ID: 1111994123

View in Genome Browser
Species Human (GRCh38)
Location 13:95146252-95146274
Sequence CCTACTTTATGGTAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111994123 Original CRISPR CCTACTTTATGGTAGGAGGA GGG Intronic
903302174 1:22386828-22386850 TATGCTTTAGGGTAGGAGGAGGG + Intergenic
904558556 1:31381651-31381673 CCAACTCTATGGTAGGAGGTTGG + Intergenic
904851824 1:33465410-33465432 CCCACTTTCTGTTAGGAGTAAGG + Intergenic
906490366 1:46263597-46263619 CCAACTTCCTGGTAGGAGTAGGG + Intronic
906809212 1:48809117-48809139 CCTACTTTAGGGAAGGAGGAGGG + Intronic
907297830 1:53466786-53466808 CCCAGTTTAAGATAGGAGGAAGG + Exonic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907469044 1:54660234-54660256 CCTACATGGTGGTAGGTGGAAGG + Intronic
907625908 1:56029130-56029152 ACTGTTATATGGTAGGAGGAGGG - Intergenic
907787704 1:57629369-57629391 CCTAATTAATGGTAGGTGGGTGG - Intronic
908222387 1:62020481-62020503 CTTTCTTTATGGAAGGAGGAGGG - Intronic
908447052 1:64209245-64209267 TCTACTTTATGGAAGTGGGAGGG - Intronic
912110885 1:106341278-106341300 CCAAATTTATGGTATTAGGAGGG + Intergenic
912140150 1:106714863-106714885 CCTACCTGAGGGTGGGAGGAGGG - Intergenic
912273067 1:108229698-108229720 CCCACTATATGGCAAGAGGATGG - Intronic
912295153 1:108464624-108464646 CCCACTATATGGCAAGAGGATGG + Intronic
912802567 1:112729482-112729504 CCTCCTTTAAGGTTGGAGGATGG + Intergenic
913363686 1:118011564-118011586 CCTACTGGAAGGTAGGAAGAAGG + Intronic
913366008 1:118039637-118039659 GCTACTTGAGGGTGGGAGGAGGG + Intronic
916528734 1:165635738-165635760 CTAACTATATGTTAGGAGGATGG - Intronic
916602878 1:166311029-166311051 CCTACTGTGGGGTAGGGGGAGGG - Intergenic
917997851 1:180460129-180460151 CCTACTGTGGGGTAGGGGGAGGG - Intronic
918091026 1:181295056-181295078 CCCACCTTTTGGTGGGAGGAGGG + Intergenic
918981742 1:191570369-191570391 CCTACTTGAGGGTGGGAGGGTGG + Intergenic
919046938 1:192464191-192464213 CATATTTTAGGGTAGCAGGAAGG - Intergenic
920275316 1:204800115-204800137 CCTTCCTGATGGTAGTAGGAGGG - Intergenic
922163537 1:223096327-223096349 CCTACTTGAGGGTAGAAGGTGGG - Intergenic
923054697 1:230417271-230417293 CTTCCTTTAAGGAAGGAGGAGGG - Intronic
924762670 1:247003440-247003462 CCGACTTTAGAGTAGAAGGAAGG + Intronic
1063001104 10:1923888-1923910 CCTGCTTTATGGGCGGAGCATGG + Intergenic
1063210905 10:3880410-3880432 CCTGCTTTATGGCAGGGGCAAGG + Intergenic
1063570825 10:7213278-7213300 CCTACTGTGTATTAGGAGGAAGG + Intronic
1063663672 10:8049807-8049829 CCTTCCCTATGGTGGGAGGAGGG - Intergenic
1064167217 10:12996921-12996943 CCTACGTGAGGGTGGGAGGAGGG + Intronic
1065073937 10:22057476-22057498 CCCAATTTATGGGAGGAGAATGG - Intergenic
1065079661 10:22115485-22115507 CCTGCTTTAAGCTAGGAGGGTGG - Intergenic
1067285323 10:44903649-44903671 CCTGATTTCTGGTAGGGGGATGG - Intergenic
1068753528 10:60624044-60624066 CCTACTTGAGGGTAGAGGGAGGG + Intronic
1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG + Intronic
1070406498 10:76102387-76102409 CCTACTTAATGGTAGAGGGTGGG - Intronic
1071967108 10:90862746-90862768 CCTAGTATATGGCAGGAGTAAGG - Intergenic
1075161343 10:120027400-120027422 CCTTTCTTATGGGAGGAGGATGG + Intergenic
1076325455 10:129617122-129617144 CCTACTTGAGGGTGGGAGGAGGG - Intronic
1077708168 11:4508652-4508674 CCTACCAGAGGGTAGGAGGAAGG + Intergenic
1078113245 11:8418240-8418262 ACTACTTGAGGGTGGGAGGAGGG - Intronic
1078333188 11:10442849-10442871 CATACTTTGTGGTGGGAGGGGGG - Intronic
1079839675 11:25381309-25381331 CCTGTTTTAGGGTGGGAGGAGGG - Intergenic
1081056363 11:38414647-38414669 CCTACTTTGAGGTAAAAGGAGGG - Intergenic
1081728626 11:45352624-45352646 CCTCCTTTATAGTAGGAGTCAGG - Intergenic
1082731997 11:56810134-56810156 CCTATTTTATGGTGGAAGGTAGG - Intergenic
1083022365 11:59520047-59520069 CCTACTTGAGGGGAGGAGGGTGG + Intergenic
1085914224 11:80865502-80865524 CCTACTTGAGGGTAGAAGGTGGG + Intergenic
1087008625 11:93492980-93493002 TCTATTTTAGGGTAGGAGAAAGG + Intronic
1087414935 11:97842055-97842077 CCTACTTTATTGTAAGAATATGG - Intergenic
1087522468 11:99258294-99258316 CCCACTTGAAGGTGGGAGGAGGG - Intronic
1087745513 11:101941116-101941138 TCTACTTTCTGTTGGGAGGAAGG - Intronic
1088149771 11:106730270-106730292 CCTACTTTAGGGCAGGGGGTAGG - Intronic
1092792928 12:12085171-12085193 CCTGCCTTATGAGAGGAGGAGGG + Intronic
1092836435 12:12493388-12493410 CCTACTGGATGGAAGCAGGAAGG - Intronic
1092947505 12:13470507-13470529 CCTACTATATGCCAGGAGGAGGG + Intergenic
1095634005 12:44409857-44409879 TCTTATTTTTGGTAGGAGGAGGG + Intergenic
1096887394 12:54731496-54731518 CTGACTTTATGGTAGGCAGATGG - Intergenic
1098103735 12:67046839-67046861 CCTCTTTTAAAGTAGGAGGAGGG - Intergenic
1102153626 12:110706309-110706331 GCTACATGATGGTAGGGGGATGG + Intergenic
1102640267 12:114360840-114360862 CCTACTTTATGCTAAGAGCATGG - Intronic
1103252336 12:119511054-119511076 CCTACTGTGTGCTAGGATGAAGG - Intronic
1104927795 12:132322614-132322636 CCTACGTTCTGGAAGTAGGAGGG - Intronic
1105341078 13:19526558-19526580 CCTACTTGAGGGTTGGAGGCTGG + Intronic
1105478402 13:20749306-20749328 TCTACATTGTAGTAGGAGGATGG - Intronic
1105878061 13:24577383-24577405 CCTACTTGAGGGTTGGAGGCTGG - Intergenic
1106363581 13:29055518-29055540 CCTACTTGAGGGTAGAAGGTGGG - Intronic
1107674943 13:42785920-42785942 CCTAATTGGTGGGAGGAGGAGGG - Intronic
1108978128 13:56475373-56475395 CCTACTTGACGGTAGAAGAAAGG + Intergenic
1109621150 13:64907195-64907217 AATACTTTATGGTAGCAGAAGGG + Intergenic
1109928902 13:69185979-69186001 TCTACTTTATGGTAGTGTGATGG + Intergenic
1111994123 13:95146252-95146274 CCTACTTTATGGTAGGAGGAGGG + Intronic
1114197132 14:20488387-20488409 CTTAATTTATGCTGGGAGGAAGG + Intergenic
1114262351 14:21046788-21046810 CTTACTTTATTGTAGGAATATGG - Intronic
1114835465 14:26198270-26198292 CCTAATTAATGGTATGAGTATGG - Intergenic
1115320294 14:32073419-32073441 CCTACTTGAGGGGAGGAAGAAGG - Intergenic
1116648351 14:47559238-47559260 CCTACTTGATGGTAGAGGGAGGG - Intronic
1117821353 14:59652670-59652692 CCTACTTGAGGGTGGGAGGAGGG + Intronic
1118528076 14:66668624-66668646 CCTACTTGAGGGTAGAAGGTGGG + Intronic
1120716202 14:87843517-87843539 CCTACTTGAGGGGAGAAGGAGGG - Intronic
1124942200 15:34228646-34228668 CCTACTTGATGGTAGGAAATTGG + Intronic
1125302985 15:38277268-38277290 CCTACTTGAGGGTGGGAGGAGGG - Intronic
1126142034 15:45446787-45446809 CCTACTGGATGGTAGGTGGGTGG - Intronic
1127011079 15:54629278-54629300 CCTACTTGAGGGTAGGAGGAGGG + Exonic
1127275000 15:57434977-57434999 CCTAATATAGGGTAGGAGGAGGG + Intronic
1128926878 15:71664645-71664667 CCTACTTGAGGGTGGGAGGAGGG - Intronic
1129010002 15:72407230-72407252 CCTGCTCTATGCTAGAAGGATGG + Intronic
1130293852 15:82628861-82628883 CCTACTTTATCGTAAGAATACGG + Intronic
1137303432 16:47176721-47176743 TCTTCTTTCTGGTAGCAGGATGG + Intronic
1139578681 16:67858781-67858803 CCGATTTTATGGTCTGAGGAGGG - Intronic
1140464793 16:75172711-75172733 CCTGCTTTATCCCAGGAGGACGG - Intergenic
1144377617 17:14661106-14661128 CCTAGTTTGTGCTGGGAGGATGG + Intergenic
1145720782 17:27070509-27070531 CCTACTTGAGGGTGGGAGGTGGG + Intergenic
1147044110 17:37740367-37740389 CCTACTTCATTGTAGGATCAGGG - Intronic
1154363989 18:13689545-13689567 CATACTTAATGGTGGGAGGCTGG + Intronic
1154395718 18:13986802-13986824 CCTACTTAATGGTTGAAGGTGGG + Intergenic
1155577407 18:27263283-27263305 TCTACTAAATGGTAGAAGGAAGG + Intergenic
1155581624 18:27314616-27314638 CTTCCTTTATTGTAAGAGGAAGG + Intergenic
1155923468 18:31629118-31629140 CTTACTTTATGGTAAGAATATGG + Intronic
1156340579 18:36206636-36206658 CCTACTTGAGGGTAGAAGGTGGG - Intronic
1156939864 18:42754239-42754261 CCTTCTTTGTGGTAGGCAGAAGG + Intronic
1157826104 18:50813829-50813851 CCTACTTGAGGGTTGGAGGGTGG + Intronic
1158167749 18:54559502-54559524 ACTACTATATGGTAGAGGGAGGG - Intergenic
1159025999 18:63182645-63182667 TCTAATTTATGGCAGGAGAATGG - Intronic
1161607778 19:5224368-5224390 CCTTATTAATGGAAGGAGGAGGG - Intronic
1162859195 19:13492803-13492825 CCTACTGTATGCTAGGTGAATGG - Intronic
1166377999 19:42338567-42338589 CCTACCTGAGGGTTGGAGGAGGG - Intronic
1166684024 19:44784407-44784429 TCTCCATTCTGGTAGGAGGAGGG + Intronic
1166854586 19:45777265-45777287 CCAACTTTATGGAGGGAGCATGG + Intronic
1167499606 19:49837664-49837686 CCTACGTGATGGTAGGTGGTGGG + Intronic
927959938 2:27234835-27234857 CTTACTTTATGGTAATGGGAGGG + Intronic
928932556 2:36639011-36639033 CCTACAAGAGGGTAGGAGGAGGG + Intronic
929611408 2:43273524-43273546 CCTACTGGAAGGCAGGAGGAAGG + Intronic
930578539 2:53182130-53182152 CCTAATGTATGATAGGAGAAAGG - Intergenic
931127724 2:59296364-59296386 CCTTCTGTATGGAATGAGGAAGG - Intergenic
931300832 2:60976511-60976533 CCTACTTTATAATTAGAGGATGG - Intronic
931658841 2:64537265-64537287 CCTACTTGAAGGTGGAAGGAGGG + Intronic
932683699 2:73849759-73849781 CCTACTTTATGGTAGGACCTGGG + Intronic
938965296 2:136382717-136382739 CCTACTATATGCTAGGTGCAAGG + Intergenic
940547523 2:155107526-155107548 CCTACTTTAGGGTGGAGGGAGGG + Intergenic
940955668 2:159724829-159724851 CCTGTTTTAGGGTAGGGGGAGGG - Intronic
942530637 2:176906093-176906115 CCCAGATAATGGTAGGAGGAGGG + Intergenic
943258214 2:185625019-185625041 CCTTATGTATGGTAGGAAGAAGG + Intergenic
945696677 2:213115275-213115297 CCTAATTTGAGGTATGAGGAAGG + Intronic
947975085 2:234358358-234358380 CCTACTTGAGGGTGGGAGGTTGG - Intergenic
1169356479 20:4910775-4910797 CTTACTTTATGAAATGAGGAGGG - Intronic
1170247628 20:14240682-14240704 CCTACTTGAGGGCAGAAGGAGGG + Intronic
1173559879 20:43995660-43995682 TCTACTTGAGGGTGGGAGGAGGG - Intronic
1176934570 21:14851284-14851306 CCTACTTGAGGGTGGGAGGATGG - Intergenic
1177203618 21:17985911-17985933 CCTACTTTCTGGTTTGAAGATGG + Intronic
1177370954 21:20202474-20202496 CCTACTTGATGGTAGAGGGTGGG + Intergenic
1178128894 21:29546883-29546905 CATACTTGATGGTAGGAAGAAGG + Intronic
1179899347 21:44380970-44380992 GCTGCTTTACGGTATGAGGATGG + Intronic
1180799656 22:18625842-18625864 CCTCCTTTCTGGGGGGAGGAGGG + Intergenic
1181222060 22:21369424-21369446 CCTCCTTTCTGGGGGGAGGAGGG - Intergenic
1182342917 22:29638748-29638770 TGTCCTTTATGGTAGGTGGAAGG - Intronic
1183237749 22:36632368-36632390 CCAACTTGATGGCAGGGGGAAGG - Intronic
1184079972 22:42212431-42212453 CATGCTTGATGCTAGGAGGATGG + Exonic
949152071 3:781369-781391 CCTACTTCAGGGGAGAAGGATGG - Intergenic
949172777 3:1021977-1021999 TCTACATCATGGTAAGAGGACGG + Intergenic
949448043 3:4156107-4156129 GCTACTTTATGGTGGTGGGAAGG - Intronic
952704237 3:36361093-36361115 CCTACTTTAGGGTAGAGGGTGGG + Intergenic
952708521 3:36405471-36405493 CCAATTTTATGGTAGGAAGGTGG + Intronic
953052053 3:39353462-39353484 CCTGCTGTAGGGTGGGAGGAGGG + Intergenic
953545186 3:43859269-43859291 CCTTCTTTAAGGGAGGAGGGAGG - Intergenic
954048788 3:47955360-47955382 GCTACATTATGGTAGGAGAATGG - Intronic
954283842 3:49603605-49603627 CCTACCTCATGGTAGGAACAAGG + Intronic
954990552 3:54837252-54837274 CCTGCTTGATGCTAGGAGGGTGG + Intronic
957535705 3:81500947-81500969 CCTACTTGAGGGTAGAAGGCTGG + Intronic
958807479 3:98829432-98829454 CCTACTGGAGGGTGGGAGGAGGG - Intronic
959035184 3:101354405-101354427 CCTACTTGAAGGTGGGAGGAGGG - Intronic
959188121 3:103073335-103073357 CCTACTTGAGGGTGGAAGGAGGG - Intergenic
959510467 3:107205199-107205221 CCTACTTGAGGGTAGGAGAAGGG + Intergenic
959881920 3:111453671-111453693 CCTACTTTAGGGTAGAGGGTGGG + Intronic
964296029 3:155234210-155234232 CCTACTTGATGGTGGAAGGTGGG - Intergenic
964345248 3:155748615-155748637 CCCACTTTAAGATAGGGGGAAGG + Intergenic
965085973 3:164098854-164098876 CCTACTGTAGGGGAGGTGGAGGG - Intergenic
966613679 3:181892431-181892453 ACTACTTTGAGGTGGGAGGATGG - Intergenic
967341687 3:188405730-188405752 GAGATTTTATGGTAGGAGGATGG - Intronic
968389249 4:175482-175504 CCTACTTTAAGGTAAAAAGAGGG - Intergenic
971434936 4:26610600-26610622 CCTACTTGATGGTAGAGGGTGGG - Intronic
976011896 4:80499087-80499109 CCTACTTGAGGGTGGGAAGAGGG + Intronic
976481323 4:85549758-85549780 CCTACTTGAGGGTAGAGGGAGGG - Intronic
977036541 4:91960412-91960434 CCTCGTTTTTGGTTGGAGGAAGG - Intergenic
978346731 4:107777905-107777927 CATATTTTATGGAAGAAGGAAGG + Intergenic
978430887 4:108632057-108632079 CCTCCTTAATGGTAGGTGGTTGG - Intergenic
982415939 4:155132022-155132044 CCTACTTTAGGGTAGCGGGAAGG + Intergenic
983647912 4:170010649-170010671 CTTACTTTATTGTAGGAAAATGG + Intronic
987159515 5:15126711-15126733 CCTACTTGATGGTGGGGGGTGGG - Intergenic
988576998 5:32436101-32436123 CCAACTTTAAGGTAGGACCAGGG - Intronic
989013457 5:36901093-36901115 CCTACTTGAGGGTGGGAGAAGGG - Intronic
990106554 5:52270610-52270632 TCTACTTGAGGGTGGGAGGAGGG + Intergenic
990304849 5:54483849-54483871 CCTTCTTTCTGGTATAAGGAGGG - Intergenic
990433921 5:55768280-55768302 CCTACTTTAGGGTAGAAAGTGGG - Intronic
991459006 5:66836786-66836808 CCTACTTGAGGTTGGGAGGAGGG + Intronic
993307492 5:86290263-86290285 CCCACTATATGGCAAGAGGATGG + Intergenic
993423349 5:87730270-87730292 CCCACTTTACAGTAGAAGGAGGG - Intergenic
997022322 5:130016076-130016098 CCTACTTGAAGGTGGAAGGAAGG + Intronic
997188573 5:131906857-131906879 CCTACTTGAGGGTGAGAGGAGGG + Intronic
998026954 5:138825577-138825599 CCTACTTTATGAAAGGATGCTGG - Intronic
999254362 5:150201855-150201877 CCTACTTCATGGGAGGAGGGTGG - Intronic
1001760390 5:174203497-174203519 CCTAATTTATGGTAAAAGTAGGG + Intronic
1007869950 6:45023752-45023774 CCTACTTGAAGGTGGAAGGAGGG + Intronic
1009871299 6:69454991-69455013 CCTACTTGTGGGTGGGAGGAGGG + Intergenic
1010517786 6:76794257-76794279 CTTACTTTTTTGTAGGAGGCAGG - Intergenic
1011851334 6:91632939-91632961 CTCACTTTATGGTAGCAGAAAGG - Intergenic
1012001135 6:93656559-93656581 CCTACTTGAAGGTAGGGGGTGGG - Intergenic
1014244409 6:119052319-119052341 ATGACTTTGTGGTAGGAGGAGGG - Intronic
1016806987 6:148221597-148221619 GCTACTTTAAGGCAGGAGGAAGG + Intergenic
1017410097 6:154159063-154159085 CCTACTCAATGGTAGGAGATAGG - Exonic
1017698865 6:157048099-157048121 CCAAATTTAAGGCAGGAGGAGGG - Intronic
1017929857 6:158942363-158942385 CCTACTTGAGGGTAGAAGGTGGG - Intergenic
1020000745 7:4754197-4754219 CCTGCATAATGGCAGGAGGAGGG + Intronic
1020436426 7:8167465-8167487 CCTACTTGCGGGTAGGTGGAGGG + Intronic
1020901456 7:14008512-14008534 GCTACTTTTTGGAATGAGGAAGG + Intergenic
1021650229 7:22825869-22825891 CCTACTTGAGGGTGGGAAGAGGG - Intergenic
1022354938 7:29605634-29605656 CCTACTTTTTGGTGGGGGTAGGG + Intergenic
1023402118 7:39798030-39798052 CCTCCTTCATGGTGGGAGGTGGG + Intergenic
1023673780 7:42608094-42608116 CCCATTTTCTTGTAGGAGGATGG - Intergenic
1025051340 7:55737125-55737147 CCTCCTCCATGGTAGGAGGTGGG - Intergenic
1027251908 7:76404224-76404246 GTAACTTTATAGTAGGAGGAGGG - Intronic
1029439283 7:100578309-100578331 CCTGCTTTCTGGCAGGAGGATGG - Intronic
1029916792 7:104218485-104218507 CATACTTTTTTGTAGGGGGAGGG - Intergenic
1031647743 7:124247467-124247489 CCTACTTGAGGGTAGAGGGAAGG - Intergenic
1032625005 7:133582125-133582147 CCTACTTGAGGGTAGAGGGAGGG - Intronic
1032660831 7:133982094-133982116 CCTACTTGACGGTGAGAGGAGGG + Intronic
1033468755 7:141623631-141623653 TGCACTTTATGTTAGGAGGAGGG - Intronic
1033709140 7:143921118-143921140 TCTACTTGAGGGTAGGAGGAGGG - Intergenic
1035490681 7:159274229-159274251 CCTACTTGAGGATGGGAGGAAGG + Intergenic
1038317503 8:26500217-26500239 CCTACTTGAGGGTGGGAGGAGGG + Intronic
1038906113 8:31904865-31904887 CCTACTGGAGGGTGGGAGGAAGG + Intronic
1038988646 8:32841596-32841618 CCTACTTGAGGGTGGGAGGAGGG - Intergenic
1039176460 8:34813129-34813151 CCTAATTTAGGGAAGAAGGAAGG + Intergenic
1043202601 8:77389645-77389667 CCTACTGTATGCCAGGAGCAGGG + Intergenic
1044307597 8:90656035-90656057 CCTACTTGATGGTAGAGGGTTGG + Intronic
1048033212 8:130652476-130652498 CTTACTTCCTGGTAGGAAGAAGG + Intergenic
1048640737 8:136357667-136357689 CCTACTTAAGGGTGGGAGGTGGG - Intergenic
1048818312 8:138355008-138355030 CCTGCTGTAGGGTGGGAGGAAGG - Intronic
1048874208 8:138824064-138824086 CCTATTTTATGCTATGAGTAGGG + Intronic
1048929335 8:139298710-139298732 CCTACTGGAGGGTGGGAGGAGGG - Intergenic
1051738242 9:20225383-20225405 ACTACTTTTGGGGAGGAGGAAGG + Intergenic
1052360797 9:27554479-27554501 CCTACTTGAGGGTGGGAGAAGGG + Intronic
1052393541 9:27909783-27909805 TCTACTTGAGGGTGGGAGGAGGG + Intergenic
1054331396 9:63760092-63760114 CCTGCTGTATGGTGGGGGGAGGG + Intergenic
1055015936 9:71618195-71618217 CCTACTTGAGGGTGGGAGGAGGG + Intergenic
1055475059 9:76654816-76654838 CCTACAGTGTGGTAGGAAGAAGG - Intronic
1056750063 9:89343493-89343515 CCTACTTGAGGGTGGGAGGAAGG - Intronic
1058172635 9:101701365-101701387 CCTACTGGAGGGTGGGAGGAGGG - Intronic
1058795147 9:108490712-108490734 CCTACTTTTTGGGTGGGGGAGGG - Intergenic
1058833475 9:108839914-108839936 TCTACTTGAGGGTGGGAGGAGGG + Intergenic
1059975443 9:119711593-119711615 CCTACTCTGTGCTAGGAGCATGG - Intergenic
1062360516 9:136185868-136185890 CCTGCCTCAGGGTAGGAGGAGGG + Intergenic
1186130880 X:6464058-6464080 CCTACTTAATAGTAGGACAAGGG + Intergenic
1186645418 X:11501694-11501716 CCTACTTTATTGTAAGAATACGG - Intronic
1186662541 X:11683595-11683617 CCTACTTGAGGGTGGGAGGAGGG + Intergenic
1188966547 X:36560700-36560722 CCTACTTTATGGTGGCAGGTGGG - Intergenic
1191020428 X:55854154-55854176 CCTACTTAAGGGTGGAAGGAAGG - Intergenic
1192113840 X:68392419-68392441 TTTACTGCATGGTAGGAGGATGG + Intronic
1193275655 X:79584308-79584330 CCTAGTTAAGGGTAGAAGGAGGG - Intergenic
1193285470 X:79709328-79709350 CCTATTGAAGGGTAGGAGGAGGG + Intergenic
1193906107 X:87246213-87246235 CCTACTTGATGGTGGAGGGAAGG - Intergenic
1194386667 X:93263932-93263954 CCTAGTTTCTGGGAGGATGATGG - Intergenic
1195576353 X:106455701-106455723 CCTACTTGAGGGTGGGAGGTGGG + Intergenic
1196870174 X:120105837-120105859 CCTACTGAAGGGTAGGAGGAGGG + Intergenic
1198043440 X:132876645-132876667 ACTCCTTTATGGTGGGAGGGGGG + Intronic
1198426902 X:136529643-136529665 CCTACTTGAAGGTGGAAGGAGGG + Intergenic
1199558103 X:149131396-149131418 CTTTATTTTTGGTAGGAGGAAGG + Intergenic
1201670989 Y:16519916-16519938 CCTACTGGAAGGTGGGAGGAGGG - Intergenic
1202591088 Y:26484031-26484053 CCTACTTGAGGGTTGGAGGCTGG - Intergenic