ID: 1111990240

View in Genome Browser
Species Human (GRCh38)
Location 13:95109087-95109109
Sequence TAGAGCATGGAGCAGTTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111990240_1111990243 -3 Left 1111990240 13:95109087-95109109 CCAGTTAACTGCTCCATGCTCTA 0: 1
1: 1
2: 0
3: 4
4: 114
Right 1111990243 13:95109107-95109129 CTAGATCCTGGAAAAGTACTTGG 0: 1
1: 0
2: 0
3: 24
4: 247
1111990240_1111990246 8 Left 1111990240 13:95109087-95109109 CCAGTTAACTGCTCCATGCTCTA 0: 1
1: 1
2: 0
3: 4
4: 114
Right 1111990246 13:95109118-95109140 AAAAGTACTTGGCATACAGGAGG 0: 1
1: 0
2: 4
3: 68
4: 595
1111990240_1111990245 5 Left 1111990240 13:95109087-95109109 CCAGTTAACTGCTCCATGCTCTA 0: 1
1: 1
2: 0
3: 4
4: 114
Right 1111990245 13:95109115-95109137 TGGAAAAGTACTTGGCATACAGG 0: 1
1: 0
2: 0
3: 23
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111990240 Original CRISPR TAGAGCATGGAGCAGTTAAC TGG (reversed) Intronic
903874571 1:26464704-26464726 GAGGGCATGGAACAGGTAACTGG - Intronic
910666025 1:89726700-89726722 TATATCATGGAGCAGTTAGGTGG + Intronic
911677039 1:100670378-100670400 TTCAGCATGGAGCAGTTTTCTGG + Intergenic
914909947 1:151776883-151776905 TACAGCATGGATCAGTAAAAAGG + Intronic
915617292 1:157048734-157048756 TAAAGTTTGTAGCAGTTAACAGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
920834156 1:209492466-209492488 TAGCCCATGGAGGAGTTACCTGG - Intergenic
921391080 1:214614305-214614327 TAGAGCATTTTGCAGTTAAATGG + Intronic
1068963620 10:62889976-62889998 TAAGGCATGGAGCAATTAAGTGG + Intronic
1069733480 10:70634765-70634787 TAGAGCAGGTAGCAGGTAATTGG + Intergenic
1076671365 10:132122546-132122568 CAGAGCATGGAGGCTTTAACAGG + Intronic
1076770906 10:132664172-132664194 CAGAGCAAGGAGCAGCTCACGGG - Intronic
1079111729 11:17609100-17609122 CAGAGCAGGGAGCAGTTTAAAGG - Intronic
1079470332 11:20771826-20771848 TAGAGGATGGAGCAATTACTAGG - Intronic
1081003611 11:37705048-37705070 AAGAGCATAGAGCAATTTACAGG - Intergenic
1086081881 11:82911854-82911876 TAGAGAATGGATGTGTTAACAGG + Intronic
1087287061 11:96276158-96276180 TAGAGAATGGACCAGGAAACCGG - Intronic
1089204330 11:116746840-116746862 TAAGGCATAGAGAAGTTAACTGG + Intergenic
1095584995 12:43839604-43839626 TAAAGCAAGGAAAAGTTAACAGG - Intronic
1096184860 12:49572229-49572251 TAGAGCCAGGAAGAGTTAACTGG - Intronic
1098739236 12:74150365-74150387 TAGAGTAAGCAGCAGTAAACAGG + Intergenic
1103016024 12:117495205-117495227 AAGAGCATGGGACAATTAACTGG - Intronic
1105021281 12:132818105-132818127 TAGAGCATGGAGGAGTGGAGGGG - Intronic
1106883406 13:34156702-34156724 TAGAGGATGAACCTGTTAACAGG - Intergenic
1107715461 13:43195263-43195285 AAGAGCAAGCAGCAGTCAACGGG - Intergenic
1108707762 13:53005632-53005654 TAGAACATGGAGCACTGGACGGG + Intergenic
1111990240 13:95109087-95109109 TAGAGCATGGAGCAGTTAACTGG - Intronic
1117991362 14:61436898-61436920 TAGAGCAGGGAGAAGGTACCAGG - Intronic
1118171169 14:63390167-63390189 TAGAGCATTGAGCATGTAGCAGG - Intronic
1119252851 14:73171708-73171730 AAGAGCAGGTAGCAGGTAACTGG + Intronic
1126163035 15:45631651-45631673 TAGAGAATGGAACAGTGAAAGGG - Intronic
1126986576 15:54317893-54317915 TAGAGGTTGGAGCAGTTAGGGGG - Intronic
1133078280 16:3296215-3296237 TAGTACATGAAACAGTTAACAGG + Intronic
1135060675 16:19268941-19268963 TAGCCCATGGAGCAGTTACCTGG - Intergenic
1138000649 16:53275605-53275627 TAGAGAATGGAGAAGAAAACTGG - Intronic
1146422650 17:32702897-32702919 TGGAACATGGAGCAGGTAAGGGG + Intronic
1153675955 18:7455732-7455754 TAAAGCATGGATGAGATAACAGG + Intergenic
1155088875 18:22486518-22486540 CAAAGCAGGGAGCAGTTTACTGG - Intergenic
1155313421 18:24547230-24547252 TAGAGCATGGATCATTTCAATGG - Intergenic
1157989318 18:52475976-52475998 TAGTGCATGCAGCTGTTATCTGG - Intronic
1160192382 18:76724624-76724646 AAGAGCATGCAGCTGTTAAGTGG - Intergenic
925932699 2:8722860-8722882 TCCAGCATGGAGCAGTTGGCAGG - Intergenic
929073373 2:38056874-38056896 TAGAGAATGCAGCAGTTAAATGG - Intronic
929285023 2:40126164-40126186 CAGAGCATGGAGTTGTTATCTGG - Intronic
929688803 2:44057679-44057701 TACAGCATGAATCAGTAAACAGG - Intergenic
930168736 2:48229977-48229999 TAGAGCTTGGAGAAGATAATTGG - Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
939774735 2:146370564-146370586 TAGAGCATGTAGCAGGGAAGAGG + Intergenic
942131951 2:172888852-172888874 TGAAGCATCCAGCAGTTAACTGG - Intronic
943095867 2:183428574-183428596 TAGAGCATGGAGGAGTTTTAGGG - Intergenic
946830681 2:223725396-223725418 TTGAGCATGGAGAAGTAAATAGG + Intergenic
946986851 2:225282961-225282983 TAGAGCATTTGGCAATTAACGGG - Intergenic
947811433 2:233006554-233006576 TAGAGGATTGAGCACTAAACAGG - Intronic
948058948 2:235029746-235029768 TAAAGCAAGGACCAGTTCACGGG + Intronic
1170917433 20:20641131-20641153 TAAGGCATGGAGAAGTTAAGTGG - Intronic
1176721987 21:10400899-10400921 AAGAGCTGGGAACAGTTAACAGG - Intergenic
1177415048 21:20782170-20782192 TGGAGCAGGTAGCAGGTAACCGG - Intergenic
1179073691 21:38097447-38097469 TAGAGAATGCAGCAATTAAAAGG + Intronic
1180303177 22:11053676-11053698 AAGAGCTGGGAACAGTTAACAGG - Intergenic
1181723877 22:24797628-24797650 TGGAGCAAGGAGCATTTTACAGG - Intergenic
1182769537 22:32784251-32784273 TAGAACATGGCGCAGGTGACAGG + Intronic
1184211223 22:43036675-43036697 AAGAGCTGGGAACAGTTAACGGG + Intergenic
950199023 3:11029576-11029598 TAGAGAATGCAGCACCTAACTGG + Intronic
952113056 3:30146672-30146694 TAGAGGATGGAACATTTAGCAGG - Intergenic
957617498 3:82550093-82550115 TGGAGCATGGAGAAGTGACCAGG - Intergenic
962336301 3:134534490-134534512 TAGATAATGGAGCAGTAAAAAGG - Intronic
962921865 3:139957658-139957680 TAGAGCATGGGGGACTTTACAGG + Intronic
970439807 4:16071012-16071034 AAGATCATTCAGCAGTTAACAGG + Intronic
976122444 4:81798336-81798358 TAGAGCATGGAGCAGACAGGTGG - Intronic
976758703 4:88525239-88525261 TAGAGAATAGGGCAGTTATCGGG + Intronic
977560183 4:98524755-98524777 TTGAGCATTGAACAGTTAATAGG - Intronic
984777544 4:183495334-183495356 AAGAGAAAGGAGCAGTTAAGAGG - Intergenic
985071792 4:186172868-186172890 TAGAAAATGGAGCAGAGAACAGG + Intergenic
988103066 5:26707567-26707589 TAGAGGATGGAGCAGTTTGGAGG + Intergenic
990444861 5:55885214-55885236 GAGAGCATGCTGCAGTAAACAGG - Intronic
997907764 5:137836607-137836629 TAGAGCAAGTTGCATTTAACTGG - Intergenic
999402363 5:151275251-151275273 TAGAATATGGAGCAATTAAACGG - Intergenic
1000523392 5:162325614-162325636 TAGAGCATGAAGCAGTTTCCTGG - Intergenic
1004307028 6:14510272-14510294 TAGTGCATCGAACAATTAACAGG + Intergenic
1007044199 6:38755796-38755818 TAGACCCTGGAACAGATAACAGG - Intronic
1008768378 6:54948074-54948096 AAGAGCATGGAGCAGGTGAAAGG + Intergenic
1010832526 6:80548289-80548311 TAGAGCATGAAACAGGAAACTGG + Intergenic
1011456492 6:87556032-87556054 AGCAGCATGCAGCAGTTAACAGG - Intronic
1011749232 6:90438693-90438715 TAAAGCATGGAGAAGTGACCCGG - Intergenic
1013476940 6:110517075-110517097 AAGAGAATGTTGCAGTTAACTGG + Intergenic
1013945268 6:115715439-115715461 TAGAGGATGGAGGAGTGAAAAGG - Intergenic
1017984790 6:159434510-159434532 TTGAGCATGGGGCTGTTGACAGG - Intergenic
1021412428 7:20343409-20343431 TACAGCAGGCAGCAGATAACAGG - Intronic
1022350049 7:29559860-29559882 TAGTGCATGGATAAGTAAACTGG - Intergenic
1022496322 7:30855210-30855232 TGGAAGATGGAGCAGTTATCAGG + Intronic
1032528727 7:132602366-132602388 TAGAGCATGTAGCTGTCATCTGG - Intronic
1032866537 7:135931023-135931045 TAGAGCATGGAGCGGTTAACTGG - Intronic
1034659529 7:152757498-152757520 CTGAGCATGCAGCAGTAAACAGG - Intergenic
1034909922 7:154987508-154987530 TAGAGAGAGGAGCAGATAACTGG - Intronic
1036474259 8:9078758-9078780 TTGAGCATGCAGCAGATACCTGG - Intronic
1040741241 8:50578969-50578991 TAGAGCTTGGAACAGTTTAAAGG + Intronic
1042269640 8:66942033-66942055 TAGGGCATGCAGCAGTTTAGAGG - Intergenic
1043526611 8:81104601-81104623 CAGAGGATGGAGCAGTTTGCAGG - Intronic
1044116282 8:88338566-88338588 TAGAGCATAGAACAATTGACAGG - Intergenic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1045425711 8:102063988-102064010 TAGGCCATGGAGCAGTTCCCAGG - Intronic
1045895836 8:107215569-107215591 CAGAGCTTGTAGTAGTTAACTGG - Intergenic
1048244347 8:132776501-132776523 TAGAGCATTAAAAAGTTAACAGG - Intronic
1049564856 8:143332707-143332729 TAAAGTAGGGAGAAGTTAACGGG + Intronic
1050088224 9:1989133-1989155 TGAAGCATAGAGAAGTTAACAGG - Intergenic
1050844958 9:10204110-10204132 TAAAGCATGGAGAGGTTACCAGG - Intronic
1051401390 9:16687329-16687351 TAGACCAAGGAGCAGGTAGCAGG - Intronic
1052035411 9:23674852-23674874 AAGAGCCTGGAGAAGTTAAGTGG - Intergenic
1053027811 9:34745111-34745133 TAGAGCAAGGAGCAGCCAGCTGG + Intergenic
1055552951 9:77447754-77447776 GAGAGCATGGAGCAGTGTTCAGG + Intronic
1055664179 9:78536740-78536762 TAGAGGATGGAGCTGTTATCGGG + Intergenic
1055730990 9:79279118-79279140 TAGAGCATGGCTTAGGTAACTGG + Intergenic
1058577999 9:106423978-106424000 TTGAGAATGGAGCAGATAAGTGG + Intergenic
1059065465 9:111079046-111079068 TAGAGCAGAGGGTAGTTAACAGG - Intergenic
1059218784 9:112592096-112592118 CAGAGCAGGTAGCAGGTAACTGG + Intronic
1187239834 X:17502380-17502402 TAGAGCATGGAGAAGGTTCCAGG - Intronic
1194058362 X:89164748-89164770 TGGAGCAGGTAGCAGGTAACCGG + Intergenic
1196959737 X:120988672-120988694 TAAGGCCTGGAGTAGTTAACTGG + Intergenic
1197862471 X:130985106-130985128 AGGAGCATGGAGCAGGTGACAGG - Intergenic
1201650997 Y:16286390-16286412 CAGAACATGCAGCATTTAACAGG - Intergenic