ID: 1111993282

View in Genome Browser
Species Human (GRCh38)
Location 13:95137968-95137990
Sequence TTTTCTTTGGGGAAAGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 464}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111993275_1111993282 1 Left 1111993275 13:95137944-95137966 CCCTGATTAAGCAGCAAAGTTTT 0: 1
1: 2
2: 2
3: 11
4: 203
Right 1111993282 13:95137968-95137990 TTTTCTTTGGGGAAAGTGGGCGG 0: 1
1: 0
2: 3
3: 61
4: 464
1111993276_1111993282 0 Left 1111993276 13:95137945-95137967 CCTGATTAAGCAGCAAAGTTTTA 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1111993282 13:95137968-95137990 TTTTCTTTGGGGAAAGTGGGCGG 0: 1
1: 0
2: 3
3: 61
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111993282 Original CRISPR TTTTCTTTGGGGAAAGTGGG CGG Intronic
900005683 1:48186-48208 TTTTCCTAATGGAAAGTGGGGGG + Intergenic
900831787 1:4970645-4970667 TTTTCTGAAGGGAAAGAGGGAGG - Intergenic
903214263 1:21834638-21834660 TTTTGTTGGGGGACAGTGAGTGG - Intronic
903495234 1:23761874-23761896 TTTTCTTTCTGGGAAGCGGGAGG + Exonic
903709981 1:25316272-25316294 TTCTCTTGGGGCAAGGTGGGTGG - Intronic
903717133 1:25376134-25376156 TTCTCTTGGGGCAAGGTGGGTGG + Intronic
905150091 1:35920427-35920449 CTTTCTTTGGGGAATGGGGTGGG + Exonic
905937422 1:41835918-41835940 TTTCTTTTGGTGAAAGTGTGAGG - Intronic
906237990 1:44223301-44223323 TATGCTTTGGGGGTAGTGGGTGG + Intronic
906262617 1:44405793-44405815 TTTTATTTGGGGAGGGGGGGAGG + Intronic
906414393 1:45608956-45608978 GTTGCCTTGGGGAAGGTGGGGGG - Intronic
907060225 1:51414644-51414666 TTTTCTTTGGGGTATGAGGGAGG - Intronic
907953092 1:59202855-59202877 TTTGCTTTGAGGAAAAAGGGTGG - Intergenic
910178951 1:84460562-84460584 TTTTTTTGTGGGGAAGTGGGTGG - Intergenic
910490125 1:87759845-87759867 TGGTGTTTTGGGAAAGTGGGTGG + Intergenic
911950732 1:104170866-104170888 CTTTCTTTGAAGAGAGTGGGTGG + Intergenic
913016855 1:114745953-114745975 GTTCCTTTGGGGAGAGGGGGTGG + Intronic
915320604 1:155054015-155054037 TTGGCTTAGGGGAAAGAGGGAGG + Intronic
915740682 1:158116261-158116283 TTAGCTCTGGGGAAAGAGGGAGG + Intergenic
915873836 1:159591083-159591105 TTAACTTAGGGGAAAGTGAGAGG - Intergenic
916412202 1:164557716-164557738 TTTTCATTGGGCAAAGTGAGAGG - Intronic
916621162 1:166499059-166499081 TTTTCTTTGAAGAAAGTCAGTGG - Intergenic
917018772 1:170563410-170563432 TTTTCTCTGAGGGAAGTGGTGGG - Intergenic
917151312 1:171947923-171947945 TTTTCTGTTGGGAAAGTGAGGGG + Intronic
918456336 1:184720797-184720819 GTTTTTTTGGGAAAAGTGGGAGG - Intronic
918892577 1:190294955-190294977 TCTGCTTGAGGGAAAGTGGGAGG - Intronic
919797512 1:201330215-201330237 TTTTCCTTGGGGAAACTGGCAGG + Exonic
920001346 1:202801864-202801886 GTCTCTTTGGGGTGAGTGGGTGG - Intronic
922188857 1:223299427-223299449 TTGTTTTTGGGGGGAGTGGGAGG + Intronic
923105143 1:230848731-230848753 TTTCCTTTGGGGAAAGCAGTGGG - Intronic
924005509 1:239606271-239606293 TTTTTTTTGGGGAGGGTGCGGGG + Intronic
924019803 1:239769144-239769166 TGTTCTATAGGGAAAGTGGCAGG + Intronic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
924563860 1:245179827-245179849 TTTGCTTTGGAGACAGAGGGTGG + Intronic
1062784304 10:249378-249400 TTTTATTTGGGCAAAGTGGCTGG + Intronic
1063567799 10:7186715-7186737 TTTTCTTTGGTGCAAATGGGAGG - Intronic
1063660498 10:8032566-8032588 TTTTCTTTGGTGCACATGGGAGG + Intergenic
1063874694 10:10461835-10461857 CTTTTTTTGGGGATGGTGGGAGG - Intergenic
1064239696 10:13615066-13615088 TTTTCTTTGAGAAAACTGGCTGG - Intronic
1064354016 10:14601833-14601855 TTTTCTTTGGGAATGGTGGAGGG - Intronic
1064952589 10:20870572-20870594 ATTTCCTTGGGGATGGTGGGTGG + Intronic
1065403232 10:25330950-25330972 TTTACTTTGGAGAAAGGGTGTGG + Intronic
1065747996 10:28859306-28859328 TTTTTTTTGGGGGGGGTGGGGGG + Intronic
1067390529 10:45858887-45858909 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
1069135731 10:64762850-64762872 TTTTCTTTGCAGAATGTGTGTGG - Intergenic
1069404277 10:68081667-68081689 TTTTCTTTAGGGTAATTGAGAGG - Intergenic
1069580444 10:69562599-69562621 TTTTCTTTCTGGGAAGTGGGCGG - Intergenic
1070107603 10:73450159-73450181 TTTTCTTTGGGGAAAGAGAGCGG - Intronic
1070134522 10:73680585-73680607 TTTTTTTTGGGGGGGGTGGGTGG + Intronic
1070956788 10:80469134-80469156 TTATCTTTGGGGCATGGGGGTGG + Intronic
1071151015 10:82634696-82634718 AGTTCTTTGGGGAAAGTGTAAGG + Intronic
1072696641 10:97608939-97608961 TTTTGTTTGGGTAAAGTGATGGG + Intronic
1072746006 10:97939618-97939640 TTTTCTTGGGGGATTGTGAGAGG - Intronic
1073059015 10:100722377-100722399 GCCTTTTTGGGGAAAGTGGGGGG + Intergenic
1073345778 10:102781862-102781884 TTTTTTTTGGGGGGGGTGGGGGG + Intronic
1073553238 10:104422905-104422927 CTTTCTTTGGGGAGATTGAGTGG + Intronic
1074204510 10:111271235-111271257 TTTTCCTAGGGAAATGTGGGAGG + Intergenic
1075300345 10:121316708-121316730 TTTTCTGTAGGAAAAATGGGAGG + Intergenic
1076785438 10:132747395-132747417 TGTGCTTTGGGGATAGCGGGTGG + Intronic
1077196147 11:1281371-1281393 TTTTCACTGAGGAAAGTGGACGG + Intronic
1077879844 11:6340477-6340499 TTTCCTTGGGGGAAAATGAGGGG - Intergenic
1078137084 11:8660424-8660446 TTCTGTCTGGGGAAATTGGGTGG - Intronic
1078178551 11:8989617-8989639 GTATCTTTGGGAAAAGTGGAGGG + Intronic
1078312307 11:10257259-10257281 TTTTTTGTGGGGAAAGAGGTAGG - Intronic
1079137148 11:17781954-17781976 TTTTATTTGGGGAGGGGGGGTGG + Exonic
1080134298 11:28836386-28836408 TTTTCTTTTGTGAAAGAAGGAGG + Intergenic
1080285126 11:30602163-30602185 TTTTCTTAAGGGAAAGAGGCAGG - Intergenic
1080593115 11:33740761-33740783 TGTTCTTGGGGGAAAATGGATGG + Intergenic
1080696036 11:34603738-34603760 TTGCCTTCGGGGAAAGTGTGGGG + Intergenic
1080716942 11:34812051-34812073 TTTTCTTTGGGGAGTTGGGGAGG - Intergenic
1081567648 11:44269889-44269911 TTTTCTGTGGGGGAAGCTGGGGG + Intronic
1081826962 11:46064262-46064284 ATTTGTTTGGGCAAAGTGGGAGG + Intronic
1082194693 11:49287902-49287924 TTTTCTCTGGGGTGAGTGGCAGG + Intergenic
1082636672 11:55603574-55603596 TTGTCCATGGGGAAAGTGGTCGG + Exonic
1082688086 11:56264392-56264414 ATTTCACTGGGGATAGTGGGTGG - Intergenic
1082716681 11:56622581-56622603 TTCTGTGTGGGGAAAGTGCGAGG - Intergenic
1082867652 11:57914356-57914378 TTTTTTTTGGGGGAAGGGGCGGG + Intergenic
1083196770 11:61092816-61092838 TTTTCTTTGGGTAAGGAGGTGGG + Intergenic
1083244771 11:61418296-61418318 TTTTCTTTTGCTACAGTGGGAGG - Intronic
1086671439 11:89553026-89553048 TTTTCTCTGGGGTGAGTGGCAGG - Intergenic
1088055809 11:105575870-105575892 TTTTTTTTGGGGGGAGGGGGAGG - Intergenic
1088090626 11:106035145-106035167 TTTGCTTAGGGGGAAGTTGGGGG + Intergenic
1088946176 11:114515438-114515460 TTTCCTTTGAGGAAACTGAGAGG + Intergenic
1089047935 11:115519957-115519979 TTTTACTTGGGGAAATTGAGAGG - Intergenic
1090562336 11:127946029-127946051 TTTTTTTTGGGGGGAGTGCGGGG - Intergenic
1091011536 11:132005853-132005875 TTTTCTTTAGGGAAACAGGAGGG - Intronic
1091358726 11:134957869-134957891 CTCTCTTTTGGGAAAGTGAGAGG - Intergenic
1091734057 12:2904659-2904681 TTTTCTTTGAGAAAAATGAGAGG + Intronic
1091981018 12:4864062-4864084 TTTTCTTCGGGGAGAGTTGAGGG - Intergenic
1092068117 12:5609339-5609361 TTTTCTTTGGGGAGGATTGGCGG - Intronic
1092185118 12:6473114-6473136 TTTTTTCAGGGGAAAGTTGGTGG - Intergenic
1093160146 12:15737424-15737446 TTTTCTTTGTAGAAAGGAGGAGG - Intronic
1094564185 12:31584830-31584852 TTTTTTTCGGGGAGGGTGGGTGG - Intronic
1095200750 12:39380952-39380974 TGTTCTTTGGGGAAAGGGAAGGG + Intronic
1095669610 12:44843138-44843160 TTTTATTTGGGGAAGGGGAGAGG + Intronic
1095704087 12:45219173-45219195 TTTTTTTTGGGGGGAGGGGGAGG - Intronic
1096060559 12:48695488-48695510 TTTTCTGTGTGGAAACTGGTAGG - Intronic
1097014008 12:55972596-55972618 TTTTTTTTGGTCATAGTGGGTGG + Exonic
1098957951 12:76706976-76706998 TTTGCTTTGGGAAAAGTGTTTGG - Intergenic
1099074498 12:78089162-78089184 TTTTTTTTGGGAAAAGGGGAAGG - Intronic
1099569615 12:84300102-84300124 TCTTCTTTGGGGTCAGGGGGAGG + Intergenic
1100008360 12:89921998-89922020 TGTGCTTTGGGGAAAGAAGGTGG + Intergenic
1101128014 12:101659335-101659357 TTTTCTCTTGGGAAAGTTGGTGG + Intronic
1102379001 12:112447294-112447316 TTTCCTCTGGGGAAAGAGGGAGG - Intronic
1102525200 12:113507642-113507664 TTTTCTATCTGTAAAGTGGGAGG + Intergenic
1102934007 12:116881856-116881878 TTTTGTTTGGGGGAGGTGGGTGG + Intergenic
1103800113 12:123532687-123532709 TTTGCTCTGGGGAGACTGGGGGG + Intronic
1104853380 12:131889748-131889770 TTGACTTTGGGAGAAGTGGGGGG + Intergenic
1105825671 13:24120373-24120395 TTTTCTTTGGGGAAGATGTATGG + Intronic
1106546749 13:30737451-30737473 TCTTCTGTGGGACAAGTGGGAGG + Intronic
1106561622 13:30851631-30851653 TTTTTTTGGGGGGAAGGGGGAGG - Intergenic
1107274153 13:38657765-38657787 TTTTTTTGGGGGAGAGGGGGCGG + Intergenic
1107285633 13:38787563-38787585 TTTTGATTGGGGAAAGTGGAAGG - Intronic
1107379292 13:39838715-39838737 ATTTCTTTGAGGAAAGTCAGTGG - Intergenic
1108406473 13:50108114-50108136 TTTTTTTTGGAGAAAGGGAGGGG - Intronic
1108439575 13:50436951-50436973 GTTTCCTTGGGGATGGTGGGGGG - Intronic
1109119699 13:58439009-58439031 TTTTCGTGGGTGAAAATGGGCGG + Intergenic
1110317902 13:74132809-74132831 TTATCTTTGGGGAAAAGGGTGGG - Intronic
1111151029 13:84253862-84253884 ATTTCTTTGGGGAAAATGGAAGG - Intergenic
1111558571 13:89913265-89913287 TTGTCTTTGGTGGAAGTGGGGGG + Intergenic
1111742590 13:92222631-92222653 TTTTCTTTGGGGTGTGTGTGTGG + Intronic
1111993282 13:95137968-95137990 TTTTCTTTGGGGAAAGTGGGCGG + Intronic
1113226495 13:108165399-108165421 TTTTCTGTGATAAAAGTGGGAGG + Intergenic
1114487186 14:23069799-23069821 TTTTCCTTGGGGAAAGAGCGTGG + Intronic
1115475506 14:33809523-33809545 TTTTGTTTGGGGGAGGTGGGGGG - Intergenic
1115661069 14:35494678-35494700 TTCTGTTTGGGGAAAAGGGGAGG + Intergenic
1115782187 14:36782418-36782440 TTTTCTTTGGGGTCAGTGACTGG + Intronic
1116113087 14:40612067-40612089 TTTTCTTTGTTGAAAGTGCCTGG - Intergenic
1116491146 14:45504644-45504666 TTTGCTTGGAGGAAAGTGGAAGG + Intergenic
1116563776 14:46418734-46418756 CTTCCTTTGGGGCCAGTGGGAGG + Intergenic
1117553201 14:56856912-56856934 TTTTGTGTGGGGAAAGGTGGAGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118706377 14:68484248-68484270 TTTGCTTTAGGGAGAGTGAGTGG - Intronic
1119691558 14:76676792-76676814 TTTTTTTGGGGGGGAGTGGGTGG - Intergenic
1121052484 14:90828514-90828536 TTTTCTTTAGTAAAAGTGGAGGG + Intergenic
1122124621 14:99572309-99572331 GTTTCCTTGGGGAAAGTAGCGGG - Intronic
1122396164 14:101433666-101433688 TAATCTTAGGGGAAACTGGGTGG + Intergenic
1122724672 14:103742350-103742372 TATTCTCTTGGGAATGTGGGTGG - Intronic
1123055246 14:105566380-105566402 TTTGCATTGGGGGAGGTGGGGGG - Intergenic
1123079695 14:105686224-105686246 TTTGCATTGGGGGAGGTGGGGGG - Intergenic
1123419233 15:20118048-20118070 TTTTCTTTGAGGGTAGAGGGTGG + Intergenic
1123446632 15:20335451-20335473 TTTTCTTTGAGGGTAGAGGGTGG - Intergenic
1123528455 15:21124591-21124613 TTTTCTTTGAGGGTAGAGGGTGG + Intergenic
1124098642 15:26672451-26672473 TCTTCTTAGGGGAAAGAGAGAGG - Intronic
1124983766 15:34585352-34585374 TTTTCTTTGGGGTAAGTGACTGG - Intronic
1125547823 15:40520128-40520150 TTTCCTTGGAGGAAACTGGGAGG + Intergenic
1125642862 15:41246224-41246246 TCTTCTTTGTAGAAAGTGGGTGG + Intronic
1125745330 15:41993766-41993788 CTTGCTTTTGGGAAGGTGGGAGG + Intronic
1126207095 15:46058178-46058200 TTTTCTTGGGGCAAGGGGGGAGG - Intergenic
1126653258 15:50948488-50948510 TGCTTTTTGGGGAAAGTGGAGGG + Intronic
1126909705 15:53404693-53404715 CTCTCTTTGGGGAAAGAGGACGG + Intergenic
1127658624 15:61079117-61079139 TTTTCTTTTGGGAAATTAGGAGG - Intronic
1128093655 15:64936249-64936271 TTTACATGGGGGAAAATGGGAGG - Intronic
1128103238 15:65023110-65023132 TTTTCTAAGGGGAAATTAGGTGG + Intronic
1128150844 15:65362658-65362680 TTGTCTTTGTGGAAAATGGGAGG - Intronic
1128903394 15:71446026-71446048 TTTTCTTTTGGGAGAGTTGAAGG - Intronic
1129290123 15:74559348-74559370 TTTTCTTTGGGGAAGAAGCGAGG + Intronic
1129386336 15:75198200-75198222 TTTTCTCTGGAGGTAGTGGGGGG + Intronic
1129830512 15:78666821-78666843 TTTTCCTTGGGGTAAGTGCCTGG + Intronic
1130670179 15:85905188-85905210 TTTACTTTGGGGAAAAAAGGAGG + Intergenic
1130910720 15:88269090-88269112 TTTTCATTGGGGAGAGTCAGAGG + Intergenic
1131403642 15:92145971-92145993 TGTTCTGTGGGGAGAGGGGGAGG + Intronic
1132242923 15:100274879-100274901 TTTTCTTTGGGGTTACTGTGGGG + Intronic
1132370739 15:101295896-101295918 TTGCCTTTTGGGAAAGAGGGAGG - Intergenic
1132447833 15:101942736-101942758 TTTTCCTAATGGAAAGTGGGGGG - Intergenic
1132936336 16:2483166-2483188 CTTTCTTGGGGTAGAGTGGGTGG + Intronic
1133041957 16:3065596-3065618 GGTTTTATGGGGAAAGTGGGGGG - Exonic
1133122973 16:3623037-3623059 TTTTTTTGGGGGGACGTGGGGGG - Intronic
1133462630 16:6000423-6000445 TTTCCTTTGAGGAAAGGGGCAGG + Intergenic
1134164416 16:11918533-11918555 TTTTCTTAGGGGTGGGTGGGTGG - Intergenic
1134176973 16:12014972-12014994 TTTTTTTGGGGGAGAGGGGGAGG + Intronic
1134517156 16:14896517-14896539 TTTTGTTTGGCCAAAGTGTGTGG - Intronic
1134537956 16:15041594-15041616 TTTGCTTTGGGGCAAATGGCAGG + Intronic
1134704824 16:16295171-16295193 TTTTGTTTGGCCAAAGTGTGTGG - Intergenic
1134962718 16:18416943-18416965 TTTTGTTTGGCCAAAGTGTGTGG + Intergenic
1134967013 16:18499542-18499564 TTTTGTTTGGCCAAAGTGTGTGG + Intronic
1135244101 16:20839577-20839599 GGTTCTTTGGGGAAGGTGTGTGG + Intronic
1135349029 16:21713330-21713352 TTTACTTTGGGGAATGTGGTTGG - Intronic
1136504608 16:30694964-30694986 TTTTTTGTAGTGAAAGTGGGAGG - Intergenic
1137030277 16:35517544-35517566 TTTTCTTTGGGTGTTGTGGGTGG - Intergenic
1137423243 16:48354072-48354094 TTTTTTTTGGGGGGGGTGGGGGG + Exonic
1137543016 16:49377657-49377679 TTCTCCTTGGGGAAAGGGAGGGG + Intronic
1138140774 16:54566787-54566809 ATTTCTGTGGGGAAAGTAGGGGG - Intergenic
1138973373 16:62173137-62173159 TTTTGTTAGGGGAAAGTTGTAGG - Intergenic
1139309049 16:66012858-66012880 ATTTCTTTGGGGAAATTTGCCGG - Intergenic
1140034309 16:71360952-71360974 TTTTCTTTGGGGGAATGGGAGGG - Intronic
1140202653 16:72906837-72906859 TTTTCTTTGAGCAAAATGGTAGG + Intronic
1140586042 16:76292980-76293002 TTTTCTTTTTTGAAAGTGGCTGG - Intronic
1141501696 16:84449199-84449221 TTCCCTTGGGGGAAAGTGAGAGG + Intronic
1141777800 16:86135854-86135876 TTTCCTGTGTGCAAAGTGGGCGG - Intergenic
1142874684 17:2844469-2844491 TTTTCCTTATGGAAAGGGGGTGG + Intronic
1143721680 17:8816034-8816056 TTATCTGTGAGGAAACTGGGTGG - Intronic
1143734522 17:8901108-8901130 TTGTTTTGGGGGACAGTGGGAGG + Intronic
1143825949 17:9607461-9607483 TTTTCTTTGGAGAGAATGGTGGG + Intronic
1143874543 17:9981768-9981790 TCTGCTTTGGGGCAACTGGGAGG - Intronic
1144590142 17:16516775-16516797 CTTTCTTTGGGAGGAGTGGGAGG + Intergenic
1147043897 17:37738923-37738945 TGTTCTTGGAGGATAGTGGGAGG - Intronic
1147513786 17:41097122-41097144 TTTTCTTTTGGAAAGGTAGGAGG - Exonic
1148010273 17:44473967-44473989 GTTTCTTAAGGGGAAGTGGGGGG + Intronic
1148740198 17:49888336-49888358 GTCCCTTTGGGGTAAGTGGGAGG + Intergenic
1148852864 17:50563081-50563103 TCTGCTTTGGGGAAGGGGGGTGG + Intronic
1149114983 17:53082512-53082534 TATTCTTTAGGGAGAGTGTGTGG + Intergenic
1149344171 17:55717532-55717554 TTCTCTTTAGGGATGGTGGGGGG + Intergenic
1150535445 17:66034521-66034543 TTTTCTTTAGGCAAAGTCTGTGG - Intronic
1150989497 17:70239572-70239594 TTGTCTTTAGGGAAAGTAGCAGG - Intergenic
1151169051 17:72231090-72231112 TCTTCTTTTGAGGAAGTGGGTGG + Intergenic
1151369942 17:73641581-73641603 TTTTTTTTGGGGATGGGGGGTGG - Intronic
1151689421 17:75672586-75672608 TTTTCTTTGGGGGTACAGGGGGG - Intronic
1152140795 17:78535195-78535217 CCTGCTTTGGGGACAGTGGGAGG + Intronic
1152251545 17:79215146-79215168 TTGGCTCTGGGGGAAGTGGGAGG + Intronic
1153572495 18:6487237-6487259 TTCTCCTTGGGGAAAGAGTGGGG - Intergenic
1153792917 18:8596103-8596125 TTTTCTCAGAGGAAAGAGGGTGG - Intergenic
1154079780 18:11244779-11244801 TTTTCTTGAGGGAGATTGGGAGG - Intergenic
1154496234 18:14963350-14963372 CTCTCTTTCGGGAAAGTGAGAGG + Intergenic
1155165297 18:23227253-23227275 AATTTTCTGGGGAAAGTGGGTGG - Intronic
1155821170 18:30379683-30379705 TCTTTTTTGGGGGAAGTTGGTGG - Intergenic
1155873516 18:31055993-31056015 AGGTCTCTGGGGAAAGTGGGTGG + Intergenic
1155978494 18:32157179-32157201 TTTTATTTGGGTAAAAAGGGAGG + Intronic
1157191927 18:45588954-45588976 TTTTGTTTGGGGTTGGTGGGTGG + Intronic
1157623518 18:49029734-49029756 TGTTCTTTGGGGAGGGTGTGTGG + Intergenic
1158178060 18:54679852-54679874 TTTTATTTGGGGCAAGTAGGGGG + Intergenic
1158892503 18:61886008-61886030 TTTTTTGTGGGCAAAGTAGGAGG + Intronic
1158898602 18:61939735-61939757 TTTTTTTTGGTGGAAGGGGGAGG - Intergenic
1159424901 18:68272411-68272433 TTTTCTATGTGGGAGGTGGGGGG + Intergenic
1160148248 18:76381124-76381146 CGTTCCTTGGGTAAAGTGGGAGG - Intronic
1160637442 19:89797-89819 TTTTCCTAATGGAAAGTGGGGGG + Intergenic
1163864614 19:19762384-19762406 TTTTCTTTGGGGAAAAGAGGGGG - Intergenic
1166816084 19:45547065-45547087 TTTCCTATGGGGAAGGAGGGAGG + Intronic
1167244686 19:48365811-48365833 TTTCCTTTGGGGCCACTGGGAGG - Exonic
1167414375 19:49362438-49362460 CTTTGTTTGGGAAAAGTGGGAGG + Intronic
1168406278 19:56112206-56112228 TTTTCTTGAGAGCAAGTGGGGGG - Intronic
1168582108 19:57564186-57564208 TTACTTTTGGGGAAAGTGGCTGG + Intergenic
925241339 2:2332429-2332451 TTTTCTTTTGGGACAGGGTGGGG + Intergenic
925654947 2:6136671-6136693 TATACTTTGGAGAAAGTGGAAGG - Intergenic
925962758 2:9033892-9033914 TTTTTTGTGGGGGATGTGGGGGG - Intergenic
926021159 2:9496826-9496848 TTTTGTTGGGGGTGAGTGGGTGG - Intronic
926841468 2:17085415-17085437 TCTTCTTAGGTGAAAGTGGGTGG - Intergenic
927190363 2:20513030-20513052 TGTTGTTTGGGGAAACGGGGAGG - Intergenic
927608608 2:24513274-24513296 TTTCCTCTGGGGAATGTGGAAGG - Intronic
927814970 2:26207210-26207232 TTTTGTTAGGGGAAAGGGGTGGG - Intronic
928453856 2:31401770-31401792 TTCTCTGTGGGGAAAGGGGGAGG + Intronic
928627344 2:33153893-33153915 TTTTCCTTTAGGAAACTGGGGGG + Intronic
928704681 2:33935511-33935533 TTTTCTATAGGGAAAGAGGTGGG + Intergenic
928957844 2:36889611-36889633 TTTTTTTTGGGGGGGGTGGGGGG + Intronic
929474058 2:42227495-42227517 TTTTCTTTGTGGAAGAGGGGTGG - Intronic
929921622 2:46176120-46176142 TTCTCTTTGGGGAAAATTGGAGG - Intronic
930048131 2:47191991-47192013 TCCTCTTGGGGGAATGTGGGAGG + Intergenic
930457751 2:51628222-51628244 TTTTTGTTGGGGGAGGTGGGGGG + Intergenic
930886362 2:56331554-56331576 TTTGCTTTGGGAAGATTGGGGGG + Intronic
931125179 2:59267447-59267469 TTTTCTTTTGGGAAAGAAGATGG - Intergenic
931186699 2:59959381-59959403 TTTATTTAGGGAAAAGTGGGGGG - Intergenic
931551220 2:63449373-63449395 CCTTCTTTCTGGAAAGTGGGGGG - Intronic
931603565 2:64028954-64028976 TTTCCTTTGGGGACAGTGAGAGG - Intergenic
931959235 2:67463676-67463698 CTTTCTTGTGGGAAAGTGGCTGG - Intergenic
932190523 2:69738297-69738319 TTTTCTTTGGGGAATCTAAGAGG - Intronic
932395135 2:71439473-71439495 TTTTATATGGGGAAAGTTGGGGG + Intergenic
933463572 2:82621259-82621281 TTGTCTTTGATAAAAGTGGGGGG + Intergenic
933863499 2:86494671-86494693 TTTTATTTGTGTAAAGTGGGTGG + Intergenic
934734632 2:96683655-96683677 TTTTCTTTGGCGACTATGGGAGG - Intergenic
935887278 2:107635872-107635894 TTTTCTTTTGGTAAAGATGGCGG + Intergenic
936078899 2:109418937-109418959 TGCTCTCTGGGGACAGTGGGGGG - Intronic
936173703 2:110199614-110199636 TTTTTTTGGGGGGATGTGGGGGG - Intronic
936989980 2:118352997-118353019 TTTAGAGTGGGGAAAGTGGGAGG - Intergenic
937022210 2:118668197-118668219 TTTGCCTTGGAGAAAGTGAGTGG - Intergenic
937880200 2:126858888-126858910 TTTTCTCTGGGGCAGGAGGGAGG - Intergenic
937915141 2:127095259-127095281 CTTTCTTTGTGGGAGGTGGGAGG + Intronic
938045287 2:128113612-128113634 TTTTATTTGGTGGAAGGGGGAGG + Intronic
939388267 2:141530964-141530986 TTTTTTCTGAGTAAAGTGGGAGG + Intronic
939791348 2:146581590-146581612 TTTCCTTTTGGGAAGGTGGCTGG + Intergenic
939833392 2:147099518-147099540 TTCTTGTTGGGGAAAGTGGTTGG - Intergenic
942483180 2:176411425-176411447 TTTTCTTTGGAGATCTTGGGTGG - Intergenic
943253888 2:185568127-185568149 TGTGCACTGGGGAAAGTGGGTGG - Intergenic
945325160 2:208473191-208473213 CTTTCTTTGGGGGTAGGGGGAGG + Intronic
946434957 2:219645158-219645180 TTTACTTTGGGCAAAGAGGGCGG + Intergenic
946726636 2:222667707-222667729 TTTGCTCTGGGGAAAGTTGCAGG - Intergenic
946815096 2:223568880-223568902 TTTTCTTTGGGCTGAGTGGGAGG - Intergenic
947867578 2:233410246-233410268 TTCTCTTTGAAGAAAGAGGGGGG + Intronic
947931630 2:233969593-233969615 TGTATTTTGGGGAAAGTGTGGGG + Intronic
1169786883 20:9368852-9368874 TTTCTTTTGGGGAATGGGGGTGG + Intronic
1170195095 20:13681344-13681366 TTAGTTCTGGGGAAAGTGGGTGG - Intergenic
1170364049 20:15580796-15580818 TCTTCTTAGGGGAAAGGGGAGGG + Intronic
1170795918 20:19546610-19546632 TTTTTTGAGGGGAAAGGGGGTGG + Intronic
1171430509 20:25081026-25081048 ATTTCTTTGGGGAAATGGGTAGG + Intronic
1171459084 20:25288518-25288540 TTTGGTCTGGGGATAGTGGGTGG + Intronic
1173259760 20:41423214-41423236 TATACTTTGGAGAAAGTGGTTGG + Intronic
1173623155 20:44451744-44451766 TTTTTTTTGGGGGGGGTGGGGGG - Intergenic
1173748661 20:45458384-45458406 TTTTCTTTGCAGGATGTGGGCGG - Intergenic
1174515785 20:51091449-51091471 TTTTCTTTCGAAAAAGGGGGAGG - Intergenic
1175145053 20:56889639-56889661 TTTCCTTTGGAGAAAGTGCTGGG - Intergenic
1176125742 20:63473696-63473718 TTTCCTTGGGGGCAAGTGCGCGG + Intergenic
1176255237 20:64148496-64148518 TTCTCTGTGGGGAAATTGTGAGG + Intergenic
1177471841 21:21569920-21569942 CTTTATTTTGGGAAAGTGGGGGG - Intergenic
1179002694 21:37477857-37477879 TTTTCTTTGGGCTAATTGTGTGG + Intronic
1179026710 21:37684628-37684650 TTTTCTTTTGCTAAAGTGGGTGG + Intronic
1179053009 21:37905314-37905336 TTTGATTGGGGGCAAGTGGGAGG - Intronic
1180914101 22:19473316-19473338 CTTTTTTTGGAGAAAGTGAGGGG - Intronic
1181158994 22:20945486-20945508 TTTTATTTGGGAAAGGTAGGGGG - Intronic
1181931014 22:26401749-26401771 TTTCCTTTGAGGAAAGAGAGAGG + Intergenic
1182049882 22:27304555-27304577 CTTTCTTTTATGAAAGTGGGAGG - Intergenic
1182166715 22:28182144-28182166 TTTTACTTGGGGGAAGTGGAGGG + Intronic
1182325982 22:29513383-29513405 TCTTTTTTGGGGACAGGGGGAGG - Intronic
1183104479 22:35606484-35606506 TTCTCTTCGGGGGAGGTGGGAGG - Intergenic
1183534493 22:38389911-38389933 TTTTTTTTTGGGCAAGAGGGGGG - Intronic
1184489781 22:44801834-44801856 TTTTCTATCTGTAAAGTGGGGGG + Intronic
1185183355 22:49377380-49377402 TTTTCTTTGTGGAGAGTAGAGGG - Intergenic
949416487 3:3820394-3820416 TTTTCTTTAGGGAATATGGTGGG + Intronic
949910499 3:8902196-8902218 ATTACTATGGGGAAAGTGGTTGG - Intronic
950270199 3:11608429-11608451 TCTTCTTTGGGGAAATTTGAAGG - Intronic
950291030 3:11784619-11784641 TTTTCTATGAGGAGAGTGGGTGG + Intergenic
950677941 3:14565780-14565802 TTTTCTATGGGCCAGGTGGGAGG - Intergenic
951366488 3:21789213-21789235 TTATCTTTGGAGAATGGGGGAGG + Intronic
952841768 3:37652509-37652531 TTTTCTTTTGGAAATGTGGCAGG + Intronic
952899786 3:38102460-38102482 TTTTCTTGGGGGAATCTGAGAGG - Intronic
953021959 3:39120294-39120316 CCTTATTTGGGGAAAGCGGGTGG + Intronic
953063352 3:39446638-39446660 TCTCTTTTGGGGAATGTGGGAGG + Intergenic
953967524 3:47321159-47321181 TTTTTTTTGGGGGGAGTGGAGGG + Intronic
954210200 3:49092936-49092958 TTTTCTTTTGCGTAAGTGGGAGG - Intronic
954213796 3:49112960-49112982 TTTTCTTAGGGGTAAGAGTGGGG - Intronic
955077546 3:55627898-55627920 TTTTTTTTGAAGAAAGGGGGCGG + Intronic
955195203 3:56799472-56799494 TTTTCTTTGTGGAAAGAATGTGG - Intronic
955282272 3:57604610-57604632 TTTTTTTTGGGGGGGGTGGGTGG + Intergenic
955657261 3:61258045-61258067 TTTTGTTGGGGGAGAGTGGTAGG - Intergenic
956362349 3:68461935-68461957 GTTTATTTAGGAAAAGTGGGGGG + Intronic
957195844 3:77066824-77066846 TTTTCTTTGGAGAAAATAGAAGG - Intronic
957233393 3:77551162-77551184 TCTTCTTTGGGGAAAATAAGTGG - Intronic
958712377 3:97732991-97733013 CTCTCTGTGGGGACAGTGGGAGG - Intronic
959276067 3:104278745-104278767 TTTTTTTTGGGGGGAGAGGGAGG - Intergenic
959496001 3:107052629-107052651 TATGTTTTGGGGAAAGGGGGAGG - Intergenic
959595168 3:108121799-108121821 TTTTCTTGGGGGTAGGTAGGAGG - Intergenic
960384032 3:116998478-116998500 TTTTCTGGGGTGAGAGTGGGAGG - Intronic
960908436 3:122624434-122624456 TCTGCTCTGGGGAAACTGGGAGG + Intronic
961925913 3:130480448-130480470 AATTCTATGGGGAAAGTGGAAGG + Intronic
962733217 3:138301765-138301787 ATTTCTTTGTGGATGGTGGGTGG - Intronic
962784292 3:138752308-138752330 TTTTCTTTGGAGAGAGGAGGTGG + Intronic
963829376 3:149990567-149990589 TTCTTTTTGGGGATAGAGGGTGG - Intronic
964483246 3:157162421-157162443 TTATCATTGGGGAAAGTTGGAGG + Intergenic
966011729 3:175087221-175087243 TTGACTTTGAGGAAGGTGGGGGG + Intronic
966310612 3:178589441-178589463 TTTTCCTTGGGGGGAGGGGGAGG + Intronic
966312929 3:178615097-178615119 TTTGCTTTGGAGAAAGTAAGGGG - Intronic
966508218 3:180730988-180731010 TATTTTTTGGGGAAAAGGGGTGG + Intronic
967864588 3:194179807-194179829 TTTTTTTTGGGGGGGGTGGGGGG - Intergenic
968327802 3:197835548-197835570 TTTTCTATTTTGAAAGTGGGAGG - Intronic
968619239 4:1596402-1596424 GTACCTTTGGGGAAGGTGGGTGG - Intergenic
970129932 4:12857361-12857383 TTTCCTTTGGGTAAAGAGGAAGG - Intergenic
970221388 4:13815438-13815460 TTGTCTGTGTGGAAATTGGGTGG + Intergenic
970291883 4:14581914-14581936 TTTTCTTTGGGGTCAGTTGCAGG - Intergenic
970454799 4:16212494-16212516 TTTTGTTTGGGGAAAGGAGTAGG - Intronic
970904003 4:21193969-21193991 TTTTCATTGTGTAAAGGGGGAGG + Intronic
971796429 4:31234629-31234651 TGCTCACTGGGGAAAGTGGGTGG - Intergenic
972635553 4:40880969-40880991 TTCCCTTAGAGGAAAGTGGGAGG - Intronic
973790079 4:54370199-54370221 TTTGTTTTGGGGAAATAGGGAGG - Intergenic
973805237 4:54519323-54519345 TGTCCTTTGTGGAGAGTGGGAGG + Intergenic
974982860 4:68982012-68982034 CTTTCTTTTTTGAAAGTGGGGGG - Intergenic
975083249 4:70305763-70305785 TTTTGTTTAGGGAAAATGGCCGG - Intergenic
975168895 4:71210594-71210616 TTTTCCTTGGGGTAAGTGTGGGG - Intronic
975717457 4:77218582-77218604 TTTTCTTCAGGGAAAGCAGGGGG + Intronic
975854492 4:78608742-78608764 TTTTCTTTTGGGGGAGTGGGGGG + Intronic
976714347 4:88107473-88107495 TGTGCTTTGGGGAGAGTGGTAGG + Intronic
976906559 4:90243558-90243580 TTTTATTTTGGGGAGGTGGGGGG + Intronic
977051041 4:92128883-92128905 TTTTCTATGGGGAAATTAAGGGG + Intergenic
977150095 4:93500605-93500627 TTATCTTTGGGGAAAATGAGAGG - Intronic
977211836 4:94227190-94227212 GTGTTTTTGAGGAAAGTGGGAGG + Intronic
977801559 4:101240032-101240054 TTTTTTTTGGGGGGAGCGGGGGG + Intronic
977891657 4:102319228-102319250 TGTCCTTATGGGAAAGTGGGGGG + Intronic
978077602 4:104552603-104552625 TTTTCTTGGGGGAAGGGGGCTGG - Intergenic
978478334 4:109158350-109158372 TTTTAGTTGGGGAGAGTTGGAGG - Intronic
978648211 4:110967416-110967438 TTTTGTTTGGGGGAGGTGGTGGG + Intergenic
978963315 4:114710551-114710573 TTTTCTTTCAGGGAAGAGGGAGG + Intergenic
979116676 4:116832889-116832911 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
979167197 4:117549765-117549787 TTTATTTGGAGGAAAGTGGGAGG + Intergenic
979923709 4:126533301-126533323 TTTTCCTTTGGGAAAGTTGGAGG + Intergenic
980520572 4:133927729-133927751 TTTTCTTTTGGGAGGTTGGGAGG - Intergenic
980838967 4:138233667-138233689 TTTTGTTTGGGGAAGATGGGAGG - Intronic
981585347 4:146295422-146295444 GTTTATTTTGGGAAGGTGGGGGG + Intronic
984438472 4:179734646-179734668 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
985099674 4:186446434-186446456 TTTTCTTTTAGGATAGTGTGTGG - Intronic
986535556 5:8783288-8783310 TTTCCTTTGGGGAAAATGGTTGG - Intergenic
987615552 5:20269366-20269388 TTTCCTTTGGGAAAAGTGGTGGG - Intronic
988715063 5:33817598-33817620 TGTGGTTTGGGGGAAGTGGGTGG - Intronic
989172590 5:38487577-38487599 TATTCTCTGAGGAAAATGGGCGG - Intronic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
991315013 5:65292414-65292436 TTTTCCTTTGGCAAAGTGGATGG - Intronic
991325782 5:65430497-65430519 TATTCTTTGGAGAAACTGGATGG + Intronic
991446737 5:66708184-66708206 TTTTATTTGCGGAAAGAGTGCGG + Intronic
991482666 5:67099845-67099867 TTTTCTTTGGAGGGAGTAGGGGG - Intronic
992205032 5:74422962-74422984 TTCTCTTTGGGACAGGTGGGTGG - Intergenic
992371504 5:76148828-76148850 TATTCCTGGGAGAAAGTGGGTGG + Intronic
992388295 5:76306907-76306929 TGTTCTCTGGGGCAAGTGAGGGG + Intronic
993685490 5:90932336-90932358 TTTTTATTGGGGAAAGTCAGCGG - Intronic
994148399 5:96420560-96420582 TCTTCCTTGGGGAAAATGGGAGG - Intronic
995418633 5:111937652-111937674 TTTCCTTTGGGGAAAATAGATGG - Intronic
995623080 5:114049264-114049286 TTTTTTTTGGTAAAAGTGGAAGG + Intergenic
995892419 5:116969525-116969547 TTTTCTTTGGGAAATATGTGAGG + Intergenic
995912466 5:117204013-117204035 TTGTCTTTTGGGAAAGTCTGTGG + Intergenic
996117396 5:119633639-119633661 TGTTATTTGTGGAATGTGGGAGG - Intronic
997862954 5:137435618-137435640 ATTTCTTTAAGTAAAGTGGGAGG + Intronic
998151012 5:139757522-139757544 TTTTCTTTGGGGGAAGAAGGGGG - Intergenic
998222827 5:140301543-140301565 TTTACTTTGGGGAAGGGGAGGGG + Intronic
999040841 5:148410098-148410120 TTTTCAATGGAGGAAGTGGGAGG + Intronic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
1000131043 5:158299971-158299993 TTTTCTTTCAGGACAGTGGGTGG + Intergenic
1001376203 5:171261076-171261098 TTTTTTTTGGGGGGGGTGGGGGG - Intronic
1002509936 5:179708228-179708250 TTGTCTTGTAGGAAAGTGGGAGG + Exonic
1003128420 6:3374542-3374564 TGTGCTTTGGAGAAACTGGGCGG + Intronic
1003353323 6:5341297-5341319 TTTTCCTGGGAGACAGTGGGTGG + Intronic
1004074296 6:12330965-12330987 ATTTCTTTGGGGAATGAGGTTGG + Intergenic
1004119690 6:12808868-12808890 CTTTCTTTGGGGGCGGTGGGTGG + Intronic
1004147131 6:13078152-13078174 TTTTTTTTGGGGGGAGTGGGTGG + Intronic
1004215312 6:13698144-13698166 TTTTTTGTGGGGGGAGTGGGGGG - Intronic
1004422263 6:15481361-15481383 TTTTAATTGGGGACAGTGTGTGG + Intronic
1004736918 6:18416069-18416091 GTTTCTTTGGAGAAAGTAGAAGG + Intronic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1005413927 6:25581483-25581505 TCTTCTCTGGGGAAAGTTGGAGG + Intronic
1006269404 6:32952244-32952266 TTGTGTCTGGGGATAGTGGGAGG - Intronic
1006298747 6:33181938-33181960 TTTTATTTGGGGTAAGAGGAGGG + Intronic
1007787037 6:44286529-44286551 TTTTCTTTGGGAACAGAGGAAGG + Exonic
1007994989 6:46297508-46297530 CTTTCTTTAGGCAAAGCGGGGGG - Intronic
1008022317 6:46593861-46593883 TTTTCTATGGACAAAGTAGGAGG - Intronic
1008278655 6:49570188-49570210 ATTTCTTTGGGGAAGGTAGGTGG - Intergenic
1008929386 6:56922352-56922374 TTTACTTTGGGCAATGTGGTTGG + Intronic
1010849909 6:80760533-80760555 TTAGCTTTGGGGAAGGTGAGGGG + Intergenic
1010961387 6:82149816-82149838 TTTTTGGTGGGGAGAGTGGGAGG - Intergenic
1011968390 6:93189719-93189741 TTTTCTGTTGGGAAAGTGGGGGG - Intergenic
1012420600 6:99060731-99060753 TTTTGTTTTGGAAAAGTTGGAGG + Intergenic
1012565975 6:100652397-100652419 GTTTATTTGGGGAAAGACGGGGG + Intronic
1013189738 6:107792012-107792034 TTTACTTTGGGGGAAGGGGAGGG + Intronic
1013230290 6:108156604-108156626 GTTTCTTTGGGGAAGGAAGGAGG - Intronic
1013335899 6:109160961-109160983 ATTGCTTTGGGGAAATTGTGAGG + Intronic
1014368438 6:120575032-120575054 ATTTCTTTGGTCAAAGTAGGTGG - Intergenic
1014884164 6:126759330-126759352 TTTTCTTCAGGGAAAGAGAGTGG - Intergenic
1015959216 6:138630208-138630230 TTTTTTTTGGTGGGAGTGGGCGG - Intronic
1016416837 6:143842629-143842651 TTTTCTTGGACGAAAGTGTGTGG - Intronic
1016757590 6:147703590-147703612 TTTTATTTGGGAGAAGTGGGTGG + Intronic
1017443320 6:154484760-154484782 TTTTCTTTGGGGGAGGGGGAAGG - Intronic
1017599403 6:156064274-156064296 TTTTTTTTGGGGGGAGGGGGTGG - Intergenic
1018182134 6:161233281-161233303 TTTCCTTTGAGGAAAATGGCAGG + Intronic
1019888787 7:3928623-3928645 TTTTTTTTGGGGGGGGTGGGTGG + Intronic
1020970134 7:14926505-14926527 TTTTTTTAGTGGTAAGTGGGAGG + Intronic
1021512682 7:21451466-21451488 AGTTCTTTGGGGAAAATGGATGG + Intronic
1021795527 7:24250312-24250334 TTTTCTGTGGGGAAAAGTGGAGG - Intergenic
1023287190 7:38631747-38631769 TTGTATTTGGGGAGAGTGAGGGG + Intergenic
1023334640 7:39155436-39155458 TTATTTTTGGGAAAAGAGGGAGG + Intronic
1023354140 7:39350359-39350381 CTTTCCTTGGGGGAAGTGAGAGG - Intronic
1023627465 7:42130185-42130207 TTTCCTTTAGGGAAATAGGGTGG - Intronic
1024128559 7:46326159-46326181 TTTTTTTTGGGGGGGGTGGGGGG - Intergenic
1024284306 7:47744217-47744239 TTTTCTTTGGGGGGAAAGGGAGG - Intronic
1024544968 7:50509333-50509355 TTTTCTTTGAGGAAGATGGAAGG - Intronic
1025780326 7:64595726-64595748 TTTTTTTTGGGGGAAGTGGGGGG - Intergenic
1026098779 7:67367900-67367922 CTTTGGTTGGGCAAAGTGGGAGG + Intergenic
1026457131 7:70582485-70582507 ATTTCTTTGGGCAACGTGGTGGG - Intronic
1027484943 7:78749813-78749835 TTTTCTTTGGAGGAAGTAGCAGG - Intronic
1027749632 7:82126553-82126575 AATTCTTTGAGGAAATTGGGCGG - Intronic
1027897090 7:84058880-84058902 TTTTCTTTGTGGACTTTGGGTGG + Intronic
1028605953 7:92656060-92656082 TTTCCTATGGTTAAAGTGGGAGG + Intronic
1030821197 7:114094031-114094053 TTTTTTATGGGGAAAGATGGAGG + Intronic
1031097434 7:117437232-117437254 TTTCGTTGGGGGAAAGTGGGTGG + Intergenic
1031429013 7:121643086-121643108 ATTTATTTGGGGTAGGTGGGTGG + Intergenic
1031961344 7:127992912-127992934 TTTTCTTTGGGGAAACTCTTTGG + Intronic
1032980548 7:137277398-137277420 TTTTTCTTGGGAAAAGTGGCTGG - Intronic
1034974515 7:155440041-155440063 TTTTCTTTGGGGAGAGAGGTGGG - Intergenic
1035219636 7:157398361-157398383 CTTTTTTTGGGGAGAGAGGGGGG - Intronic
1035774844 8:2180194-2180216 TTTTCTTTCGGGTTATTGGGAGG + Intergenic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1037244613 8:16818754-16818776 TTTTTTTTGTGGAAATTGGCAGG + Intergenic
1037628522 8:20629960-20629982 TTTCCTTTTGGGTAAGTGGGTGG + Intergenic
1038529831 8:28309560-28309582 TATTTATTGGGGAGAGTGGGAGG - Intergenic
1041253740 8:55960835-55960857 TGTTCTTTGGGGGAAGGGGCTGG + Intronic
1041313838 8:56541732-56541754 CTTTCTCTGGGGACAGAGGGAGG + Intergenic
1041595622 8:59647480-59647502 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
1042230514 8:66549675-66549697 TTTTATTTGAGAAAAGTTGGTGG - Intergenic
1042321494 8:67479976-67479998 TTTTTTTTGGATAGAGTGGGAGG + Intronic
1042783242 8:72516229-72516251 TTACCTCTGGGGAGAGTGGGAGG + Intergenic
1043099101 8:76017438-76017460 TTTTCTTTGGGGAGCATGGATGG + Intergenic
1043782900 8:84359171-84359193 TTTTCTTTGGGAACAGGGTGGGG + Intronic
1044481154 8:92690187-92690209 TTTTCTTTGTGGAAAGTTCTCGG + Intergenic
1044516869 8:93149160-93149182 CTATCTTTGGGGAGAGTGAGAGG - Intronic
1045297184 8:100882349-100882371 TGTTCTTTGGTGAAGGTGGCTGG + Intergenic
1045700385 8:104859795-104859817 TTAGCTTTGGGGAAGGTGGTTGG + Intronic
1047557707 8:125950592-125950614 TTTTTTTGGAAGAAAGTGGGTGG + Intergenic
1047808913 8:128386466-128386488 TTGCCTTTGGGGAAATTGTGTGG + Intergenic
1048654484 8:136520563-136520585 GTTACTTTGGGCAAAGTAGGAGG - Intergenic
1050033644 9:1412567-1412589 TCTTCCTTGGGCAAATTGGGTGG + Intergenic
1050387952 9:5110825-5110847 GTTTGTTCGGGGAAGGTGGGGGG + Intronic
1050711904 9:8474825-8474847 TTTTCTTTTGGTAAAGTAGAAGG + Intronic
1051213322 9:14768912-14768934 TTTTCTTTGGGGTTTCTGGGAGG + Intronic
1052053449 9:23876097-23876119 TTGTCTTTGGGGAATGTAGTGGG - Intergenic
1054805286 9:69391582-69391604 TTATCTTTGGGAAAAGAGAGGGG - Exonic
1055030927 9:71770545-71770567 TTTTATAAGGGGAAAGGGGGTGG + Intronic
1055045331 9:71918249-71918271 TTTTGTTTTGGGAAAGTTGAAGG + Intronic
1056992077 9:91421802-91421824 TTTTTTTTGTGGGAGGTGGGGGG - Intronic
1058775873 9:108283201-108283223 TTGTCTTGGGGGAAAGGGAGTGG - Intergenic
1059885768 9:118743197-118743219 TTTTCTTTTTGGAAAGTAAGTGG - Intergenic
1060431576 9:123555416-123555438 TTTTCTTTGGAGCAATTGGGTGG - Intronic
1060744996 9:126125625-126125647 TTTACTTAGAGGAAAATGGGTGG + Intergenic
1060810111 9:126606936-126606958 TTTCCTTTGAGGGAGGTGGGTGG + Intergenic
1060964221 9:127703631-127703653 TTTGCTTTGGGGAAAGAGGCAGG - Intronic
1061175904 9:128996763-128996785 TTTCCTTTGGGGAAAGAGGATGG - Intronic
1061347889 9:130042192-130042214 TTTCCAGTGGGGAAAGTTGGCGG - Intronic
1061713286 9:132502270-132502292 TTTTTTTTGGGGGAGGGGGGTGG + Intronic
1062494999 9:136827469-136827491 TCTGCTTTGGGGAAAGCAGGCGG - Intronic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1186345178 X:8684655-8684677 TTTTCCTCGGGGAAGGCGGGGGG - Intronic
1186553332 X:10530338-10530360 TTTTCTTTGGTGGTAGTGGTGGG - Intronic
1186898528 X:14029733-14029755 TTTCCTTTGGGGAGTGAGGGAGG - Intronic
1187915061 X:24146038-24146060 TTCTCCTTGGGGAGAGTGTGTGG + Intergenic
1187934054 X:24318893-24318915 TTTTGTCTGGGGGAAGAGGGAGG + Intergenic
1188057784 X:25562065-25562087 TCTTCTATGGGGAACATGGGAGG + Intergenic
1188294937 X:28435750-28435772 TTATCTTTGGGTAAAGTCGGGGG - Intergenic
1188636340 X:32436490-32436512 TTTTCTTTGGGGGAAATGTCAGG + Intronic
1189152756 X:38725046-38725068 TTTTTTTTGGGGGGGGTGGGGGG + Intergenic
1190072641 X:47291632-47291654 TTTTCTTTTGGGTCATTGGGAGG + Intergenic
1190728016 X:53204213-53204235 TTTTCTTTGGGGAATCTGACTGG - Intronic
1192937142 X:75871834-75871856 TTTTCTTTGGGGAGGTGGGGAGG + Intergenic
1193100520 X:77606281-77606303 TTTTCTTTGGGGGATGGGGTTGG - Intronic
1194008552 X:88529470-88529492 TTGTCTTTGGTGGAAGTTGGGGG - Intergenic
1194371199 X:93074308-93074330 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1194668186 X:96698598-96698620 TTTTCTTTGGGGAAGGATGATGG - Intronic
1194908725 X:99611819-99611841 TTTTTTTTGGGTATAGTGGATGG - Intergenic
1195583863 X:106539893-106539915 TTTTCTTAGGAAAAAGTGGTAGG - Intergenic
1196001700 X:110794149-110794171 TTTTCTTTTAGGGAAGGGGGTGG + Intronic
1197236692 X:124073908-124073930 TTATCTCTAGGGAAAATGGGAGG - Intronic
1198059179 X:133026805-133026827 TATTCTTTGGGGAAGGTTGATGG + Exonic
1198132369 X:133709852-133709874 TTTTCTGTAGGAAAAGTGAGAGG - Intronic
1198431299 X:136569292-136569314 TTTCCTTTGGGGAATGTGATTGG + Intergenic
1198664124 X:139002980-139003002 TTCTGTTTGGGAAAAGTGGAGGG + Intronic
1200094417 X:153650513-153650535 TTTTCTTTGCGGGATGGGGGTGG + Exonic
1200270317 X:154676542-154676564 TCTTCCTTGGACAAAGTGGGGGG - Intronic
1200678998 Y:6186196-6186218 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1201507892 Y:14724642-14724664 TTTTTTTTGGGGGAGGTAGGGGG + Intronic