ID: 1111997101

View in Genome Browser
Species Human (GRCh38)
Location 13:95175938-95175960
Sequence CAGGCACCTGTTCCTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111997101_1111997105 -3 Left 1111997101 13:95175938-95175960 CCCACCACAGGAACAGGTGCCTG 0: 1
1: 0
2: 0
3: 21
4: 200
Right 1111997105 13:95175958-95175980 CTGCCTGCTGTCCTTCCCACAGG 0: 1
1: 1
2: 8
3: 40
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111997101 Original CRISPR CAGGCACCTGTTCCTGTGGT GGG (reversed) Intronic
900407621 1:2499425-2499447 CAGGGACCTCTTCCTGGGGGTGG - Intronic
902585223 1:17434958-17434980 CAGGCACCTGTCACTGTGCTCGG - Intronic
902930889 1:19730730-19730752 CAGGCAGCTTTTCCTGGGGAAGG + Intronic
903172734 1:21563884-21563906 CAGACACCTGCTGCTGTGGATGG + Intronic
905638398 1:39571491-39571513 TAGGCACCTGGTGCTGTGCTAGG - Intronic
905905318 1:41614221-41614243 CAGGCAGCTGTTCCTTGGGGAGG - Intronic
906515874 1:46438523-46438545 GATGCACCTGTTCCGGGGGTGGG + Intergenic
907278340 1:53328919-53328941 AAGGCACCTCTTCCTCTGGAGGG + Intergenic
907762492 1:57375161-57375183 CAGCCACCTGCTCCTGTGGAGGG - Intronic
907946417 1:59140207-59140229 AAGGCACCTCTTCCTCTGTTAGG + Intergenic
916460105 1:165014967-165014989 GAGGCACCTGTTCCTCTGGGCGG - Intergenic
921546558 1:216481480-216481502 CAGGGCTCTGTTCCTTTGGTAGG - Intergenic
1066513626 10:36130503-36130525 CAGGCACCTGTGCCTTTTCTTGG + Intergenic
1069204741 10:65667615-65667637 CAGGCATCTGTTACCATGGTAGG + Intergenic
1069807006 10:71132423-71132445 CAGGCACCCCTTTCTGTGGCTGG + Intergenic
1070841444 10:79490656-79490678 CACGCAGCTGTTCCTGAGTTGGG - Intergenic
1071477022 10:86033798-86033820 TGGGCACTTGTTGCTGTGGTAGG - Intronic
1075612107 10:123862594-123862616 CAGGTACCTGGCCCTGTGGTTGG - Exonic
1077304648 11:1863702-1863724 CAGCCCTCTGTTCCTCTGGTTGG - Intronic
1080742551 11:35079786-35079808 TTAGCACCTGTTTCTGTGGTTGG - Intergenic
1080884981 11:36359028-36359050 CAGGCTCATATTCTTGTGGTTGG + Intronic
1081167146 11:39820388-39820410 CAGGCCTCTGGTCCTGTGGTGGG + Intergenic
1081372686 11:42323512-42323534 GAGGCACATGTTTCTGAGGTGGG - Intergenic
1081398964 11:42620372-42620394 CAGGGACCTGTTCCTGCCCTGGG - Intergenic
1081744924 11:45466198-45466220 CAGGCCCCTCTTCTTTTGGTGGG + Intergenic
1083144912 11:60750935-60750957 CAGGCAGCTCTTCCTCTGGTGGG + Intergenic
1089313232 11:117573791-117573813 CAGGCACCTTTTCCTGGTGAAGG + Intronic
1090714428 11:129417485-129417507 CAGGCACGCGTTCCTTTCGTTGG - Intronic
1091709163 12:2725407-2725429 CAGTCACCTCATCCTGTGTTAGG - Intergenic
1094849170 12:34374661-34374683 CAGGCATCTTCACCTGTGGTGGG + Intergenic
1095761941 12:45849635-45849657 CAGGCACATATTCATGTGGTAGG + Exonic
1096658689 12:53107763-53107785 CAGGCACGTGTTACTGTGTTCGG + Intronic
1099128985 12:78802939-78802961 TTGGCATCAGTTCCTGTGGTTGG - Intergenic
1101775532 12:107789761-107789783 CAAGCACCTGTTGCAGTGGCTGG - Intergenic
1102062719 12:109945989-109946011 CAGGCACATGGTCCTGTGCCTGG - Intronic
1104159014 12:126160969-126160991 CAGACTCATGTTCCTGTAGTAGG - Intergenic
1104363447 12:128155088-128155110 CAGGCACCAGTGCCTGAGGGAGG - Intergenic
1105977874 13:25489260-25489282 CAGGCTCCTCTTCCTGTGTCTGG + Intronic
1110871312 13:80455437-80455459 CAGGCACCTGCTGCTGTGCTGGG - Intergenic
1111997101 13:95175938-95175960 CAGGCACCTGTTCCTGTGGTGGG - Intronic
1114714762 14:24813561-24813583 CAGGGACTAATTCCTGTGGTTGG + Intronic
1115545374 14:34461741-34461763 CAGTCCCCTGTTCCTGTAGGAGG - Intronic
1117163694 14:53013500-53013522 CAGGCACCTGCCACTGTGCTCGG + Intergenic
1118159428 14:63273857-63273879 CAGGCGCCTGGTTCTGTGGAAGG + Intronic
1119217017 14:72876774-72876796 CAGACAGCAGTTCCTGTGGCTGG - Intronic
1121846961 14:97180473-97180495 AAGGCACGTCTTCCTGTGCTTGG + Intergenic
1122940713 14:104980072-104980094 CGGACACCTTTTCCTGGGGTGGG + Intergenic
1123064212 14:105608216-105608238 CAGGCCCCTGCACCCGTGGTGGG + Intergenic
1123093447 14:105752625-105752647 CAGGCCCCTGCACCCGTGGTGGG + Intergenic
1128741142 15:70084500-70084522 CAGGCATCAGTTCCAGTGCTGGG - Intronic
1129952949 15:79608023-79608045 CAGCCTGCTGTTCCTGTGCTGGG + Intergenic
1130128478 15:81115348-81115370 GATGAACCTGTTCCAGTGGTTGG + Intronic
1130403793 15:83580478-83580500 CATGCTTCTGTTACTGTGGTGGG + Intronic
1131449578 15:92528131-92528153 AAGGAACCTGTTTTTGTGGTAGG - Intergenic
1132205146 15:99981301-99981323 CAGACACCTGTCCCTGTTGAAGG - Intronic
1133662561 16:7933323-7933345 AAGCCACCTATTCCTGAGGTTGG - Intergenic
1133740000 16:8644211-8644233 CAGGCACCAGATTCTGTGCTGGG + Intronic
1134856586 16:17525094-17525116 CAAACACCTATTCCTGTGCTTGG - Intergenic
1134893736 16:17865170-17865192 CAAGCATCTGATACTGTGGTGGG - Intergenic
1136009609 16:27354896-27354918 CAAGCACCTGGTTCTGTGCTGGG - Intronic
1136406598 16:30051773-30051795 CAGCCACCTCTGCCTGAGGTTGG + Intronic
1136548621 16:30969532-30969554 CAGGCAGCTGTGCCTGGTGTAGG + Intronic
1136988442 16:35135960-35135982 CAGGCACCTGCTACTGTGCCTGG + Intergenic
1143433360 17:6903247-6903269 CAGGCACCTGTGCCTATGAGAGG + Intronic
1144671976 17:17138066-17138088 GGGGCAACTGTACCTGTGGTTGG - Exonic
1145963494 17:28901282-28901304 CAGGTATCAGTTCCTGTGGCCGG - Exonic
1146525521 17:33564044-33564066 AAGTCACATATTCCTGTGGTGGG + Intronic
1149806348 17:59620686-59620708 AAGGCACCTTCTCCGGTGGTGGG + Intronic
1149867561 17:60159139-60159161 CAGGCACCTCATCCTGTCCTGGG - Intronic
1150565297 17:66333699-66333721 CAGGCACTGGTTCCTGGGGGAGG - Intronic
1152103529 17:78316202-78316224 CCAGCCCCTGCTCCTGTGGTTGG + Intergenic
1152910180 17:83000103-83000125 CAGGCACCTGTCACTGTGCCTGG + Intronic
1154399716 18:14025055-14025077 AAGGCACTTGTTCCTGTGAAAGG + Intergenic
1155215877 18:23642432-23642454 CTGGCACCTGTGCCAGTGGCTGG + Intronic
1156265615 18:35485845-35485867 CAGGCATGAGTTCCTGTGCTTGG - Intronic
1157493750 18:48141017-48141039 CAGGCATCTGGTCCTGTCATAGG + Intronic
1157852340 18:51067553-51067575 CAGGCACATGTTACTGTGCCTGG + Intronic
1158607259 18:58906617-58906639 CAGGCACCTGCACCGGTGCTGGG + Intronic
1159789933 18:72765559-72765581 CAGGCACCTGTCACTGTGCCTGG + Intronic
1160374643 18:78402193-78402215 CAGGAAACTTTTCCTGTGATGGG + Intergenic
1160761730 19:788885-788907 CAGGCCGCTGACCCTGTGGTCGG + Intergenic
1160839261 19:1138266-1138288 CCGGCACCTGTTTCTGTGTGGGG - Intronic
1160845492 19:1164324-1164346 CTAGCACCTGTTCCTGTGCACGG - Intronic
1160902848 19:1437504-1437526 CAGGCACCTGTTACCGTGCCCGG - Intergenic
1161071097 19:2261547-2261569 CAAGCACCTGTCCCCGTGCTTGG - Intronic
1161936614 19:7376210-7376232 AAGGCAGCTGTGTCTGTGGTTGG + Intronic
1162028780 19:7908628-7908650 CAGGCCCCAGCTCCTGTGGGAGG + Intronic
1162585163 19:11553888-11553910 GTGGCACCTGTTCCTCTGGACGG + Intronic
1163970181 19:20785902-20785924 CAGGCACCTGCCACTGTGCTGGG + Intronic
1165098500 19:33424090-33424112 CTGTCACCTGCTCCTGTGCTGGG + Intronic
1168352780 19:55686095-55686117 CAGGCATCTGGGCCTGTGTTAGG + Intronic
925788900 2:7462328-7462350 CATGCACTTGTGCCTGTGGCAGG + Intergenic
926599058 2:14821888-14821910 CAGGCACCTGTCACTGTGCCTGG - Intergenic
927473935 2:23397608-23397630 CAGGCCCTTATTCCTGTGCTGGG + Intronic
928159269 2:28907128-28907150 CAACCACCTGATCCTGAGGTTGG + Intronic
929783751 2:44974470-44974492 CAGGCCCCTGTGGCTGTGGCTGG - Intergenic
930126064 2:47797717-47797739 CAGGCACCTGCTACTGTGCTCGG + Intronic
931674428 2:64679883-64679905 CAGGCAGCTGCTCCTGGGCTAGG - Intronic
933727706 2:85435973-85435995 CAGACACCTGGCCCTCTGGTGGG + Intronic
934308932 2:91846417-91846439 CAGGCACCTGCTACTGTGCCTGG + Intergenic
935202673 2:100871471-100871493 CAGGCACATGCTGCTGTGCTTGG + Intronic
935867188 2:107402509-107402531 CAGTTACCACTTCCTGTGGTTGG - Intergenic
937616322 2:123926372-123926394 CAGGCACATGTTCATGTGAGAGG + Intergenic
939740665 2:145902110-145902132 TAGGCATCTGGTCCTGTGATGGG - Intergenic
939848735 2:147279019-147279041 CAGTCACCTGCTACTGTGATTGG - Intergenic
941254942 2:163217297-163217319 CATGCAACTCTTCCTTTGGTGGG - Intergenic
941369043 2:164641561-164641583 CAGGCACCCGTTAGTGTGCTTGG - Intergenic
944662627 2:201934029-201934051 CAGTCACTTGAGCCTGTGGTAGG - Intergenic
944871781 2:203919297-203919319 CAGGCACCTGTTACCGTGCCGGG + Intergenic
946003977 2:216507305-216507327 CAGGGAGCTTTTACTGTGGTAGG + Intronic
946092902 2:217246548-217246570 CAAGGACCTGTGCCAGTGGTGGG - Intergenic
946132464 2:217617625-217617647 CAGGCAGCTGCTCCTGAGGCAGG - Intronic
948895811 2:240926357-240926379 CAGGCACCAGCCCCTGTGGGAGG + Intronic
948966299 2:241383361-241383383 CACAGCCCTGTTCCTGTGGTGGG + Intronic
1171772667 20:29336435-29336457 CAGGCACCGGGGCCTGTTGTGGG + Intergenic
1172766199 20:37352370-37352392 CAGCCACCTTTGTCTGTGGTTGG + Intronic
1172938395 20:38637597-38637619 CAGACCCCTTTTCCTGTGGAAGG - Intronic
1173365274 20:42379535-42379557 GAGGCACCTGAGCCTGTGGAGGG + Intronic
1173667840 20:44775358-44775380 CTGGCACCTTTTTCTGGGGTGGG + Intronic
1173703212 20:45091498-45091520 CAGTCAGCTCTTCCTTTGGTCGG + Intergenic
1173806218 20:45927080-45927102 CAGGCTCTGGTTTCTGTGGTGGG - Intergenic
1176262380 20:64188810-64188832 CAGGCACCGGAGCCTGCGGTGGG + Intronic
1177940765 21:27408928-27408950 CAGGCACATATTCCTAAGGTAGG - Intergenic
1178375965 21:32067716-32067738 GAGACACCTGTTCCTGCGGCAGG + Intergenic
1178895396 21:36553377-36553399 CAGGGGCCTGTTCCTCAGGTGGG - Intronic
1178906518 21:36641558-36641580 CAGGCACATGCCCCTGTGCTTGG - Intergenic
1179482153 21:41685308-41685330 CAGGCTCAAGTCCCTGTGGTTGG - Intergenic
1180075594 21:45459895-45459917 CAGGCACCCGTTGCTGTTGTGGG - Intronic
1181495148 22:23283484-23283506 CAGGCACAGGCCCCTGTGGTGGG - Intronic
1183070202 22:35390808-35390830 AAGGGACATCTTCCTGTGGTGGG - Intronic
1184342714 22:43894737-43894759 CAGTCACCTCTTCCTGTAGCAGG - Intergenic
1184834189 22:47011287-47011309 CCTGCAGCTGTGCCTGTGGTCGG + Intronic
950965565 3:17143453-17143475 CAGGCACTTCTTCCCATGGTGGG - Intergenic
952410844 3:33048535-33048557 CAGGTGCATGTTCCTGTGGGTGG + Intronic
954635225 3:52067482-52067504 CAGGGAGCTTTTCCTGTTGTGGG + Intergenic
961095531 3:124152734-124152756 CAGGCTCCTGCTACTGTGGCTGG + Intronic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966486894 3:180481306-180481328 CAGGCACTTTGTCCGGTGGTAGG + Intergenic
967754512 3:193153828-193153850 CAGATACCTGTCCCTGAGGTAGG + Intergenic
967950161 3:194834510-194834532 AAGTCACCTCTTCCTGTGGAGGG + Intergenic
968130428 3:196189868-196189890 CAGGCACTTGTCCCTGAGGTTGG - Intergenic
968898609 4:3419910-3419932 TGGGCATCTGTTCCTGTGGAAGG + Intronic
969598639 4:8162903-8162925 CAGGTGCCTGTGCTTGTGGTGGG - Intergenic
970356968 4:15263952-15263974 CAGTCACCTGTTCCAGTCTTTGG - Intergenic
975306299 4:72852713-72852735 CACACACCGGGTCCTGTGGTGGG + Intergenic
979357050 4:119716449-119716471 CGGGCACCTGCTCCAGTGGGAGG - Intergenic
980096136 4:128492790-128492812 CAGGCTCCTGGTCCAGTAGTGGG + Intergenic
983899945 4:173122899-173122921 CAGGCAGCCCTTCCTGTTGTTGG - Intergenic
985033529 4:185816289-185816311 CAGGGACCAGATCCTTTGGTGGG - Intronic
985277494 4:188252087-188252109 CAGGCACCTGCCACTGTGCTTGG + Intergenic
987949280 5:24654887-24654909 CACACACCTGGGCCTGTGGTGGG - Intergenic
990900222 5:60741773-60741795 CAGGCACCTGTCACTGTGCCTGG - Intergenic
994007441 5:94855472-94855494 CTGGCAATTGTTGCTGTGGTAGG + Intronic
994368361 5:98941957-98941979 CAGGCACATGCCCCTGTGCTCGG + Intergenic
995068568 5:107890918-107890940 CAGGCAAATGTTTCAGTGGTTGG + Intronic
996683684 5:126256971-126256993 CAGGCACCAGTAGCAGTGGTTGG - Intergenic
998077354 5:139247382-139247404 CAGGCTCCTCTTCCTGTCTTGGG + Intronic
998373995 5:141679754-141679776 CAGTTACCTGTGCCTGTTGTGGG + Exonic
998435773 5:142107922-142107944 TTTGCACCTGTTCCTGTGGTCGG + Intergenic
998454876 5:142264101-142264123 CAGACACCGGGGCCTGTGGTGGG - Intergenic
998471751 5:142389159-142389181 CAGGCACCTGTCATTGTGTTTGG + Intergenic
1001542162 5:172547250-172547272 CAGGCACCGTTTCCTGAGATGGG + Intergenic
1001925301 5:175631629-175631651 CAGGCACTTTTGCCTGTGTTAGG - Intergenic
1002174877 5:177396295-177396317 CAGGCAACTGTGCCTTTGATGGG - Intronic
1003572396 6:7264294-7264316 CAGGCAAGCATTCCTGTGGTGGG - Intergenic
1005913839 6:30334501-30334523 CTGTAACCTGTTCCTGGGGTAGG + Intronic
1007107992 6:39296417-39296439 TAGCCACCTGTTCCTGTGGGTGG - Intergenic
1007415450 6:41688839-41688861 AAGTCCCCAGTTCCTGTGGTGGG - Intronic
1010042061 6:71396691-71396713 CAGGCAACTTTTCTTGAGGTGGG - Intergenic
1010498615 6:76567012-76567034 GAGGACCCTGTTCCTGTGGCAGG + Intergenic
1011349053 6:86402205-86402227 CAGGCATCTGGGCCTGTGATGGG + Intergenic
1017083620 6:150693042-150693064 CAGGGAACTGTTCCTGCGGTTGG + Intronic
1017689373 6:156948030-156948052 CAGGCACCTGCTCCTGAGCATGG + Intronic
1019351028 7:554043-554065 CTGGGAGCTGTTCCTGTGGGTGG - Intronic
1019724561 7:2594115-2594137 CAGGCACCTGTCACTGTGCCCGG - Intronic
1021709497 7:23401266-23401288 CCCGCAACTGTTCCTCTGGTGGG - Intronic
1024275457 7:47673478-47673500 CACCCACCTGTTCCTGTTGGAGG - Intergenic
1024951233 7:54862785-54862807 CAGGAACCCATTGCTGTGGTAGG + Intergenic
1025040991 7:55645722-55645744 CAGGGCGCTGTCCCTGTGGTAGG - Intergenic
1026897070 7:74015517-74015539 GAGCCAGCTGTTCCTGGGGTGGG - Intergenic
1027989199 7:85335216-85335238 CAGGCTCCTGGAGCTGTGGTGGG + Intergenic
1031496285 7:122452536-122452558 CAGGCACCTGTCACTATGCTTGG + Intronic
1033657343 7:143382438-143382460 CAGGCCTCCGTACCTGTGGTGGG - Exonic
1034466635 7:151233542-151233564 CAGGCTCCGGCTCCTCTGGTTGG + Exonic
1034488331 7:151380155-151380177 CAGGCCCATTTTCCTGGGGTGGG + Intronic
1039566066 8:38553520-38553542 CAGGCCCCTGCACCTGGGGTTGG + Intergenic
1042122821 8:65507112-65507134 CCAGCACCTGTTCCAGTGGAGGG + Intergenic
1044181991 8:89207633-89207655 CTGGCACTTGTTAATGTGGTGGG - Intergenic
1045370411 8:101517000-101517022 CATCATCCTGTTCCTGTGGTGGG + Intronic
1047432977 8:124808650-124808672 AAGGCACCTATTCCTCTGGGTGG - Intergenic
1048378474 8:133843726-133843748 CAGGGAGCTGGTCCAGTGGTAGG + Intergenic
1049246092 8:141563328-141563350 CAGGCACGTTTCCCTGTGGGAGG - Intergenic
1049319050 8:141986244-141986266 CATGCTCCTGTTGATGTGGTGGG + Intergenic
1049548362 8:143245336-143245358 CAGCCACCTGTTCTTGTTCTGGG - Intergenic
1049653715 8:143788655-143788677 CAGGAACCTGCTCCTGTGGCTGG - Intergenic
1053299345 9:36937570-36937592 CAGGCTCCTCTTCCTGTGTTTGG + Intronic
1056206990 9:84328783-84328805 CAGGCACCTGTCACTGTGCCTGG - Intronic
1056518764 9:87380606-87380628 AAGGCACCTTTTCCTCTTGTGGG + Intergenic
1056803849 9:89712969-89712991 CAGGCACCTGTGCCTCTTGTGGG + Intergenic
1056987503 9:91377056-91377078 CAGGCACCTGGGCCTGTTGTGGG - Intergenic
1057038768 9:91832655-91832677 CAGCCACCCTTCCCTGTGGTCGG + Intronic
1057945069 9:99319336-99319358 CAGGCATCTCTTTCTGTGGTTGG + Intergenic
1058451597 9:105101447-105101469 CAGGCACCTGCTACTGTGTCTGG + Intergenic
1059491572 9:114671967-114671989 CATGCACCTGTTCATGGGGTAGG - Intergenic
1059508886 9:114825499-114825521 CAGGCCCCTGCTCCTCTGCTTGG + Intergenic
1061620958 9:131810975-131810997 CAGGCACCTGCTCCTGTTAGGGG + Intergenic
1186004565 X:5054520-5054542 CAGGCATTTGTTCCTCAGGTGGG + Intergenic
1186911561 X:14173567-14173589 GAGCCACCTGGTCCTGGGGTTGG + Intergenic
1191952719 X:66610938-66610960 CAGCCACCTGTTCCTATGTGGGG - Intronic
1192235945 X:69296159-69296181 CATCCACCTGATCCTGAGGTGGG + Intergenic
1192509359 X:71712798-71712820 CCGACACCTGTCCCTGTGTTTGG + Intergenic
1192517338 X:71768755-71768777 CCGACACCTGTCCCTGTGTTTGG - Intergenic
1193271545 X:79534962-79534984 AAGGCATCTGGTCCTGTTGTGGG + Intergenic
1194333750 X:92618526-92618548 CAGACACCTGTATCGGTGGTGGG - Exonic
1195741246 X:108066804-108066826 CAGGGACCTGTTCCTGGTGGGGG + Intronic
1195781395 X:108469279-108469301 CAGGCACCTGTCACTGTGCCTGG + Intronic
1197809763 X:130430733-130430755 CAGGCACCTGCTCCTCAGCTGGG + Intergenic
1198004459 X:132478586-132478608 CATGCACCTGTTACTGAGTTAGG - Intronic
1199978668 X:152909014-152909036 CAGGCCACTGTCCCAGTGGTTGG + Intergenic
1200315927 X:155132992-155133014 GAGGCACCTCTGCCTGTGGAAGG + Intronic
1200443217 Y:3235224-3235246 CAGGCCCCTGTCCATTTGGTTGG + Intergenic
1200642434 Y:5737528-5737550 CAGACACCTGTATCGGTGGTGGG - Intronic