic
1095134935 12:38588984-38589006 TTTCATATGAAGATAATAGAAGG + Intergenic
1095586320 12:43853586-43853608 TTTTATTGTAAGATATAGAAAGG + Intronic
1096202966 12:49698992-49699014 TTTTCTTTGAAGATAGAGGAGGG - Intronic
1097211939 12:57377763-57377785 TTTTACATTGAGATAAAGAGAGG - Intronic
1097647700 12:62256541-62256563 TTTTATAATAAGAAAACGAATGG + Intronic
1097706553 12:62874810-62874832 TCTTACATTAACATAAAGCACGG - Intronic
1097882749 12:64700860-64700882 TTTTATATAAGGATAAAGGTGGG + Intergenic
1098012778 12:66072147-66072169 TTTTTTATCAAGATAAGGGATGG + Intergenic
1098684640 12:73403186-73403208 TTTTATATTTAAAAAATGGAGGG + Intergenic
1099048048 12:77748447-77748469 TTTTAAATTAAGATGAATGCTGG + Intergenic
1099362552 12:81723246-81723268 TTTTATATTTAAATACAGGCAGG - Intronic
1099489288 12:83268561-83268583 TTTTGTATAAAGTTTAAGGAGGG + Intergenic
1099593046 12:84620986-84621008 TTTTTTTTTAAGAGACAGGATGG + Intergenic
1099677763 12:85784872-85784894 TTATACATTAAGATAAAGGTAGG + Intergenic
1099679621 12:85808795-85808817 TTTTATTTTAAAATAAATAATGG + Intronic
1099909560 12:88812978-88813000 GTTTATATCAAGAAAAATGAGGG + Intergenic
1100229256 12:92590615-92590637 TTTTATGTTAAGCTTAAGAAAGG - Intergenic
1100414874 12:94361519-94361541 TTTTGTATTTATATAAGGGATGG - Intronic
1101355309 12:103971694-103971716 TTTGAGACTAAGATAAATGATGG + Intronic
1102799466 12:115718815-115718837 TCTTATATCAAAATAAATGAGGG + Intergenic
1103577617 12:121890087-121890109 TTTTATTTTAAGTAAAAGCAGGG + Intronic
1104246710 12:127049608-127049630 TTTTATATAAGGTTTAAGGAAGG - Intergenic
1105641041 13:22264600-22264622 TTTAATATTCAGATAAAGATAGG - Intergenic
1105744722 13:23366522-23366544 TATTATAATAATATGAAGGATGG + Intronic
1106362417 13:29044690-29044712 TGTTATTTTAAGAAAAAGAAAGG - Intronic
1106392612 13:29350126-29350148 TGTTATTTTAAGAAAAAGAAAGG - Intronic
1106661257 13:31801822-31801844 TTTTATTTTCCTATAAAGGAAGG + Intronic
1106703555 13:32256053-32256075 GTTTCTATCAAAATAAAGGAAGG + Intronic
1107449430 13:40495254-40495276 TTTTGTTTTAAGATAATGGTAGG + Intergenic
1107870359 13:44740846-44740868 TTTTATTTTTACAAAAAGGAAGG - Intergenic
1108041445 13:46343268-46343290 TTGTATATTAAGGAAAAAGATGG - Exonic
1108434122 13:50385040-50385062 TTTTATATTAAAATAAACATGGG + Intronic
1108443031 13:50475467-50475489 TTTTATAATATATTAAAGGAAGG + Intronic
1109076456 13:57842498-57842520 TAATATAGTAAGATAAACGAGGG + Intergenic
1109090930 13:58044430-58044452 TTATATATCATGATGAAGGAAGG - Intergenic
1109229279 13:59736972-59736994 TTTTATATATAGTTTAAGGAAGG - Intronic
1109529842 13:63627668-63627690 TTTTACATAAAGAGGAAGGAAGG - Intergenic
1109712165 13:66176128-66176150 CTTTATATGTATATAAAGGAGGG + Intergenic
1109927656 13:69167551-69167573 TTTTATATTTTGATAAAGGTTGG - Intergenic
1109982054 13:69922113-69922135 CTTTATATTAAAAAAAAGGAAGG - Intronic
1110101467 13:71611201-71611223 TTTGAAACTAAGATAAAGAAGGG + Intronic
1110157502 13:72335547-72335569 TTTTATGTTAATGAAAAGGATGG + Intergenic
1110338517 13:74361760-74361782 TTTTAAGTTAAAATAAAGCAAGG - Intergenic
1110420186 13:75298839-75298861 TCTTACATGAAGATAAAGGAGGG + Intronic
1110667687 13:78137350-78137372 TTTTTTTTTAAGAAAAAGAAAGG - Intergenic
1110991997 13:82053568-82053590 TTTTATATACAGTAAAAGGAAGG - Intergenic
1111354893 13:87086224-87086246 TTTTTTATTAACATAAATCATGG - Intergenic
1111568104 13:90043087-90043109 TTTCCTCTTAAAATAAAGGAAGG - Intergenic
1111677987 13:91410644-91410666 TATTCCATTAAGATGAAGGAAGG - Intronic
1111989962 13:95106700-95106722 TTTTATATTAAGATAAAGGAGGG + Intronic
1112347472 13:98602265-98602287 TTTCAAAGTAAGATAAAGCAGGG - Intergenic
1113075197 13:106461216-106461238 TTTTTTTTTAAAAAAAAGGAAGG + Intergenic
1113152534 13:107280870-107280892 TTTTCTAATGAGCTAAAGGAAGG + Intronic
1113187697 13:107708098-107708120 TTTTATATCAAGGTAAAAGCAGG + Intronic
1113333712 13:109357527-109357549 TTTTTTAATAAAAGAAAGGAAGG - Intergenic
1113398755 13:109972879-109972901 TTTTGTGTTATGATAAAGTATGG + Intergenic
1113766783 13:112886540-112886562 TTTTTTTTTAAGCTAAAGGTGGG + Exonic
1114652518 14:24294933-24294955 TTTTATATCAAGACAATGAAGGG - Intronic
1114789255 14:25637792-25637814 TTTTAAATGATGATAAAGGGAGG - Intergenic
1114816756 14:25968189-25968211 TTTTGGCTTGAGATAAAGGATGG + Intergenic
1114845336 14:26313870-26313892 TTTTGTATAAAGTTTAAGGAAGG - Intergenic
1114927037 14:27415635-27415657 TTGTATATTTAAATAAAGAAGGG - Intergenic
1115461046 14:33661233-33661255 CTTTATTTTAATATTAAGGAAGG - Intronic
1116178540 14:41506189-41506211 TATTATATTAAGATAGAACATGG + Intergenic
1116623675 14:47238890-47238912 TTTTAAATTAATAGAAAGTAAGG + Intronic
1117153948 14:52918955-52918977 TTTTATATTAAGATAAATGCTGG - Intronic
1117362433 14:54990172-54990194 TTTTATGTAAAGATTAAGGGTGG - Intronic
1117392274 14:55272805-55272827 TTTTATATTAAGTTATAGCCGGG - Intronic
1117789240 14:59321707-59321729 TTTTATAGTCAAATAAAGAAAGG - Intronic
1118570642 14:67191347-67191369 TTTTATAATAAAATATTGGAGGG + Intronic
1118581361 14:67302290-67302312 TTTTTTCTTAAGATAACTGAAGG + Intronic
1118642850 14:67808379-67808401 TTTTGTAGTAGGATAAAGAATGG - Intronic
1119941836 14:78649442-78649464 TTTTTTTTTAAGAAAAAGAAAGG - Intronic
1120169797 14:81236704-81236726 TTTTATGTCTAGCTAAAGGATGG + Intergenic
1121781807 14:96626796-96626818 TTTTGAAGTAAGAGAAAGGAAGG + Intergenic
1123504241 15:20923009-20923031 TTTTATAGTAAAATAAAATAAGG + Intergenic
1123561486 15:21496706-21496728 TTTTATAGTAAAATAAAATAAGG + Intergenic
1123597730 15:21933986-21934008 TTTTATAGTAAAATAAAATAAGG + Intergenic
1124545610 15:30624118-30624140 TTTCATCTTAAGAGAAAGGAAGG + Intergenic
1124779128 15:32613513-32613535 TTTCATCTTAAGAGAAAGGAAGG + Intergenic
1125099756 15:35898657-35898679 TTTTATACTCAGATAATGGAGGG - Intergenic
1125101866 15:35923044-35923066 TTCTGTATTAAGATAAAAAAAGG + Intergenic
1125126218 15:36224608-36224630 TTTTATATAAAAATAAAGTATGG + Intergenic
1125208647 15:37184330-37184352 TTTTATATTAAAATATTTGATGG - Intergenic
1126112277 15:45182346-45182368 TTTTATCTGTAGAAAAAGGATGG + Intronic
1126126768 15:45301098-45301120 CATTATATTAAGAGATAGGAAGG - Intergenic
1126252372 15:46583646-46583668 TATTTTATTAATTTAAAGGATGG + Intergenic
1126771178 15:52057545-52057567 TTTTTTTTTGAGACAAAGGAAGG - Intronic
1127107502 15:55632482-55632504 TTTTATTCTAAGAGAGAGGAAGG - Intronic
1127542947 15:59960879-59960901 TTTTATATTCAAATAAAAAATGG - Intergenic
1127880260 15:63151001-63151023 ATTTATATTAAGTTTATGGAAGG + Exonic
1128770778 15:70280773-70280795 TTTTATAATAAGGTAAAGGTGGG - Intergenic
1129854799 15:78815659-78815681 ATTTATATCAAGATACAGGGGGG - Intronic
1130009485 15:80138889-80138911 TGTTCTATTTAAATAAAGGATGG + Intergenic
1130176428 15:81576290-81576312 TTCTATATTAAAATTAAGGAGGG + Intergenic
1130918926 15:88327843-88327865 CTTGGTATTAAGAAAAAGGAAGG - Intergenic
1132053669 15:98633178-98633200 TTTTTTATTAACATAAAGGTGGG - Intergenic
1202969831 15_KI270727v1_random:223830-223852 TTTTATAGTAAAATAAAATAAGG + Intergenic
1133843581 16:9433179-9433201 CATTATATAATGATAAAGGAAGG - Intergenic
1133990356 16:10701997-10702019 TGTCATATTAAGATTAAGGCTGG + Intergenic
1134087647 16:11369244-11369266 TTAAAAATTAAGAAAAAGGAAGG + Intronic
1134470249 16:14518624-14518646 TTTTATGTTAAGAAAAACAATGG + Intronic
1134484363 16:14645692-14645714 TTTAATCTTAAATTAAAGGAGGG + Intronic
1135808012 16:25561129-25561151 TTTTATATAAGGTTTAAGGAAGG - Intergenic
1135994055 16:27235215-27235237 TTGTATATTGAGATAAAGAGAGG - Exonic
1136010610 16:27361141-27361163 CTGTATATTAAAAAAAAGGAGGG - Intronic
1137922856 16:52508636-52508658 TTTTATATAAAGAAAAAACAAGG + Intronic
1138448782 16:57080777-57080799 TTTTAAAGTAAGAAAAAAGAGGG + Intronic
1138799371 16:60008338-60008360 TTCTATATAAAGATGATGGAAGG + Intergenic
1139621633 16:68149427-68149449 TTTTATATTAGGATTAAGTTTGG - Intronic
1140211261 16:72972462-72972484 CTTTATAATCACATAAAGGAGGG - Intronic
1140338332 16:74132967-74132989 TATTTTATGAAGATAAATGATGG - Intergenic
1140634568 16:76896465-76896487 TTTTATATTAAATAAAAGCAAGG + Intergenic
1143906216 17:10211155-10211177 TTTCATAATAAAAAAAAGGAAGG + Intergenic
1144376638 17:14649340-14649362 TTTTATATTAGGGAAAAGTATGG - Intergenic
1144402985 17:14924809-14924831 TTTTATTTTAAGAGACACGAAGG + Intergenic
1144419286 17:15081336-15081358 TTCTTTATGAAGAAAAAGGACGG - Intergenic
1145944753 17:28765041-28765063 TCACTTATTAAGATAAAGGATGG + Intronic
1146167620 17:30601722-30601744 TTTTCCATTTAGAAAAAGGAAGG - Intergenic
1146220028 17:31009644-31009666 TTTTCCATTTAGAAAAAGGAAGG - Intergenic
1146556595 17:33830344-33830366 TTTTATTTTGACAAAAAGGAGGG - Intronic
1147479840 17:40749870-40749892 TTTTATATTAACATCAAGAATGG + Intronic
1148702635 17:49598938-49598960 TTTTATATTTAGTTAGAAGAAGG + Exonic
1149806981 17:59627608-59627630 TTTTATATTATGAGAAAAGTAGG + Intronic
1149810303 17:59662923-59662945 TTTTTTAAAAAGATAAGGGAGGG + Intronic
1150716625 17:67577782-67577804 ATTTATATAAAGATTAAGGCTGG + Intronic
1150854447 17:68737610-68737632 TTGTAGGTTAAGAAAAAGGATGG - Intergenic
1151099299 17:71537998-71538020 TTTTAGATTAAAATAAAGATAGG - Intergenic
1151115067 17:71726260-71726282 TTTGATATTAAGATTAAAAAAGG + Intergenic
1152152760 17:78612843-78612865 TTTTTTCCTAATATAAAGGAAGG - Intergenic
1152487702 17:80605358-80605380 TTTTACATTAAGAAAAAAGAAGG + Intronic
1153513890 18:5886858-5886880 TATTCTATTAATAAAAAGGAAGG + Exonic
1153753623 18:8258684-8258706 TGTAAAATTAAGATAAAGAAAGG + Intronic
1153980889 18:10309504-10309526 TTTTATAATATTACAAAGGAAGG + Intergenic
1154369933 18:13750935-13750957 TTTTATATAAAGTGTAAGGAAGG - Intronic
1155105185 18:22657027-22657049 TTTTGTCTTCAGATAAAGAAAGG + Intergenic
1155784310 18:29878147-29878169 ATTTATATTATGATAATGGCAGG + Intergenic
1155982409 18:32195238-32195260 TGTTATATTATGATAAAAGTAGG + Intronic
1156214721 18:34984701-34984723 ATGTAGATTATGATAAAGGAGGG - Intronic
1156272013 18:35544320-35544342 CTTTATAGAAAGATAGAGGAGGG + Intergenic
1156283174 18:35661881-35661903 TTTTATACTAAAATAGAGCATGG + Intronic
1157848104 18:51022654-51022676 TCTTATTTTAAAAAAAAGGACGG - Intronic
1158238103 18:55342362-55342384 ATTCATATTAAGATACATGAGGG + Intronic
1158240998 18:55378041-55378063 TTTTATATTAAAAGAAAACAAGG - Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1158364181 18:56712505-56712527 TTTTATTTTATGAAAAAGCAAGG - Intronic
1158684790 18:59603697-59603719 CTTTATAGAAAGATAAGGGAAGG - Intronic
1159548193 18:69867136-69867158 TTTTATATGAATATAAATAAAGG - Intronic
1160337805 18:78058351-78058373 TTTTATATTAAAATTATGGAAGG + Intergenic
1161603395 19:5199627-5199649 TTTTTTTTTAAAAAAAAGGAGGG - Intronic
1163704643 19:18805015-18805037 TTTTATGTAAATATGAAGGAAGG - Intergenic
1164216391 19:23154228-23154250 TTTTATATTAAAATCTAGAATGG - Intergenic
1164753995 19:30676614-30676636 TTATAGATTATGATATAGGATGG + Intronic
1168522914 19:57066848-57066870 TTTTTTTTTAAAAAAAAGGAAGG + Intergenic
1202679792 1_KI270711v1_random:41901-41923 TTTTATATGTACATAAAGGGAGG + Intergenic
925758723 2:7162599-7162621 TTTAATATTAATATACAGGTTGG - Intergenic
925999666 2:9320084-9320106 TATTATTTTAAGAGAAAGAAAGG + Intronic
926330084 2:11817238-11817260 TTTTGAATTAGGATGAAGGAGGG + Intronic
926484779 2:13440906-13440928 TTTTGTATAAAGTGAAAGGAAGG + Intergenic
926614127 2:14978121-14978143 TTTTATAAGAAGAGAAAAGAAGG - Intergenic
928070815 2:28213968-28213990 TTTTATTTTGAAATAAAGGCAGG + Intronic
928784718 2:34869256-34869278 TTTTAAAGTAAAATAAACGAAGG - Intergenic
928833140 2:35512855-35512877 TTTTATATAAAGTGTAAGGAAGG + Intergenic
929089957 2:38205840-38205862 TTTAATATTATGGTAAAGGTAGG + Intergenic
929645220 2:43619467-43619489 TTCTTTTTTCAGATAAAGGAAGG + Intergenic
930225488 2:48788228-48788250 TTATATATGTAGAGAAAGGAAGG - Intergenic
930446383 2:51478510-51478532 TTTAATATAAAGATACAGGAAGG - Intergenic
930600257 2:53434478-53434500 TGTTCTATTAAGCAAAAGGAAGG - Intergenic
930755828 2:54971046-54971068 TTAAATCTTAAGATAAATGAGGG + Exonic
931380224 2:61745991-61746013 TTTTTTAATAAAATAAAGGTGGG - Intergenic
931410143 2:62021682-62021704 TTTTGTATTAAGCTGAAGAATGG + Intronic
931593996 2:63920623-63920645 TTTTGTATTAAAATTTAGGATGG - Exonic
931635094 2:64333539-64333561 GTTTAGGTTAAGATAAAGGATGG + Intergenic
931835598 2:66095697-66095719 TTTTGTATAAAGTGAAAGGAAGG + Intergenic
931891578 2:66678871-66678893 TTTTATTTTGAGAGAAAGTAAGG + Intergenic
932292969 2:70597996-70598018 TTTTATTTTGAGATAAATGTAGG + Intergenic
933573761 2:84043706-84043728 TTTTACATTTAGAAAATGGAAGG + Intergenic
934223165 2:90105219-90105241 TTTTGGATTGAGATGAAGGAGGG - Intergenic
934483859 2:94682368-94682390 TTTTTTATTAAGATATACAATGG - Intergenic
934939099 2:98486963-98486985 TTTTCTTTTAAGAGCAAGGATGG - Intronic
935546889 2:104409555-104409577 TTTTAAAAAAAGATAAATGATGG + Intergenic
936639497 2:114296296-114296318 GTTTTAATTAAGATAAAAGAGGG + Intergenic
937125146 2:119470342-119470364 TTTAATAATAAGAAATAGGATGG + Intronic
937591854 2:123623289-123623311 TTTTACATTAAAATAAATGTTGG - Intergenic
938634241 2:133205562-133205584 TTATAAATGAAGATAATGGAAGG - Intronic
938835318 2:135096945-135096967 ATTTATATTAATATATAGAAAGG - Intronic
939161369 2:138593938-138593960 TTTTCTATTAAAATAAAGCCTGG + Intergenic
939398051 2:141657910-141657932 TTTTCAATTAATAGAAAGGATGG - Intronic
941097531 2:161256354-161256376 TTATATATTAAGAGAAAAAAAGG - Intergenic
941194491 2:162431645-162431667 TCTTATATTCAAATAAATGATGG + Intronic
942207049 2:173629594-173629616 TTGTATATTAATATAAGAGAGGG - Intergenic
942670381 2:178369091-178369113 TTTCTTATTAAGATGAAGGCTGG - Intronic
942744554 2:179216953-179216975 TTTTATATAAGGTTTAAGGAAGG - Intronic
942874911 2:180783580-180783602 TTTTGTATAAAGTGAAAGGAAGG + Intergenic
942993673 2:182234918-182234940 TTTTATATTAAAATTATAGAGGG + Intronic
943265401 2:185725249-185725271 TTTTTTTTTTAGATAAAGAAAGG - Intergenic
943278512 2:185899830-185899852 TTTTATATGGAAAAAAAGGAAGG - Intergenic
943543462 2:189245449-189245471 TTTTATTTTAAGATTAATTAAGG + Intergenic
943685692 2:190815687-190815709 TCTTCTATTATGATCAAGGAAGG - Intergenic
943980636 2:194545275-194545297 TCTTATATGATGACAAAGGAGGG - Intergenic
945008278 2:205433234-205433256 TTTTAAATTGAGATATAGGCTGG + Intronic
945116330 2:206411239-206411261 TTTTTTATTAGGTTTAAGGAAGG + Intergenic
945211811 2:207391033-207391055 TTTTATATTATGTTAAATGAAGG + Intergenic
945506192 2:210643534-210643556 TTTAAAATAAAGATAAAGCACGG - Intronic
945567004 2:211413425-211413447 GTTTTTATTAAGACAAAAGAAGG - Intronic
945631948 2:212288913-212288935 TTATATATTAAAAGAAAGGGAGG + Intronic
947481911 2:230508618-230508640 TTTTATATTTAAAGAAAGTATGG - Intronic
949038309 2:241830711-241830733 GTTTATATAAAGATAAATGTTGG + Intergenic
1168975233 20:1960647-1960669 TTTTAAAGTAAGAGAAAAGAGGG - Intergenic
1169365723 20:4990673-4990695 TTTTATAATAAGATAAGAGATGG - Intronic
1169466196 20:5842250-5842272 TTTTATCTGAAGGTAGAGGAAGG - Intronic
1169585395 20:7077455-7077477 TTTTAAATGTAGATAAAGAAAGG + Intergenic
1169765237 20:9141534-9141556 TTTTAGATTGAGATAAAGATGGG + Intronic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1170654298 20:18271692-18271714 TTTTTTTTTAAGAAACAGGAAGG - Intergenic
1171261985 20:23742154-23742176 TTTTATGTGTAGCTAAAGGATGG + Intergenic
1171271089 20:23817884-23817906 TTTTATGTGTAGCTAAAGGATGG + Intergenic
1172378748 20:34469711-34469733 TTTTACTTAAAGATAAAGGAGGG + Intronic
1172486697 20:35302864-35302886 TTTTATAGCAAGTTAAATGAAGG + Exonic
1173382132 20:42555234-42555256 TTTTACATGAAGATAAACAATGG - Intronic
1174225966 20:49000351-49000373 TTTTATGATAAGATAACTGATGG + Intronic
1174688924 20:52483475-52483497 TTTTATAATTAGATAACAGAAGG - Intergenic
1174741177 20:53015642-53015664 TTCTATGTTAAAATATAGGAGGG + Intronic
1175366404 20:58459361-58459383 TTTTTTTTTAAGAGGAAGGATGG + Exonic
1175528059 20:59649498-59649520 TTTTGTGGTAATATAAAGGACGG + Intronic
1175584771 20:60129951-60129973 ATTTAATTTAAGAAAAAGGATGG + Intergenic
1175651337 20:60726826-60726848 TTTTATATTATCACAAAAGATGG - Intergenic
1176703478 21:10089056-10089078 TATTATATTAAGTTGAATGAGGG + Intergenic
1177306902 21:19330325-19330347 TTATATAATAAGTTAATGGACGG - Intergenic
1177307857 21:19343619-19343641 TTTAACATTAAGTTAAATGAGGG + Intergenic
1177380123 21:20329353-20329375 TTTTATATTTCCAAAAAGGAAGG - Intergenic
1177380678 21:20338926-20338948 TTTTTTATTAAAAGAAAAGAAGG - Intergenic
1177612712 21:23473430-23473452 TTTAATAATAATGTAAAGGAAGG + Intergenic
1177780673 21:25619609-25619631 TTTTATTTGAAGATTAAGTATGG - Intergenic
1178159285 21:29893055-29893077 TTTTATATTATAATAAAAGTAGG - Intronic
1178576803 21:33800083-33800105 TTTTCTATTAAAATGAAAGATGG + Intronic
1178732003 21:35112554-35112576 TTTTATATTAACATTTAGGTTGG + Intronic
1178780206 21:35595650-35595672 CCTTATATGAAGATAAAGAAAGG + Intronic
1179366528 21:40763915-40763937 TTTTATATAAGGTTTAAGGAAGG - Intronic
1179483463 21:41693476-41693498 GTTTTTAATCAGATAAAGGAAGG + Intergenic
1179819204 21:43926657-43926679 TTTTTTTTTAATAAAAAGGAGGG + Intronic
1182925367 22:34118019-34118041 TTTTATATAATGATATAGGTAGG - Intergenic
1183398128 22:37585002-37585024 TTTTAAATTAAAATTAAGGCTGG - Intergenic
949147205 3:716363-716385 TTTTATATAAAGATGAAATATGG + Intergenic
949549573 3:5101137-5101159 TCTTATCTAGAGATAAAGGATGG + Intergenic
949569163 3:5275290-5275312 CTTTATAGAAAGATACAGGATGG + Intergenic
949934612 3:9107057-9107079 AATTAGATTTAGATAAAGGATGG + Intronic
950308799 3:11937841-11937863 TTTTAGTTTGAGAGAAAGGAAGG + Intergenic
951196907 3:19834939-19834961 TTTTATAGTAAGAGAAAGGTAGG - Intergenic
951223801 3:20097349-20097371 TGTTATTTTAAGATGAAGGAGGG - Intronic
952732159 3:36649882-36649904 TTATATATTAGAATAAAGGATGG + Intergenic
952991849 3:38837258-38837280 TTTGATATTAATAAAACGGAAGG - Intergenic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
954165868 3:48757469-48757491 ATTTATATTAAGTTAAGGAATGG - Intronic
954528810 3:51299587-51299609 TTTTATATAAAGTGTAAGGAAGG + Intronic
955027287 3:55181363-55181385 TCCTATATAAAGCTAAAGGAGGG + Intergenic
955588202 3:60505166-60505188 TTATCTATTAAAATAAAGGAAGG - Intronic
956137486 3:66113431-66113453 TTTTAAATTAAGATAAAGACTGG - Intergenic
956151640 3:66249812-66249834 TTGTATATAAAGATGAATGAAGG + Intronic
956482256 3:69685031-69685053 TTTTATTTTCAGAGAAAGGAAGG + Intergenic
956486127 3:69723714-69723736 TTTTAAATTAAGGAAAAGGAAGG - Intergenic
957176220 3:76813638-76813660 TTTTATTTTAACATAGAGTAAGG - Intronic
957231422 3:77521470-77521492 TTTTATAGTATGGTAATGGATGG + Intronic
957433081 3:80139015-80139037 TTTTTTTTTAAGATATAGAATGG + Intergenic
957603692 3:82371480-82371502 TTTTATATAAAGTGTAAGGAAGG + Intergenic
957733373 3:84174144-84174166 ATTTATATGAAGATACAGCAGGG + Intergenic
957748350 3:84375410-84375432 TTTTATTAAAAAATAAAGGAGGG - Intergenic
958437845 3:94119701-94119723 TTGTATTCAAAGATAAAGGAAGG - Intronic
958467586 3:94476746-94476768 TTTTGTATAAAGTTTAAGGAAGG - Intergenic
958953612 3:100442763-100442785 TTTTATTTTTAAAAAAAGGAGGG - Intronic
959032587 3:101317917-101317939 TTTTAAAATAATATAAAGTACGG + Intronic
959102479 3:102027587-102027609 TTTTATCCTGAGATAAAGTAAGG + Intergenic
959212537 3:103405685-103405707 TTTTATATTCAGATAAAAGATGG + Intergenic
959299998 3:104586738-104586760 ATTTATAGTATGATAAAGTAAGG + Intergenic
959867213 3:111284423-111284445 TTTGATAGTAATATAAAGGCTGG + Intergenic
960102034 3:113753909-113753931 TTTTTTCTTAAGATACATGATGG - Intronic
960324060 3:116273345-116273367 TTTTCTATTAAGATGGAGGCAGG - Intronic
960644206 3:119860508-119860530 TTCCATATTCAGATAGAGGAAGG - Intronic
960733436 3:120751082-120751104 TTTTATAATAATATATATGATGG - Intronic
961338565 3:126201191-126201213 TTATTTATTAATAAAAAGGAAGG + Intergenic
961716787 3:128863279-128863301 TTTGATAATAAGAGAAAGAACGG + Intergenic
961839722 3:129698875-129698897 GCTTATATTAAAATAAAGCAGGG - Intronic
961921578 3:130431974-130431996 TTTAATTTTAAGATAGAGGTAGG + Intronic
961939279 3:130620592-130620614 TTTTCTTTAAAGATGAAGGAAGG + Intronic
963958352 3:151280410-151280432 TTGTCTATTAAGAAAAAGGTGGG - Intronic
964128807 3:153264978-153265000 TTTTGTATAAAGTTGAAGGAAGG - Intergenic
964799895 3:160544423-160544445 TTTTATATGAGCACAAAGGAAGG + Intronic
965415832 3:168391082-168391104 TTTTACATTAATATTAATGAAGG - Intergenic
965716035 3:171604141-171604163 TTTTGTATTATGATACAGGCTGG - Intronic
966001213 3:174950950-174950972 TTGTCTCTTTAGATAAAGGATGG + Intronic
966043076 3:175515979-175516001 TTTTATTTTAAAATAAATAAAGG + Intronic
966388862 3:179430389-179430411 TTCTATTATAAGAGAAAGGAAGG - Intronic
967282781 3:187838073-187838095 TTTTTTTTTAAAAAAAAGGAAGG + Intergenic
967597099 3:191339005-191339027 ATTTATTTTTAGATAAAGGGGGG + Intronic
968248040 3:197174716-197174738 ATTTATATACAGATAAATGAGGG + Intronic
969745743 4:9069751-9069773 TTTTTTTTTAAGATAGAGAAGGG - Intergenic
969985040 4:11199757-11199779 ATTTAAAAGAAGATAAAGGAAGG - Intergenic
970021432 4:11574001-11574023 TATTTTATTAATATTAAGGATGG - Intergenic
970060864 4:12032592-12032614 TTTCATATTAAGAAAAGTGATGG + Intergenic
970150169 4:13081238-13081260 TTTTAAAATTAGATAAAGGAAGG - Intergenic
970500827 4:16675090-16675112 TTTTATTTTGAGATAATGGTAGG + Intronic
970509432 4:16766219-16766241 ATGTATATTAATATAAAAGATGG - Intronic
970530031 4:16972030-16972052 TTTGCTGTTAAGATAAAGGATGG - Intergenic
970759544 4:19468308-19468330 TTTTTTAATATGACAAAGGATGG + Intergenic
971428938 4:26543420-26543442 TTTTATATGAAGTAAAAGCATGG + Intergenic
971485140 4:27151998-27152020 TTATAGATAAAGATAAAAGATGG - Intergenic
971566303 4:28145946-28145968 TTTTATATTAGAATGAATGATGG - Intergenic
973719046 4:53705036-53705058 TTTTTTCTAAAGATAAAGGAAGG - Intronic
974141414 4:57893038-57893060 TTTTATATTAAGATATACATAGG - Intergenic
975275877 4:72500785-72500807 TTTTATATAAAGTGAAAGGTAGG + Intronic
976359819 4:84164682-84164704 TTTTTTATTTAGTTAAATGATGG + Intergenic
976925502 4:90490692-90490714 TTTTATATAAGGTTTAAGGAAGG + Intronic
977126980 4:93181886-93181908 ATTTTTATTAAGATAAACTAGGG - Intronic
977630762 4:99239751-99239773 TTTAAAACTAAGATAAATGAGGG - Intergenic
977650890 4:99468172-99468194 TTTGGTAGTAAGATGAAGGATGG + Intergenic
977946920 4:102924377-102924399 TTTTATATAAAGTGTAAGGAAGG - Intronic
978014098 4:103722592-103722614 TTTCACATTAAGAAATAGGAAGG + Intergenic
978151313 4:105438997-105439019 TTTTTTTTTAAGATAAAGTTAGG - Intronic
978335166 4:107659338-107659360 TACTATATTAAAAGAAAGGATGG + Intronic
978362065 4:107941100-107941122 TTTATTGTTAAGAAAAAGGAGGG + Intronic
978889769 4:113810688-113810710 ATTTAAATTAAGAAAAATGATGG - Intergenic
979239986 4:118439453-118439475 TTTCAAGTTAAGATAAAAGATGG + Intergenic
979469734 4:121080739-121080761 TTTTTTTTTAAAAAAAAGGAGGG + Intergenic
979510763 4:121550822-121550844 GCTTATATTAAGATGAAGAAAGG - Intergenic
979956651 4:126961259-126961281 TCTTTTATAAAGATGAAGGAGGG + Intergenic
980015092 4:127640841-127640863 TTTTATATGATTATAAAGCATGG + Intronic
980375697 4:131945412-131945434 TATTATATTAAGTTGAATGAGGG + Intergenic
980405469 4:132349500-132349522 TTTAATATTGAAATAAAGGATGG + Intergenic
980540886 4:134193325-134193347 TTGTATTTTAGGATATAGGATGG - Intergenic
980641659 4:135587742-135587764 TTTTAAATGAAAAAAAAGGAGGG - Intergenic
981126751 4:141115962-141115984 TTTTGTATAAAGCTTAAGGAAGG - Intronic
981611261 4:146596367-146596389 CATTATATCAATATAAAGGAGGG - Intergenic
981972558 4:150682456-150682478 TTTGATATTCAGAGAAAGAAAGG - Intronic
983357038 4:166675811-166675833 TTTTATATTAAAAAAAAAAAAGG - Intergenic
983597584 4:169488342-169488364 TTTTGTATAAAGTTTAAGGAAGG + Intronic
983717095 4:170796085-170796107 TTTTTTATTAATATAAAGCTGGG + Intergenic
983757105 4:171352912-171352934 TTGTATCTTAACAAAAAGGAAGG + Intergenic
983898731 4:173110006-173110028 ATTTATATTAAGAGAAAGAAGGG - Intergenic
983982476 4:174015755-174015777 TCTTAAATTAGGAGAAAGGATGG + Intergenic
984330902 4:178316533-178316555 TTCTGTATTAAAATAAATGAGGG - Intergenic
984749692 4:183260157-183260179 TTTTATTTTTAGAGAAAAGAAGG - Intronic
985028577 4:185764796-185764818 TTCTATTTTAAGATAAATGATGG - Intronic
985332904 4:188860120-188860142 TTTTGTATAAAGTTTAAGGAAGG + Intergenic
986522473 5:8634712-8634734 TTTTATATTATAATTATGGAAGG - Intergenic
986573414 5:9188773-9188795 GTTTGTGTTAAGAGAAAGGAAGG - Intronic
988067665 5:26242220-26242242 GTTTAATATAAGATAAAGGATGG - Intergenic
988141670 5:27250328-27250350 TATTATTTTAAGATCAAGGTTGG + Intergenic
988190469 5:27925048-27925070 TTGTATTTTAAGATAAAGAATGG - Intergenic
988531933 5:32035502-32035524 TTTTTTTTTAAGAGAAAGAAAGG + Intronic
988965007 5:36407263-36407285 TTTTCTATAATGATAAAAGAAGG - Intergenic
989091219 5:37734577-37734599 TTTTATAAAAAGATAAAAGGGGG + Intronic
989124316 5:38036636-38036658 TGTTATACTAAGATAAACTAGGG + Intergenic
990100908 5:52185369-52185391 TTTTTTATTTAAAAAAAGGAGGG + Intergenic
990376943 5:55180105-55180127 TTTTATAGTAAGCAAAAGCAAGG + Intergenic
990862039 5:60338073-60338095 TTATATAGGTAGATAAAGGAAGG + Intronic
992250465 5:74870955-74870977 TTTTATTTTCTGATAAAAGAGGG + Intergenic
992309181 5:75477372-75477394 TTTTTTTTTAAGATAAAATACGG + Intronic
992547721 5:77831293-77831315 TTTAATAGGAGGATAAAGGAAGG - Intronic
992706089 5:79394483-79394505 TTTGATATTCAGTGAAAGGATGG + Intronic
992821296 5:80499205-80499227 TTTTATGTTATGATATAGTATGG + Intronic
993253788 5:85561004-85561026 TTTTGTATTAAGTGTAAGGAAGG - Intergenic
993295156 5:86128621-86128643 TTTTTAACTAAGAAAAAGGATGG - Intergenic
993459787 5:88169199-88169221 TTTTGTATAAAGTTTAAGGAAGG + Intergenic
994387664 5:99151176-99151198 TTTTATATAAGGTTTAAGGAAGG - Intergenic
994786917 5:104178104-104178126 TTTTATATTAAGATTAGGATGGG + Intergenic
994896224 5:105706912-105706934 TTTTTTTTTAAGATGGAGGAAGG + Intergenic
995002590 5:107152725-107152747 TTTTATATAAAGAGTATGGATGG + Intergenic
995223590 5:109678510-109678532 TATTATATTAAGGTTAAAGAGGG + Intergenic
995551980 5:113290849-113290871 TTTAAAATTGAGATTAAGGAAGG - Intronic
995753615 5:115478541-115478563 GTTTATATTGAGATTAAGGAAGG - Intergenic
995817033 5:116182275-116182297 TTTAATATTAAGATTATGGATGG + Intronic
995820504 5:116224934-116224956 TTTTACATTTAAATAAAAGATGG + Intronic
995927415 5:117391399-117391421 TTAAATATTAATATAAAGGTGGG + Intergenic
996123917 5:119704132-119704154 TTGAAAGTTAAGATAAAGGAAGG - Intergenic
996170073 5:120279590-120279612 TTTTATATTAAAGTAAATAAGGG - Intergenic
996547329 5:124694291-124694313 TTTCATTTTAAGATTAATGAGGG - Intronic
996587255 5:125103111-125103133 TTTTCAAATAAGGTAAAGGATGG - Intergenic
996932187 5:128903369-128903391 TTTTATTTTTAGAAAAAAGATGG + Intronic
997336975 5:133115328-133115350 TTTCATATTGAGACAAATGAGGG + Intergenic
997607962 5:135190403-135190425 TTTTATATTTGGATTTAGGAAGG - Intronic
997724225 5:136106730-136106752 TTTTATTCTAAAAAAAAGGAAGG + Intergenic
998032778 5:138886379-138886401 TTTTTTATTGAGAGAAAGGATGG + Intronic
998248013 5:140526746-140526768 TTTAATACTAAAATAAATGATGG + Intronic
998576421 5:143322693-143322715 ATTCATATCAATATAAAGGAAGG + Intronic
998630891 5:143897437-143897459 TTTTACATTAAAAAAAAGAAAGG - Intergenic
998790476 5:145761408-145761430 TTTTATATTAAGACATAAAAAGG - Intronic
999150595 5:149423791-149423813 ATTTATGTTGAGATAAGGGATGG - Intergenic
999739424 5:154538762-154538784 TTCTCTATAAAGATAAAAGAGGG - Intergenic
999826669 5:155280239-155280261 TTATATAGTCAGATATAGGAAGG + Intergenic
999885914 5:155922524-155922546 TTTAAAATTAAGATAAAAAATGG + Intronic
1000642268 5:163717009-163717031 TTATATTTTATGATAAAGAATGG + Intergenic
1001069025 5:168567975-168567997 TTTTCTATTAGAATAAAGAATGG - Intronic
1001225596 5:169941922-169941944 TTTTAAATTGGGAGAAAGGATGG - Intronic
1001409711 5:171502159-171502181 TTTGATAAAAACATAAAGGAGGG - Intergenic
1002112300 5:176926089-176926111 TTTCATAATAAAATAACGGAGGG + Intronic
1002139271 5:177128931-177128953 TTTCAACTTAAGATCAAGGAAGG - Intergenic
1002147107 5:177193098-177193120 TTTTAAATTACTCTAAAGGATGG + Intronic
1002740240 5:181430038-181430060 TTTCAAGTTAAGATAAAAGATGG + Intergenic
1003311842 6:4975463-4975485 TTTTATTTTTAGAAAAAGAAAGG - Intergenic
1005123052 6:22412426-22412448 TTTAATTGTATGATAAAGGACGG + Intergenic
1005435995 6:25812834-25812856 TTTTATATTAACATGAAGCATGG + Exonic
1005724016 6:28631224-28631246 TTTAAAACTAAGATAAAGAAAGG + Intergenic
1005756118 6:28926211-28926233 TTTTAAATTAAAAAAAAGGAAGG - Intergenic
1005904221 6:30247032-30247054 TTTAAAATTAAGATAATGGTAGG - Intergenic
1005995619 6:30929466-30929488 TTTCATATGGAGATAATGGAGGG + Intergenic
1006040745 6:31252528-31252550 TTTTGTAGTGAGAGAAAGGAGGG + Intergenic
1006548330 6:34798860-34798882 ATGTACATTAAGAGAAAGGAGGG + Intronic
1006657496 6:35608346-35608368 TTTTATTTTAAGATTCAGGGGGG - Intronic
1006967550 6:38004017-38004039 TTTTATATGAAACTGAAGGATGG + Intronic
1007315080 6:40981106-40981128 TTTTATGATAAGAATAAGGATGG - Intergenic
1007433527 6:41790860-41790882 TTGGGTATTAAGATAAAGAAGGG + Exonic
1007962774 6:45975762-45975784 TTTCATAGTAAGAGAAATGAAGG - Intronic
1008374012 6:50770687-50770709 TTTTATAATAATACAAATGAAGG - Intronic
1008374466 6:50775977-50775999 TTTAATATTATGATAAATAATGG + Intergenic
1008646201 6:53517417-53517439 TTTTATATTAAGAAAAGGTAGGG - Intronic
1009052310 6:58290985-58291007 TTCAATATAAAGCTAAAGGAAGG + Intergenic
1009398192 6:63227374-63227396 TTCTATTTTAAAATAAAGGGTGG + Intergenic
1009639287 6:66310020-66310042 TTTAATATTTATTTAAAGGATGG - Intergenic
1009675365 6:66812984-66813006 TTTTATATAAAGTGTAAGGAAGG - Intergenic
1009735026 6:67665265-67665287 TTTTATATTCAGAGAAAAGTGGG + Intergenic
1010369418 6:75090072-75090094 TTCTGTATTGGGATAAAGGAAGG - Intronic
1010785804 6:79999708-79999730 TTGTATATTTAGAAAAGGGAAGG - Intergenic
1011007229 6:82659876-82659898 TTGTATAAAAAGATAAATGAGGG + Intergenic
1011052160 6:83164480-83164502 TTTATTATTTAGATAAAGGAGGG - Intronic
1011468222 6:87680778-87680800 TTTTTTTTTAAAAAAAAGGAAGG + Intronic
1011575836 6:88798147-88798169 TTTTATATTCAGAATAATGAAGG - Intronic
1011579062 6:88837607-88837629 TAATATATTAAGACAAAGTAGGG + Intronic
1012353322 6:98280535-98280557 CTATATATTTAGATAAATGATGG - Intergenic
1012644186 6:101659183-101659205 TTTTGTATAAAGAATAAGGAAGG + Intronic
1014243805 6:119046054-119046076 AGTTGTAATAAGATAAAGGATGG - Intronic
1014545151 6:122726690-122726712 TTTTATAATCAGATAAAGAGGGG + Intergenic
1014563882 6:122924860-122924882 GTTTATATTAAAATACAGTATGG - Intergenic
1014658786 6:124140189-124140211 TTTTATATTATGCAAAAGGAAGG - Intronic
1014668125 6:124265530-124265552 TTTTGTAATAAGATAACAGAAGG + Intronic
1014821163 6:125989747-125989769 TTTCATCTTAAGAAAAATGAGGG - Intronic
1014992750 6:128102876-128102898 GTCTATATCAAGATGAAGGAAGG - Intronic
1015081576 6:129232459-129232481 TTTTGTTCTAAGATATAGGATGG - Intronic
1015083646 6:129260272-129260294 TTTTAAATTGAAATAAAAGATGG - Intronic
1015100762 6:129476987-129477009 TTTTTCATTAAGATAAAAAAAGG + Intronic
1015106893 6:129547496-129547518 TTTTACAGCAAGAGAAAGGAGGG + Intergenic
1015146499 6:129993489-129993511 TTTTTTTTTAACATAAATGAAGG + Intergenic
1015183419 6:130385446-130385468 TTTTAAATTAAGATAGAGATAGG + Intronic
1015405390 6:132831343-132831365 TTTAAAATGAAGATAAAGGCTGG - Intergenic
1015703418 6:136061066-136061088 TTTTAAAGTAACATAAAAGAGGG - Intronic
1015802531 6:137075113-137075135 TTTTATATAAAGTGTAAGGAAGG - Intergenic
1016257754 6:142129299-142129321 TTTTAGTTTCAGATAAAGGAGGG - Intergenic
1016662416 6:146597047-146597069 TATTAAATTAGGATAAAGTAAGG - Intergenic
1016695446 6:146988941-146988963 TGTTATTTTATGATAATGGAAGG - Intergenic
1017107395 6:150900713-150900735 TTCTATATTAAGAAAAAGTGCGG + Intronic
1017107904 6:150905335-150905357 TATAATATCAAGAAAAAGGATGG - Intronic
1017903423 6:158737972-158737994 TTTTATAAGTAGATAAACGAAGG - Intronic
1018307049 6:162468823-162468845 TTTTAAATTAATATATTGGATGG + Intronic
1019245352 6:170705638-170705660 TTTCAAGTTAAGATAAAAGATGG + Intergenic
1020394627 7:7700423-7700445 ATTTATATTAAGAAAAAGTCAGG + Intronic
1020636415 7:10700835-10700857 TTTTATATAAAGTGTAAGGAAGG - Intergenic
1021011550 7:15474517-15474539 TTTTGTATAAAGTTTAAGGAAGG - Intronic
1021242603 7:18222481-18222503 TTTTATAATAAGAAAAAATAGGG - Intronic
1021346200 7:19531866-19531888 TTTTATATGTAGTGAAAGGAAGG + Intergenic
1021728098 7:23569155-23569177 TTAAAAATTAAGATAAAGGCTGG - Intergenic
1022257838 7:28677092-28677114 TTTTATCTTAAAATAGAAGAGGG + Intronic
1022272216 7:28819774-28819796 TTTTATAGTAAGAAAAAAAAAGG - Exonic
1023127368 7:36967939-36967961 TTTAATATAAACATAATGGAAGG - Intronic
1023309781 7:38873242-38873264 TTTTATGTTAAGTTAAAAGTAGG + Intronic
1023421330 7:39983190-39983212 TTTTATATAAGGTTTAAGGAAGG + Intronic
1023427483 7:40053761-40053783 TTTTTTTTTAAGAAAAAGAAGGG + Intronic
1023771430 7:43560293-43560315 TTTTCTTTTAAAGTAAAGGAAGG + Intronic
1023954988 7:44878033-44878055 CTTTATATTTAGAAATAGGATGG - Exonic
1024351567 7:48370949-48370971 TTTTATATAAGGTTTAAGGAAGG + Intronic
1024915001 7:54488970-54488992 TTTTAAACAAAGAGAAAGGAAGG - Intergenic
1025168802 7:56737250-56737272 TTGTTTTTTAATATAAAGGAGGG - Intergenic
1025703589 7:63842662-63842684 TTGTTTTTTAATATAAAGGAGGG + Intergenic
1025794206 7:64722821-64722843 TTTTATATTAAAAGCTAGGATGG - Intergenic
1026816526 7:73516878-73516900 AATTATATTAAGAGAAAGCAAGG + Intronic
1027807815 7:82851988-82852010 TTATATATTAACATAAAAGGGGG + Intronic
1027832475 7:83197300-83197322 TGTTATTTTAATACAAAGGAAGG - Intergenic
1028060608 7:86309717-86309739 TTATATATTGACATAAATGATGG - Intergenic
1028304307 7:89243709-89243731 TATTGTGTTAAGATAAAGAAGGG + Intronic
1028348637 7:89815799-89815821 TTTTAAATTAATTTAAATGATGG + Intergenic
1028478615 7:91279444-91279466 TTTTAGAAGAATATAAAGGATGG - Intergenic
1028751363 7:94386882-94386904 TTTTATTTTAATTTAAAAGAAGG + Intergenic
1030356382 7:108547925-108547947 ATTTCTATTAAGATTAAGAAAGG - Intronic
1030655738 7:112165662-112165684 TTAAATATCAAGATAAAAGAAGG - Intronic
1030844770 7:114395532-114395554 TTTTAGATAAAGAGAAAGCAAGG + Intronic
1031552129 7:123127973-123127995 ATTTATATTGACATATAGGATGG + Intronic
1031673638 7:124582493-124582515 GATTATATCATGATAAAGGAAGG - Intergenic
1032826237 7:135571284-135571306 TTTTTTTTTAAGATCGAGGAAGG + Intronic
1033949722 7:146769291-146769313 TTTTATATAATAGTAAAGGAGGG - Intronic
1034742653 7:153493033-153493055 TTTGATATGAAGATGAAGGGGGG - Intergenic
1035502775 8:102564-102586 TTTCAAGTTAAGATAAAAGATGG - Intergenic
1035996529 8:4553477-4553499 TTTTATTCAAAAATAAAGGAGGG + Intronic
1036383996 8:8261838-8261860 TTTTATAGGAAGTAAAAGGAAGG + Intergenic
1037372681 8:18196766-18196788 TATTATTTTAAGAAAGAGGAAGG + Intronic
1037427231 8:18769234-18769256 CTTTAAATGAAAATAAAGGAAGG + Intronic
1037513684 8:19609185-19609207 TTTTATATTGAGATTGAGGGAGG + Intronic
1038197872 8:25384754-25384776 TTTTTTATTAAGACATAGGCTGG - Intronic
1038204122 8:25448539-25448561 TTTTTTATTGTGATAAAAGATGG - Intronic
1038427543 8:27474008-27474030 TTTTGTCTTAAGATAAAGATTGG + Intronic
1038529004 8:28301799-28301821 TTTTTTTTTAAAAAAAAGGAAGG - Intergenic
1038665164 8:29531497-29531519 TTTTGTAGTGAGAGAAAGGAGGG - Intergenic
1038858039 8:31354460-31354482 GTTTATATAAAGATAAATGTTGG - Intergenic
1039207061 8:35168760-35168782 TTTAATATCTATATAAAGGAAGG - Intergenic
1039365968 8:36928151-36928173 TTTTATATTGAGAAAAATAATGG - Intronic
1039550916 8:38442253-38442275 ATTTATATTATAATAAAGGCAGG - Intronic
1039620511 8:38992962-38992984 TTTATCATTAAGGTAAAGGAAGG - Intronic
1040000426 8:42571206-42571228 TTTTTTTTTAAGATAAAGTCTGG + Intergenic
1040744805 8:50628623-50628645 TTATAAATTCACATAAAGGAAGG - Intronic
1040816879 8:51517990-51518012 TATTATATGAAGATAAATTAAGG - Intronic
1041322745 8:56631561-56631583 TTTTATATGAGGTTTAAGGAAGG + Intergenic
1041854421 8:62434488-62434510 ATTTATCTTAAGATAAACGCTGG - Intronic
1041854423 8:62434493-62434515 GTTTATCTTAAGATAAATCAGGG + Intronic
1042037020 8:64544377-64544399 TTAGATATTAAGAAAAATGATGG + Intergenic
1042258004 8:66826269-66826291 TTTCTTATAAAGATGAAGGAAGG - Intronic
1042291163 8:67170738-67170760 CTATATTTTAAGGTAAAGGATGG + Intronic
1042858145 8:73287829-73287851 TTTTATATTAAGAGGGAGGCAGG + Intergenic
1043090706 8:75899340-75899362 TTTTATAAACATATAAAGGATGG - Intergenic
1043117159 8:76272069-76272091 TCTTAGATTAAGAAAAAAGAGGG + Intergenic
1043473110 8:80580585-80580607 TTTTAAATTATTATAAAGGTAGG - Intergenic
1043560607 8:81489099-81489121 TATTATATAAAGACAAAGTAGGG - Intergenic
1043700569 8:83282776-83282798 TTTTATAGTAAGATCAAGATTGG - Intergenic
1043727104 8:83624660-83624682 TTTTGTGTTTAGAGAAAGGAAGG + Intergenic
1043763432 8:84098813-84098835 TTTTGTATTAAGTGTAAGGAAGG + Intergenic
1043773115 8:84229681-84229703 TTTGAGATTAAGAAAGAGGATGG + Intronic
1043794483 8:84519333-84519355 ATTCATATTAAGAGAGAGGATGG - Intronic
1044769296 8:95613006-95613028 TTGTATATGAAAATAAAGCAGGG + Intergenic
1045200135 8:99972220-99972242 TTTTATATAAGGTTTAAGGAAGG - Intronic
1045224777 8:100233807-100233829 GTTCATTTTAAGATAGAGGAAGG + Intronic
1045354299 8:101371777-101371799 TTTTTGATTCAGATAATGGATGG - Intergenic
1046087576 8:109457744-109457766 TGTTATATTACAACAAAGGAAGG + Intronic
1046320282 8:112565482-112565504 TTTTATATTCAAATTAAAGATGG - Intronic
1046530457 8:115438567-115438589 TTATATATTTAGATACAGGGAGG + Intronic
1046611345 8:116429083-116429105 TTGAATAACAAGATAAAGGAAGG - Intergenic
1047106380 8:121734885-121734907 TTTTAAATTAAGGTATAGGCCGG - Intergenic
1047521351 8:125597588-125597610 TTCTATATGAAGATATAGGCTGG + Intergenic
1047578738 8:126188589-126188611 TTTCATATTAAGTTAGAGGTTGG - Intergenic
1047611195 8:126522533-126522555 TTTTTAATTTAGATATAGGAAGG + Intergenic
1048024406 8:130571838-130571860 TATTAGATTTAGATAAAGCAAGG + Intergenic
1048155919 8:131951073-131951095 TTTTATTTTAAGATAATTAAAGG + Intronic
1048249867 8:132854868-132854890 TTTTATATCATGACAAAGCAGGG - Intergenic
1048310273 8:133316957-133316979 TTTTTTTTTAAGAGACAGGATGG + Intergenic
1050808477 9:9714848-9714870 TTTCATATCAGGATAAAGGAAGG - Intronic
1050989149 9:12125082-12125104 TTTTATCTTAAGCAAATGGATGG + Intergenic
1051033171 9:12708270-12708292 TTTTATTTGAGGATAAGGGAAGG + Intronic
1051438347 9:17056302-17056324 TTTTGTATAAAGTTTAAGGAAGG + Intergenic
1051638803 9:19205178-19205200 TTTTTTTTTAAGATACAGGTAGG - Intergenic
1051701580 9:19829891-19829913 TTTAATAAAAAGAGAAAGGAAGG - Intergenic
1052024796 9:23562572-23562594 CTTTATATTAAGATATAACAAGG + Intergenic
1052486171 9:29102606-29102628 TTTTATCTTAACCTGAAGGAAGG + Intergenic
1052722140 9:32184711-32184733 TTTTATAATATGATATAGAAAGG + Intergenic
1053640739 9:40076077-40076099 TATTATATTAAGTTGAATGAGGG + Intergenic
1053673925 9:40402018-40402040 TTTTTTATTAAGATATACAATGG + Intergenic
1053765395 9:41389395-41389417 TATTATATTAAGTTGAATGAGGG - Intergenic
1053923728 9:43028385-43028407 TTTTTTATTAAGATATACAATGG + Intergenic
1054321429 9:63672060-63672082 TATTATATTAAGTTGAATGAGGG + Intergenic
1054510701 9:65974272-65974294 TTTTGTATTAAGATATACAATGG - Intergenic
1054544013 9:66300555-66300577 TATTATATTAAGTTGAATGAGGG - Intergenic
1055085466 9:72309190-72309212 TTTTATATTAATTTAAATGTAGG + Intergenic
1055161750 9:73138001-73138023 TTTCATTTTAAGATGAAGAAAGG + Intergenic
1055184602 9:73435461-73435483 TTTTATTTTTAGAAAAAGGAAGG - Intergenic
1056784946 9:89584813-89584835 ATTTAGATTAAGATTAAAGAGGG + Intergenic
1058613143 9:106796724-106796746 TTTTACATTGAGGTAAAGGTAGG - Intergenic
1059558318 9:115305490-115305512 TTTTACATTAGAAAAAAGGAGGG + Intronic
1059592722 9:115679578-115679600 TTTTATTTGAAGATGAAGTATGG + Intergenic
1060713914 9:125902082-125902104 TTTTTTTTTAAGAGAAATGATGG + Intronic
1062512502 9:136914548-136914570 TTTTCTCTTAAAATAAAGCAAGG - Intronic
1202788514 9_KI270719v1_random:59155-59177 TATTATATTAAGTTGAATGAGGG + Intergenic
1203605548 Un_KI270748v1:54846-54868 TTTCAAGTTAAGATAAAAGATGG + Intergenic
1186644932 X:11496461-11496483 CTTTATATTCAAATAAATGAGGG + Intronic
1186912248 X:14181085-14181107 TTTTATTTTAAGGTAACTGAAGG + Intergenic
1187212349 X:17243930-17243952 TTTCATTTTTACATAAAGGAAGG + Intergenic
1187800886 X:23061476-23061498 ATGTTTATTAAAATAAAGGAGGG + Intergenic
1187861450 X:23687481-23687503 TTTTGTATTAAGAGAGGGGATGG - Intergenic
1188135805 X:26493326-26493348 TTTGATTTTAAGATAATGAAGGG + Intergenic
1188869485 X:35356955-35356977 TATTATATAATGGTAAAGGAGGG - Intergenic
1188890366 X:35604651-35604673 TTTTATATTAAGATTGATGAAGG - Intergenic
1189054947 X:37688665-37688687 TTTTAAATTAAGAAAAAGTTTGG + Intronic
1189107057 X:38247692-38247714 TCTTATATAAAGTTAAAGCATGG - Intronic
1189683776 X:43542826-43542848 TTATATTTTATGATAAAGAAAGG - Intergenic
1190325112 X:49201839-49201861 GTTTATAATAGGATAAAGAATGG + Intergenic
1191035183 X:56017729-56017751 TTTTAGTTAAAGATAAAAGAAGG + Intergenic
1191196806 X:57732695-57732717 TTTTATTTTAATAGAAAGAAGGG - Intergenic
1191925344 X:66303230-66303252 ATTTATATTAGGAAAAAGGGGGG - Intergenic
1192419102 X:71013080-71013102 TTTTAAATTAAGGTAAATTAAGG + Intergenic
1192922019 X:75716821-75716843 TTTTGTATAAAGAGTAAGGAAGG + Intergenic
1193385717 X:80869526-80869548 TTTTATATTTAAGTCAAGGAAGG + Intergenic
1193641661 X:84016088-84016110 TTTAATATTAGAATAAATGAGGG + Intergenic
1195778506 X:108434620-108434642 ATATATTTTAAGATAGAGGAGGG - Intronic
1196046496 X:111261303-111261325 TTTTATATAAAGATATATAATGG + Intronic
1196138165 X:112232116-112232138 TCTTAGGTTAAGATACAGGAGGG + Intergenic
1196575301 X:117310543-117310565 TTTTTTAAAAAGATACAGGATGG + Intergenic
1196881212 X:120199692-120199714 TTTAATATGAAGATAACAGATGG - Intergenic
1197167474 X:123393758-123393780 TTTTATATTAAAATGTTGGAGGG + Intronic
1197293736 X:124691393-124691415 TTTTCTCTTAAGAAAAAGTAAGG - Intronic
1197786933 X:130207660-130207682 TATTATATTAAGATCAAAGTTGG - Intronic
1199622082 X:149711179-149711201 TTTTAATTGAAGATAAAGAATGG + Intronic
1201498806 Y:14619089-14619111 TTATAGATTTAGATAGAGGAAGG + Intronic
1201537787 Y:15069467-15069489 TTTTGTATGAAGCTTAAGGAAGG - Intergenic
1201595515 Y:15663960-15663982 TTTTGTATAAGGATTAAGGAAGG + Intergenic
1201689424 Y:16746436-16746458 TTTTTTATTAAAACAAAAGATGG - Intergenic
1201695562 Y:16820509-16820531 TTTTATATAAGGTTTAAGGAAGG + Intergenic
1202105446 Y:21359352-21359374 TTTTATATAAAGTGTAAGGAAGG - Intergenic
1202387731 Y:24341287-24341309 TTTCAAGTTAAGATAAAAGATGG + Intergenic
1202483055 Y:25328841-25328863 TTTCAAGTTAAGATAAAAGATGG - Intergenic