ID: 1112012759

View in Genome Browser
Species Human (GRCh38)
Location 13:95305814-95305836
Sequence CCTGTGAAGAAGGAAGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 1, 2: 8, 3: 59, 4: 474}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112012759_1112012764 17 Left 1112012759 13:95305814-95305836 CCCCACTCTTCCTTCTTCACAGG 0: 1
1: 1
2: 8
3: 59
4: 474
Right 1112012764 13:95305854-95305876 AACTTGTGAATACACTCTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112012759 Original CRISPR CCTGTGAAGAAGGAAGAGTG GGG (reversed) Intergenic
900392548 1:2440026-2440048 CCTGTGGAGAAGGGGGAGTCAGG + Intronic
900473585 1:2866072-2866094 CCTGTGCAGAGGGAAGACAGTGG + Intergenic
900803255 1:4750801-4750823 TCTGAGAAGAAGGAGGAGTGAGG + Intronic
900936285 1:5768272-5768294 CATGTGAAGAAGGCAGAGATTGG - Intergenic
901026516 1:6281286-6281308 CCTGTGGAGAAGGGAGGGCGGGG + Exonic
901269657 1:7942133-7942155 AATGAGGAGAAGGAAGAGTGAGG + Intronic
901930671 1:12594946-12594968 CCTGAGAAAATGGAAGAATGAGG + Intronic
901972487 1:12919023-12919045 CCTGTGAGGAAGTAAGAGTGAGG + Intronic
902012692 1:13282739-13282761 CCTGTGAGGAAGTAAGAGTGAGG - Intronic
902703821 1:18191004-18191026 GAAGAGAAGAAGGAAGAGTGGGG - Intronic
903563828 1:24249382-24249404 GTTGTGAAGAAGGAAGCATGTGG + Intergenic
904255990 1:29255182-29255204 CCTGGGTAGAAGGGAGAGTGGGG + Intronic
905482642 1:38271925-38271947 CCTGGGAAGGAGGAAGACTTTGG - Intergenic
906046869 1:42837945-42837967 CAAGTGAAGAGGGAACAGTGTGG + Intronic
906074637 1:43042979-43043001 CCTGTGAAAGAGGAAGGGGGAGG - Intergenic
906561094 1:46757512-46757534 CCTGTTAAGCAGGAGGAGTGGGG - Intergenic
906808868 1:48806263-48806285 CATGTGAAGATGGTAGAATGGGG + Intronic
907187071 1:52617695-52617717 CCTCTGGAGAATGATGAGTGGGG - Intergenic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
907717540 1:56941137-56941159 CCTGTGGACAAGGAAGTGTCTGG - Intronic
907965291 1:59323002-59323024 CCGGAGAAGAAGGCAGAGAGAGG + Intronic
908790274 1:67774305-67774327 TCTGTGGGGAAGGAAAAGTGGGG - Intronic
909427943 1:75549421-75549443 ACTAAGAAGAAGGAAGAGTGGGG - Intronic
909916734 1:81328787-81328809 TGTGTGTAGGAGGAAGAGTGGGG - Intronic
911054997 1:93701673-93701695 CCTGGGAAGCAGGCAGAGTGGGG - Intronic
911781529 1:101885571-101885593 GCTGAGAAGAAGGAAGAGAAGGG - Intronic
912663121 1:111552519-111552541 TCTGTGAAGATGGTAGAGTAAGG - Intronic
914810672 1:151025493-151025515 CCTGTGGAGAAGGGAGATGGTGG - Exonic
916077279 1:161209171-161209193 CCTGGGAAGAGGGAGGAATGTGG - Exonic
916832869 1:168510833-168510855 CCCTTGAAGAAGTAACAGTGAGG - Intergenic
917062559 1:171056403-171056425 CCAGTGAGGAAGGATGAGTCAGG - Intronic
917231983 1:172847156-172847178 TCTGTGAAGAAGGAAAGGAGAGG + Intergenic
917356433 1:174131191-174131213 CCAGTGAGGAAGGATGAGTCAGG + Intergenic
918273691 1:182929343-182929365 TGTGTGAAGAAGGAAGACTGTGG + Intronic
919077456 1:192830864-192830886 TTCATGAAGAAGGAAGAGTGTGG - Intergenic
919328803 1:196142671-196142693 CCATAGAAGAAGGAAGAGTTGGG + Intergenic
919733789 1:200931526-200931548 CATGTGAAGAAGGATGTGTTTGG - Intergenic
920229619 1:204461758-204461780 CCTGGGAGGAAGGAAGAGTGTGG + Intronic
920455643 1:206099127-206099149 CCAGAGAGGAAGGAGGAGTGAGG + Intronic
920821348 1:209384298-209384320 TGTGTGAAGAGGGAAGAGAGAGG + Intergenic
921159970 1:212465687-212465709 CCAGTGAGGAAGGAGGAGTGGGG - Intergenic
921397652 1:214685841-214685863 CCAATGAAGGAGGAAGAGAGGGG - Intergenic
922932795 1:229403365-229403387 CTTGAGCAGAAGGAAGAGTGAGG + Intergenic
923033350 1:230267083-230267105 CATGTGCACAAGGAAGAGAGGGG - Intronic
923134639 1:231107314-231107336 CCTGGGATGAAGGCAGAGTGTGG - Intergenic
923550438 1:234959023-234959045 CCTGAGAGAAAGGAAGAGAGGGG - Intergenic
923936464 1:238765733-238765755 CCTGTGGAGAGGGAAGAGACAGG + Intergenic
924481512 1:244439542-244439564 CTTGAGGAGAAGGAAGAGTCAGG - Intronic
924815976 1:247442555-247442577 GCTGTGCAGAAGGAAGAGAGAGG + Intronic
1062861676 10:815276-815298 CCTGTGATGTAAGAACAGTGGGG - Intronic
1063206431 10:3835966-3835988 CCTGCGAAGCAAGCAGAGTGGGG - Intergenic
1063312610 10:4968800-4968822 CCTGGGAAAAAGGAATTGTGAGG - Exonic
1063315325 10:4998747-4998769 CCTGGGAAAAAGGAATTGTGAGG + Exonic
1063905127 10:10773799-10773821 CATGTGAAGAAGGAAGAGGAGGG - Intergenic
1063983302 10:11473915-11473937 CCTGAGGAGAAGGAAGAATGAGG + Intronic
1064163580 10:12966909-12966931 CCTGGGAGGAAGGCAGGGTGTGG + Intronic
1064894027 10:20213467-20213489 CTTGTGAAGAAGAAAAAGTAAGG - Intronic
1066313914 10:34224592-34224614 CCTGTGAAGTAGGAAAACTTAGG + Intronic
1066489708 10:35882901-35882923 CCTGTGAGGCAGGAAGACAGGGG + Intergenic
1067248202 10:44564248-44564270 CCTGTTATGAAGGAAGAATAGGG - Intergenic
1067522807 10:47020880-47020902 CTTTTGGAGAAGGAAGAGTCTGG + Intergenic
1067726739 10:48776310-48776332 CCAGTGGAGAAGCAAGGGTGCGG + Intronic
1068224398 10:54087927-54087949 CCTGAGCAGGAGGAAGAGAGAGG - Intronic
1068712248 10:60147705-60147727 CCGGTGCAGGAGGAAGAGAGAGG - Intronic
1069014016 10:63407375-63407397 CCTATGAGGAAAGAAGACTGAGG - Intronic
1069197126 10:65565640-65565662 ACTGTAAAGAAGGATGAGTTAGG + Intergenic
1069606407 10:69741544-69741566 CCTGTGAGGAAGGCATAATGGGG - Intergenic
1070385526 10:75920657-75920679 CCAGAGAAGAAGGAGGAATGTGG - Intronic
1070680932 10:78448531-78448553 CCTGTGAAGGATAAAGGGTGGGG + Intergenic
1070741401 10:78905631-78905653 TCTGTGAAGGAGGCAGAGTGGGG + Intergenic
1072727771 10:97825150-97825172 CTGGTGCAGTAGGAAGAGTGCGG + Intergenic
1073054572 10:100690857-100690879 GATGTGAAGGAGGAAGGGTGGGG + Intergenic
1073167154 10:101465805-101465827 CATCTGAAGATGGAAGAGTTTGG + Intronic
1073197750 10:101707311-101707333 ACAGTGCAGAAGGGAGAGTGGGG + Intergenic
1073615229 10:104988209-104988231 CCTATCAACCAGGAAGAGTGGGG - Intronic
1073738491 10:106379441-106379463 CCTGTGAAGAGAAAATAGTGAGG - Intergenic
1074550219 10:114435809-114435831 GCGGCTAAGAAGGAAGAGTGAGG - Intronic
1074554763 10:114478020-114478042 CCAGTCAAGAAGGAAGGGAGAGG - Intronic
1075310808 10:121412122-121412144 CCAGTGGAGAAGAAGGAGTGAGG + Intergenic
1075313565 10:121434077-121434099 CCTGTGCAGGAGGAAGAATATGG + Intergenic
1075377707 10:121992564-121992586 CCTATGAAGAAGGTGGAGTGTGG + Intronic
1077491049 11:2861252-2861274 GGTGTGAAGAAGGAAGAGGCTGG - Intergenic
1078135033 11:8644705-8644727 CCTGAGAAGATGGCAGAGTTGGG - Intronic
1078332959 11:10441028-10441050 CCCCTGAAGAAGGAGGAGGGTGG + Intronic
1079516976 11:21281060-21281082 CTTGAGGAGAGGGAAGAGTGGGG + Intronic
1080642456 11:34165814-34165836 TCTGTGAATGAGGAAGACTGAGG - Intronic
1080800080 11:35602202-35602224 TCTGTGAGAAAGGAAGAGGGAGG + Intergenic
1081308189 11:41539232-41539254 GCTATGAAGAAAAAAGAGTGGGG + Intergenic
1081338155 11:41893656-41893678 CCTTGGGACAAGGAAGAGTGTGG - Intergenic
1081780013 11:45703736-45703758 CTTGAGAACAAGGAAGTGTGTGG + Intergenic
1081789624 11:45773768-45773790 CCTAGGAAGGAGGAAAAGTGGGG + Intergenic
1083050513 11:59772177-59772199 CTTGTGAAGAAGCAGGTGTGGGG + Intronic
1083274437 11:61588641-61588663 CCTGGAAAGGAGGAAGAATGAGG + Intergenic
1083439705 11:62667747-62667769 CCTGGGATGGAGGAAGAGAGGGG + Exonic
1083544223 11:63537163-63537185 CCTGAGGAGAAGCCAGAGTGTGG + Intronic
1083906237 11:65673216-65673238 CCTCTGAAGACTGAAGGGTGAGG - Intergenic
1084220573 11:67675037-67675059 CCTGTGAAGCCTGAAGAGTGAGG - Intronic
1084244196 11:67844693-67844715 ACTGGGAAGAAGGAAATGTGGGG + Intergenic
1085173986 11:74470900-74470922 CCTGGGAAGATGGGGGAGTGGGG + Intergenic
1085400788 11:76234360-76234382 CCTGGGAATAAGGAAACGTGAGG + Intergenic
1085479023 11:76806425-76806447 CCTGTGAAGACGGAAGAGGCTGG + Intergenic
1085776382 11:79370299-79370321 CCTGTGAAGTTGGAAGACAGTGG - Intronic
1086404728 11:86489813-86489835 CCTGTGAAGAATAAAGGGGGAGG - Intronic
1087601978 11:100328551-100328573 CCAGAGAAGAAGGAAGAGACAGG + Intronic
1087812916 11:102627687-102627709 CCTGTGAAGAAAGAAAAATCAGG - Intergenic
1087954194 11:104264651-104264673 GCAGGGAAGAAGGAAGAGTGTGG - Intergenic
1087983379 11:104645825-104645847 TCAGTGAAGTAGGTAGAGTGGGG - Intergenic
1088571541 11:111228210-111228232 TGTGTGAAGAAGGAGGAATGGGG - Intergenic
1088978516 11:114838900-114838922 CATGTGAAGATGGAAAAGGGAGG + Intergenic
1089746039 11:120617704-120617726 CCGGAGCAGGAGGAAGAGTGGGG - Intronic
1090065779 11:123502269-123502291 CCAGTGATGAAAGAAGAGTTAGG - Intergenic
1090340021 11:126009473-126009495 CCTGTCTAGAAGGAGGAATGTGG + Intronic
1090763237 11:129855228-129855250 CCTGGGCAAAAGGTAGAGTGTGG - Intronic
1091307065 11:134543050-134543072 CCTGGGAAGGAGGCAGAGAGGGG - Intergenic
1092810331 12:12266666-12266688 CCTGAGAGGTGGGAAGAGTGGGG - Exonic
1093669457 12:21855857-21855879 TCTCTTAATAAGGAAGAGTGTGG + Intronic
1094635939 12:32227240-32227262 CTGGTGATGAAGGAAGAGAGAGG - Intronic
1095546607 12:43378777-43378799 TCTGTGAAAATGGAAGAGTAAGG + Intronic
1095722278 12:45413602-45413624 CATTTGAAGAGTGAAGAGTGAGG + Intronic
1096194928 12:49643602-49643624 CCTGTGAAGAATGAACAGAGGGG + Exonic
1096244774 12:49978275-49978297 ATTGTGAAGATGGATGAGTGGGG - Intronic
1096376517 12:51115882-51115904 GCTGTGAAGAAGGGAGAATGGGG + Intronic
1096647022 12:53044441-53044463 GCTGGGAACCAGGAAGAGTGGGG - Intergenic
1096969812 12:55656649-55656671 CCTGTGCAGAATGAAGGGTTTGG - Intergenic
1097573189 12:61357332-61357354 CCTGTGATCCAGGAAGAATGAGG - Intergenic
1098432312 12:70433438-70433460 CCTGTGAAAAAAGAAGAAGGTGG + Exonic
1098738684 12:74142072-74142094 CCTGTTAAGATGGAAGATGGAGG + Intergenic
1099276020 12:80577304-80577326 CATGTGAAGAAGGAGGTGTTTGG - Intronic
1099419426 12:82437351-82437373 ACTGTAAAGCAGGAATAGTGGGG - Intronic
1099623238 12:85031430-85031452 TCTGTGAAGAAGAAAGAGAATGG + Intronic
1100294258 12:93246158-93246180 CCTGTGGGGTAGGCAGAGTGTGG - Intergenic
1100595785 12:96070884-96070906 ACTGTGTAGAACTAAGAGTGAGG - Intergenic
1100664278 12:96733986-96734008 GCTTTGAGGGAGGAAGAGTGTGG + Intronic
1100774862 12:97962810-97962832 GCTGTGAAGTAGGAACAGTCTGG - Intergenic
1101631579 12:106500182-106500204 CCTTTGAAGAAGAAAGTTTGAGG + Exonic
1103394276 12:120596053-120596075 CCTGGGGAGAAGCAAGAATGAGG + Intergenic
1103480115 12:121245309-121245331 GCTGGGGAGAAGGAAGAGGGAGG - Intronic
1103566363 12:121817776-121817798 CTGGGGGAGAAGGAAGAGTGGGG - Intronic
1103782406 12:123407728-123407750 CCTTTGAAGAAGGGAAAGTGGGG - Exonic
1104355173 12:128078852-128078874 CCTGTGAATAATGAAGAGGATGG - Intergenic
1105217692 13:18298758-18298780 CCTTTGAAGAAGGGAAAGTGGGG - Intergenic
1105502393 13:20983806-20983828 CCTGTGTAGAAGGAAAAGGAAGG + Exonic
1106256255 13:28024453-28024475 CCTGTGAGGAAGGTAGTGTTAGG + Intronic
1106370750 13:29130368-29130390 CCTGGGCAGAAGGAAGAGCGAGG - Intronic
1107318430 13:39159617-39159639 CTTGTGAACAATGAAGTGTGTGG + Intergenic
1107449423 13:40495227-40495249 AATATGAAGAAGGAAGGGTGGGG - Intergenic
1107859148 13:44644191-44644213 CCTGTGAGGAAGGAAAAGTGGGG + Intergenic
1108149312 13:47515579-47515601 CCTGGGTAGAAGGTAGGGTGTGG - Intergenic
1108493629 13:51004366-51004388 CGTGAGAGGAAGGAAAAGTGAGG + Intergenic
1108922392 13:55692461-55692483 CCTGAGAAGAATCAAGAATGAGG + Intergenic
1109342859 13:61084091-61084113 CCAGAGTAGAAGGAAGAGTGGGG + Intergenic
1109405978 13:61900862-61900884 CATGTGAAAAGAGAAGAGTGGGG + Intergenic
1110496635 13:76175336-76175358 CCTGTGAAGAAAGACACGTGAGG - Intergenic
1112012759 13:95305814-95305836 CCTGTGAAGAAGGAAGAGTGGGG - Intergenic
1112597387 13:100820806-100820828 CCTGTGAAGAATGCATATTGGGG - Intergenic
1114764934 14:25360215-25360237 CCTGTGAAGAAGGTAGAGGAAGG + Intergenic
1115203231 14:30875034-30875056 CCTGCGAAGAGAGAAGCGTGAGG - Exonic
1115755277 14:36522287-36522309 CCTGAGTAAAAGGAAGAGTTGGG + Intergenic
1117231702 14:53725568-53725590 CCTGGGAGGATGGAGGAGTGTGG - Intergenic
1117860634 14:60089252-60089274 TCTGGGAACAAGGCAGAGTGAGG + Intergenic
1118842702 14:69524971-69524993 ACTGTGTAGAAGGAACAGTGTGG - Intronic
1119175027 14:72562569-72562591 ACTGTGAAGGAGAAAGAGTGAGG + Intronic
1119325070 14:73755045-73755067 CCTGGGAAGGAAGGAGAGTGGGG - Intronic
1120054251 14:79903997-79904019 TCTGGGAAGATGGAAGAGTAGGG - Intergenic
1120175839 14:81292586-81292608 CATGTGAAGAAGGATGTGTTTGG + Intronic
1120285805 14:82499409-82499431 CATGTGAAGAAGGATGTGTTTGG + Intergenic
1120459569 14:84777571-84777593 CCTGAGCAGGAGGAAGAGTTGGG + Intergenic
1120513038 14:85438485-85438507 TCTGAGAAGAAGGAGGAGGGCGG + Intergenic
1121156738 14:91692279-91692301 CCTGGGCAGAAGGAACAGAGTGG - Intronic
1121286065 14:92736878-92736900 CTTGTGAAGAAGCAACAGTGAGG + Intronic
1122832054 14:104403182-104403204 CCAGAGAAGGAGGAAGGGTGGGG - Intergenic
1123501220 15:20882794-20882816 CCTGTGAAAAACAAAGACTGAGG - Intergenic
1123558472 15:21456499-21456521 CCTGTGAAAAACAAAGACTGAGG - Intergenic
1123594703 15:21893774-21893796 CCTGTGAAAAACAAAGACTGAGG - Intergenic
1124818043 15:33016754-33016776 CCGGGGAAGAAGGAGGGGTGAGG - Intronic
1125041507 15:35192553-35192575 CCTGTGAAGCAAGAAGGATGTGG - Intergenic
1126284585 15:46996541-46996563 CCAGTGAGGAAGGATGAGTCAGG + Intergenic
1126349373 15:47728854-47728876 CCTTTGAAGATGGAAGAGAGAGG - Intronic
1127462597 15:59212952-59212974 CCTGAGGAGGAGGAGGAGTGTGG + Intronic
1128114304 15:65095680-65095702 TATGTGGAGAAGGGAGAGTGGGG + Intronic
1128233973 15:66054492-66054514 CAAGTGAAGAAGCCAGAGTGGGG - Intronic
1129363175 15:75037292-75037314 CCAGAGATGAAGGAAGAATGTGG + Intronic
1129577165 15:76762652-76762674 CCTGTTACTAAGGTAGAGTGGGG - Intronic
1130235839 15:82132747-82132769 GCAGTTAAGAAGGAGGAGTGGGG + Intronic
1130744700 15:86638588-86638610 CATGTGAAGAACAAAGTGTGGGG - Intronic
1130773021 15:86944074-86944096 CAGGTGAAGAATGAAGGGTGGGG + Intronic
1131791684 15:95972440-95972462 TCTGTGAAGAAGGAGAAGTGAGG + Intergenic
1202966822 15_KI270727v1_random:183649-183671 CCTGTGAAAAACAAAGACTGAGG - Intergenic
1134206119 16:12239151-12239173 TCTGTGATGAAGGAAGAAGGAGG + Intronic
1134260064 16:12643998-12644020 CAAGTGAAGAGGGATGAGTGTGG + Intergenic
1134842776 16:17414928-17414950 CCCTTGGAGAAGGCAGAGTGAGG - Intronic
1135686093 16:24499429-24499451 CCTGTGGAGAAGGAACAGCGAGG + Intergenic
1135707640 16:24688452-24688474 CCAGGGAAGCAGGAAAAGTGTGG + Intergenic
1135899566 16:26444408-26444430 CCAGAGAAGAAGTTAGAGTGTGG + Intergenic
1136411866 16:30082462-30082484 CCTGGGGAACAGGAAGAGTGGGG - Exonic
1137264220 16:46855478-46855500 TCTGGGAAGAAGGGAGAGGGAGG - Intergenic
1137325584 16:47431986-47432008 GCTGTTAGGAAGGAAAAGTGTGG - Intronic
1137936020 16:52636326-52636348 ACTTTGAAGATGGAAGAATGAGG - Intergenic
1137936532 16:52640232-52640254 TGTGAGAAGAAGGAAGAGGGAGG + Intergenic
1138267551 16:55670843-55670865 CTTGCGATGGAGGAAGAGTGGGG + Intronic
1139073272 16:63410711-63410733 GCTGAGAAGAAGGCAGAATGAGG + Intergenic
1139233493 16:65309988-65310010 CCTGTAAGACAGGAAGAGTGGGG - Intergenic
1139267946 16:65657215-65657237 CCTGTGAAGGAGGCAGATTCGGG - Intergenic
1140604034 16:76512793-76512815 CCTATGAGAAAAGAAGAGTGTGG + Intronic
1141194274 16:81848273-81848295 CTTGGGAAGAAGCAAGAGAGGGG + Intronic
1141508186 16:84494668-84494690 CCCGTGAAGAAAAAATAGTGGGG - Intronic
1141756656 16:85995862-85995884 CCTCTGAAGAAGTGACAGTGGGG - Intergenic
1143737819 17:8925990-8926012 CATGTGAAGCGAGAAGAGTGAGG + Intronic
1144682456 17:17204924-17204946 GCTGTGCAGAAGGAACAGCGCGG + Intronic
1144781833 17:17812303-17812325 CCTGTGTACAGGGAAGAGAGGGG - Exonic
1144932901 17:18874592-18874614 GCTCTGAAGGAGGAAGGGTGTGG + Intronic
1145001077 17:19304990-19305012 CCTGTGGAGAAGGCAGGGTGAGG - Intronic
1145270755 17:21403698-21403720 GCTGTGATGAAGGGAGAGGGTGG + Intronic
1145308962 17:21691085-21691107 GCTGTGATGAAGGGAGAGGGTGG + Intergenic
1145765102 17:27453591-27453613 TCTGTGAGGAAGGAAAACTGTGG + Intergenic
1145841035 17:27994702-27994724 CCTGTGGAGAAGAAAGAATGGGG + Intergenic
1146123057 17:30211609-30211631 CCTGGGAGGCAGGAAGGGTGGGG + Intronic
1146458776 17:33027168-33027190 ACTTTGAAGATGGAAGAATGTGG - Intronic
1146519057 17:33512047-33512069 CCTGTGTAAAAGGAGGAGTTTGG + Intronic
1147036304 17:37684022-37684044 CCAGTGAGCAAGGAAGAGTGAGG - Intergenic
1147484306 17:40797281-40797303 CCTGGAGAGAAGCAAGAGTGTGG + Exonic
1147893031 17:43730695-43730717 TCTATGACTAAGGAAGAGTGAGG + Intergenic
1149278082 17:55067584-55067606 ACTTTGAAGAATGAAGAATGAGG + Intronic
1149396941 17:56254789-56254811 CCTGGAAAGAAGGGATAGTGAGG + Intronic
1150904298 17:69321145-69321167 ACTGGGATGAAGGAAGAATGTGG + Intronic
1151069272 17:71189717-71189739 CCGGGGAAGGAGGAAGAGAGAGG + Intergenic
1151305659 17:73261355-73261377 CCTGTAGAGAAGGAAGGGGGAGG + Intronic
1151391559 17:73790849-73790871 CCTCTATAGAAGGAAGAATGAGG - Intergenic
1151534459 17:74730763-74730785 CTGGTGAGGAAGGAAGAGAGTGG + Intronic
1151994926 17:77602493-77602515 CCATTTAAGAAGGAATAGTGGGG + Intergenic
1152640129 17:81445823-81445845 ACTGGGAAGAGGGAAGAGAGAGG - Intronic
1153236164 18:2990618-2990640 TCTGTTAAAAAGGAAGAGAGTGG + Intronic
1154138228 18:11799827-11799849 CCTGAGGACAAGGAAAAGTGGGG - Intronic
1155249709 18:23942924-23942946 CCTGTGAAGGAAGAAGAATGAGG - Intronic
1155905167 18:31442047-31442069 CCTGAGATGATGGAAGAGTTAGG + Intergenic
1156445434 18:37233342-37233364 CCTCTGAAGCATGGAGAGTGGGG + Intergenic
1156778485 18:40822050-40822072 CCAGTGAGGAAGGATGAGTCTGG - Intergenic
1157402701 18:47401136-47401158 CCTGGGTAGAAGGATGATTGTGG - Intergenic
1157403125 18:47402765-47402787 CCTGGGTAGAAGGATGATTGTGG - Intergenic
1158032169 18:52979246-52979268 CCTATGAAGACGGAGGAGAGGGG + Intronic
1158792766 18:60802082-60802104 CCTGTGAAGAAAATAGAGAGGGG - Intergenic
1160492380 18:79349101-79349123 CCTGTGAAGAGGGAATAGGTGGG + Intronic
1161335877 19:3713032-3713054 ACTTTGAAGTAGGAGGAGTGTGG - Intronic
1161569822 19:5024361-5024383 CATCTGAAGACTGAAGAGTGAGG + Intronic
1162183024 19:8883533-8883555 GCTGTGGAGGAGGAAGAGGGAGG + Exonic
1164540809 19:29120289-29120311 CCTGTGCAATAGGAGGAGTGTGG - Intergenic
1164611057 19:29631971-29631993 CCTGGGAAGATGGAACAGTAGGG + Intergenic
1164784630 19:30920252-30920274 CTTCTCAAGAAGGAAGTGTGTGG - Intergenic
1164816570 19:31208759-31208781 CCTCTGAAAGAGGAACAGTGTGG - Intergenic
1164855452 19:31517371-31517393 CGTGGGAAGAAGGAAGAAGGAGG + Intergenic
1165531916 19:36410095-36410117 ACTTTGAAGAAGGAAGATTGTGG - Intronic
1165559444 19:36666754-36666776 CCGGTGGAGAAGGAAGAGCTGGG - Exonic
1166924447 19:46257230-46257252 ACTGTGAAGAACGCAGAGGGCGG - Intergenic
1167683479 19:50940721-50940743 CCTGTGAAGAAGGACATGTTTGG + Intergenic
926509232 2:13752849-13752871 CCTGTGAAGAGAAAATAGTGGGG - Intergenic
927144531 2:20153925-20153947 CCAGAGCAGAAGGAAGAGAGAGG - Intergenic
927446180 2:23163954-23163976 CCTGAGGAGTAGGAAGAGGGGGG - Intergenic
929193397 2:39161574-39161596 CCTGTGAAGCGGGTAGAGCGCGG + Intergenic
932013478 2:68000865-68000887 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
932257061 2:70296955-70296977 CCTGTGTAGTAAGAAGAGTCTGG + Exonic
932775075 2:74523537-74523559 CCTGAGAAGAAGGGTGGGTGGGG + Exonic
932782338 2:74568399-74568421 CCTCTGGAGAAGGAAGAGTCCGG + Intronic
934296616 2:91747893-91747915 CCTTTGAAGAAGGGAAAGTGGGG + Intergenic
934918045 2:98316821-98316843 CCAGAGCAGAAGGAAGAGAGGGG - Intergenic
935115868 2:100135803-100135825 AGTGTGAAGGAGGGAGAGTGTGG + Intronic
936664285 2:114576463-114576485 CCTGGCAAGAAGGAAGCCTGGGG + Intronic
936849080 2:116873945-116873967 CCAGTGAAGAAGGGTGAGTCAGG + Intergenic
937076666 2:119112374-119112396 CATGTGAAGAGGAAAGAGTGTGG + Intergenic
937859815 2:126698821-126698843 ACTGTTAAGAAGGAAGAAAGAGG + Intergenic
937889913 2:126930958-126930980 CCTGAGCAGCAGGAATAGTGTGG + Intergenic
939350197 2:141027094-141027116 CCTTGGAAGAAGGAAAAGTGGGG + Intronic
940875775 2:158895808-158895830 ACTGGGTAGAAGGGAGAGTGGGG - Intergenic
941373988 2:164705079-164705101 CCTGTGAAGCAGGAAGAGTGAGG - Exonic
943816545 2:192264361-192264383 CATGTGAGATAGGAAGAGTGAGG - Intergenic
944093633 2:195942337-195942359 TTTGAGAAGAAGGAAGGGTGGGG + Intronic
944355177 2:198778986-198779008 CCTAGGAAGAGGGTAGAGTGGGG - Intergenic
944553298 2:200864903-200864925 CTTGTGAACAAGGAAAAGTGAGG + Intergenic
945254915 2:207795428-207795450 GATGTCAAGAAGGAAGAGGGAGG - Intergenic
945478768 2:210319616-210319638 CTTATGAAGAAGGAGGAGTTAGG + Intergenic
945531744 2:210963553-210963575 TCTGTGAAGAGTGAAGAGTGTGG - Intergenic
946084413 2:217156600-217156622 CCTATGAAGAAGGAAGGGACTGG - Intergenic
946316766 2:218921076-218921098 TCTGTGGAGAAGGAAGAATTGGG - Intergenic
947006277 2:225514813-225514835 GCTGTGGAGAAAGGAGAGTGGGG - Intronic
947480086 2:230491396-230491418 CCAGTGAGGAAGGATGAGTCAGG + Intronic
948271001 2:236673124-236673146 CATGTGAATATGGAAGTGTGAGG + Intergenic
948712505 2:239833754-239833776 CCTGTGAAGAAGGGGAAGAGGGG + Intergenic
948888929 2:240897487-240897509 CCTGTGGAGATGGAGGAGTGTGG - Intergenic
948976744 2:241468118-241468140 CCTGTGGAGGCGCAAGAGTGGGG - Exonic
1168900312 20:1358306-1358328 CATGGGAAGAAGGAGGAGGGAGG + Intronic
1169568588 20:6882500-6882522 CCTCTGAAGAACAAAGAGTTGGG + Intergenic
1169711565 20:8570331-8570353 CCAGTGAGGAAGGTAGAGAGTGG + Intronic
1170051344 20:12149087-12149109 CATGTGAAGAAGGCAGAGATTGG - Intergenic
1170196396 20:13693545-13693567 CAATTGAACAAGGAAGAGTGGGG - Intergenic
1170983194 20:21235030-21235052 CCTGTGATGAATGCAGAATGAGG + Intronic
1171290936 20:23982454-23982476 CCTGGGCAGCAGGAACAGTGGGG + Intergenic
1172850463 20:37958974-37958996 CCTGTGAACAAGAAAGAGAAAGG - Intergenic
1173290798 20:41713305-41713327 CTTGGGAAGAAGGAAGGGAGAGG - Intergenic
1173294904 20:41747894-41747916 CCTGTGGGGAAGTAAGAGTGGGG + Intergenic
1173329076 20:42059234-42059256 CCTGTGAGGAAGGCAGAGCAGGG - Intergenic
1174447659 20:50601662-50601684 CCTGTGGAGAAGGTTCAGTGCGG + Intronic
1174774587 20:53332062-53332084 CCTGTGCAGAAGGCAGGGTGGGG + Intronic
1175132157 20:56797455-56797477 CGTGTGAAAAAGGAAGAGACTGG - Intergenic
1175545449 20:59775155-59775177 CCTGTGATGAAGGGAGAAGGAGG + Intronic
1177645775 21:23898631-23898653 CCAGAGCAGGAGGAAGAGTGAGG + Intergenic
1179376317 21:40852822-40852844 CTTCTGAAGAGGGAAGAGTTGGG + Intergenic
1179588928 21:42392412-42392434 GCTGTGAGGAACGCAGAGTGAGG + Intronic
1180182017 21:46122250-46122272 TCTGTGCAGAAGAAAGTGTGAGG + Intronic
1180918516 22:19506205-19506227 GCTGGGAAGGAGGAAGAGTGAGG + Intronic
1181937757 22:26450786-26450808 CATGTGAAGAAGGATGTGTTTGG + Intronic
1182367068 22:29786394-29786416 CCTGTGTAGAAGCAGCAGTGGGG + Intergenic
1182759491 22:32710685-32710707 CCAGAGCAGAAGGAAGAGAGAGG - Intronic
1182799645 22:33021233-33021255 CCTGTGAAGTAGGAAGGGCAGGG - Intronic
1183310727 22:37108239-37108261 CCCAGGCAGAAGGAAGAGTGTGG - Intronic
1183523674 22:38311028-38311050 CCAGTGAAGATGGGAGAGTCAGG + Intronic
1184569961 22:45316402-45316424 GCTGTGAAAAAGGAAGTTTGTGG + Intronic
1184750096 22:46480683-46480705 CCTGTGTAGTAAGAAGAGTCTGG + Intronic
949772432 3:7593836-7593858 ACTGTGGAGAAGCAAGAGTAGGG + Intronic
949796058 3:7852324-7852346 CCTGTGAAAAATGAAGATTTTGG + Intergenic
950670560 3:14522926-14522948 CCTGCGAAGAAGGTGGAGTGGGG - Intronic
951988090 3:28643285-28643307 AATGTGAAAAAGGAAGAGCGCGG + Intergenic
952420195 3:33123452-33123474 CCAGAGAAGAAGGAAGAGAGCGG - Intronic
952537112 3:34322680-34322702 CCTGTGGAGCAGGAAAAGAGAGG + Intergenic
953751597 3:45612496-45612518 CCTATCAAGAAGTGAGAGTGTGG - Intronic
954731872 3:52670644-52670666 CCTGGGAAGAAGGGAAAATGGGG - Intronic
955299782 3:57766519-57766541 CCTGAGAAGAGGAAAGAGTCTGG - Intronic
956254584 3:67270536-67270558 CCTGAGATGAAGGAGGAGTTGGG - Intergenic
956562481 3:70595469-70595491 CCTGAAAACAAGGAAGATTGAGG + Intergenic
956960020 3:74388668-74388690 CCTGTGAAGAAAAAAGGGTAGGG - Intronic
957137119 3:76303206-76303228 ACTGTAAAGAAGGCAGAATGTGG - Intronic
957268855 3:78003166-78003188 CCAGTGAGGAAGGATGAGTCAGG + Intergenic
958617561 3:96515056-96515078 CTTGAGGAGAGGGAAGAGTGGGG + Intergenic
959040335 3:101414943-101414965 CCTGTGTAGTAAGAAGAGTCTGG - Intronic
959191033 3:103112117-103112139 ACTCTGAAGAAGGAAGAAGGTGG + Intergenic
959287428 3:104433931-104433953 CCTGTAAAGGGGGCAGAGTGAGG + Intergenic
960171917 3:114472372-114472394 CCTGGGAAAAAGGAAGAAAGAGG + Intronic
960632406 3:119745478-119745500 TATGTGAATAAGGAAAAGTGTGG - Intronic
961170858 3:124796817-124796839 CCTGGGCAGAAGGAAGAGAAGGG + Exonic
961399044 3:126621448-126621470 GCTGAGCAGAAGGCAGAGTGTGG - Intronic
961549547 3:127661184-127661206 TCTGTGAAGAAGGTACAGGGTGG - Intronic
961609795 3:128127571-128127593 GCAGTGAAGAAGGCAGAGGGAGG - Intronic
962269182 3:133965720-133965742 CCTGAGAAGAAGACAGAGGGAGG - Intronic
964007757 3:151852010-151852032 CCAGTGTGGAAGGAAGAGTCAGG + Intergenic
964171865 3:153779983-153780005 CCTGTAAAGAAGAATGAGGGGGG + Intergenic
965074821 3:163962985-163963007 CCAGAGCAGAAGGAAGAGAGAGG - Intergenic
968092555 3:195908213-195908235 TCTGTGCAGAGGGAAGAGAGGGG - Intronic
968614117 4:1569665-1569687 CCTGTGGGGGAGGAAGGGTGGGG + Intergenic
969083821 4:4640742-4640764 CCTGTGAAGCAGGGAGCCTGTGG + Intergenic
969301068 4:6297594-6297616 CCCGTGAAGAAGGCAGGCTGGGG - Intronic
969909387 4:10429272-10429294 CCAGTGGAGAAGAATGAGTGGGG - Intergenic
969960645 4:10941203-10941225 CATGTGAAGAAGGATGTGTTTGG + Intergenic
970020941 4:11567947-11567969 CCTGAGCAGGAGGAAGAGAGAGG + Intergenic
970287955 4:14539413-14539435 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
970497229 4:16638757-16638779 CCTCGAAAGCAGGAAGAGTGAGG - Intronic
970907148 4:21229187-21229209 TTTGTGAAGACGGATGAGTGGGG - Intronic
971559580 4:28059883-28059905 CCTTTGAAGAAGGAAGAGTATGG - Intergenic
972371820 4:38431324-38431346 CCTGACAGGAAGGAAGAGTCTGG + Intergenic
972388010 4:38586521-38586543 CCTTAAAAGAAGGAAGAGGGAGG - Intergenic
972446186 4:39146096-39146118 GCTGAGAGGAAGGAAGAATGGGG - Intergenic
972633963 4:40866237-40866259 CCTGTGAACATGGAAAACTGAGG - Intronic
973295053 4:48509403-48509425 CCTATGAAAAATGAAGTGTGTGG - Intronic
973584678 4:52377969-52377991 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
973647719 4:52966995-52967017 CCTGGAGGGAAGGAAGAGTGTGG - Intronic
973996246 4:56462300-56462322 TCTGTGAACAAGGATGAGAGTGG + Intergenic
974277171 4:59737585-59737607 CCTGTAAGGATGGAAGAGTTTGG - Intergenic
974540289 4:63225337-63225359 CCTGAGAAGAAAGAATAGTTTGG + Intergenic
975910693 4:79263287-79263309 CATGTGTGGAAGGATGAGTGTGG + Intronic
976397591 4:84572811-84572833 CATGTGGAAAAGGAAGGGTGAGG - Intergenic
976494526 4:85712223-85712245 CCTGTTAAGAGAGAAGAGGGTGG + Intronic
978361600 4:107936427-107936449 TCTGAGAAGAAGGATGAGTTTGG + Intronic
979969406 4:127115227-127115249 CCAGAGCAGAAGGAAGAGAGTGG - Intergenic
980348766 4:131661567-131661589 CCTTTAAATATGGAAGAGTGTGG + Intergenic
980638777 4:135544515-135544537 CCAGTGAAGAAGGGAGAGCCTGG + Intergenic
980723581 4:136728190-136728212 CTTGAGGAGAAGAAAGAGTGGGG - Intergenic
982528229 4:156506002-156506024 TCAGTGAGGAAGGAAGAGTCAGG - Intergenic
983448308 4:167880255-167880277 ACAGTGAAGAAGGAAATGTGGGG - Intergenic
984092118 4:175387474-175387496 CCTGTGAGGAAGGATGGGTCAGG - Intergenic
984621616 4:181959426-181959448 TGTGTGAAGAAGGAAGGGAGTGG + Intergenic
985573811 5:664561-664583 CCTGGGCAGAGGGCAGAGTGAGG - Exonic
986140667 5:5026642-5026664 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
987427274 5:17787403-17787425 CCTGTGAAGGGTGAAGGGTGAGG - Intergenic
988617506 5:32789607-32789629 CCTGTGAATAGGGAGAAGTGAGG - Exonic
989517532 5:42360904-42360926 TTTCTGAAGGAGGAAGAGTGAGG + Intergenic
990177287 5:53122142-53122164 CCTGAGATGAAGGACAAGTGTGG - Intergenic
990352803 5:54935573-54935595 CCTGAGAAGGAGAAAAAGTGAGG + Intergenic
990396526 5:55385549-55385571 TCAGTGAAGTGGGAAGAGTGAGG + Intronic
990898483 5:60725279-60725301 GCTGGGGAGAAGGCAGAGTGGGG - Intergenic
991035034 5:62120609-62120631 CTTGTGAAGAAGGAAGTATGTGG - Intergenic
991449113 5:66732974-66732996 GCTGAGAAAAAGGAGGAGTGGGG - Intronic
992942104 5:81772758-81772780 CTTTTGAAGATGGAAGACTGGGG - Intergenic
993442897 5:87978500-87978522 CCTGTGATGGAGGAAGGGTTTGG - Intergenic
995035000 5:107523540-107523562 CCTGCTAAGAAGGAAGACAGTGG + Intronic
995594203 5:113730963-113730985 CCAGTGAGGAAGGATGAGTCAGG + Intergenic
995666192 5:114544925-114544947 CCAGTGAAGAAGGATGGGTCAGG - Intergenic
996993333 5:129663910-129663932 ACTGTGTATAAGGAAGAGTAAGG - Intronic
997096946 5:130923964-130923986 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
997174111 5:131756235-131756257 CATGTAAAAAAGGAACAGTGAGG + Intronic
997224009 5:132195241-132195263 CCTGTGAAGAAAGGACAGGGAGG - Intronic
998660519 5:144231762-144231784 CATGTGAAGAAGGATGTGTTTGG + Intronic
999119557 5:149198626-149198648 CCTGTGATAGAGGCAGAGTGAGG + Intronic
999369872 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG + Intronic
999721792 5:154404078-154404100 CATGGCAAGAAGGAAGAGAGAGG - Intronic
999774398 5:154800437-154800459 CCTCAGAAGAAGGAAGGGAGAGG + Intronic
1000919512 5:167121541-167121563 CCTGAGAAGATGGGAGAGTTGGG + Intergenic
1001657705 5:173365250-173365272 CCTGTTAGCAAGGAAGAGGGAGG - Intergenic
1001873171 5:175175497-175175519 GATGTGAAGAAGGGAGAGTAAGG + Intergenic
1002682785 5:180981420-180981442 CCGGTGGAGAAGGAGGAGGGCGG + Intergenic
1002985067 6:2181770-2181792 CCTGAGGAGAGGGAAGAGGGAGG - Intronic
1003083953 6:3046103-3046125 CCTGTGTAGTAAGAAGAGTCTGG - Intergenic
1004352669 6:14903841-14903863 CCTGTGAAATAGGAAATGTGAGG + Intergenic
1005150923 6:22749576-22749598 CATGTGAAGAAGGAACAGACTGG - Intergenic
1005170623 6:22980714-22980736 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
1005223114 6:23610755-23610777 CCTGTGTAGGATGAAAAGTGTGG + Intergenic
1005509071 6:26495845-26495867 TCTGGGAAGAATGAAGAGAGGGG + Intergenic
1005952232 6:30640513-30640535 CCTGTGAGGAAGGAAGCGGCGGG - Exonic
1006212712 6:32411185-32411207 CTTGTGAAGCAGGCTGAGTGAGG - Intergenic
1006894246 6:37456648-37456670 CCTGTAGAGAGGGAAGACTGAGG + Intronic
1007341294 6:41192901-41192923 CCTGAGAAGAAGGGACAGGGTGG + Exonic
1007809461 6:44475936-44475958 CCTGTGAAGCAGGAACAAAGCGG - Intergenic
1010018076 6:71127709-71127731 CCTGTGAAGAATGATGACAGAGG - Intergenic
1010302976 6:74282986-74283008 CCTGTGTAGTAAGAAGAGTCTGG - Intergenic
1010773652 6:79861212-79861234 TCTGTGAAGACAGCAGAGTGAGG - Intergenic
1011348991 6:86401869-86401891 GCAGTGAAGAGGGAAAAGTGGGG - Intergenic
1011753116 6:90473100-90473122 GCTGAGCAGAAGGAAGAGGGAGG - Intergenic
1011944190 6:92880679-92880701 CCAGTGAGGAAGGATGAGTTAGG - Intergenic
1013030696 6:106329660-106329682 CAAGTGAAGAAGAAAGAATGTGG - Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1013934495 6:115577734-115577756 GATGTGAAGAAGGAAGAAAGAGG + Intergenic
1014317304 6:119883952-119883974 CTTGAGAAGAAGGATGAGTCTGG + Intergenic
1014932237 6:127348744-127348766 CGTGTGAGGAAAGGAGAGTGAGG + Intergenic
1017153305 6:151300582-151300604 CCTGTGGAGAAGGAAGTGGATGG + Intronic
1017398226 6:154028366-154028388 CGAGAGGAGAAGGAAGAGTGGGG - Intronic
1017893151 6:158655907-158655929 ATTGGGCAGAAGGAAGAGTGGGG + Intronic
1018007271 6:159634081-159634103 CATTTGAAGAAGAAAGAATGCGG - Intergenic
1018931093 6:168240895-168240917 CCTGTGATCAAGGAAGGGTCAGG + Intergenic
1019298280 7:290352-290374 CCTGGGACGAAGGAAGGGCGGGG + Intergenic
1019803768 7:3107549-3107571 CCTGTGAAGAGGGAACAGTGTGG + Intergenic
1020111814 7:5451877-5451899 CCTGGGAGGAGGGGAGAGTGGGG - Intronic
1021585956 7:22208642-22208664 CCTATAAAGAAGGAAGAATTGGG - Intronic
1021894452 7:25220974-25220996 CCTGTGAAGAGAGCAGAGTGTGG - Intergenic
1022293871 7:29031045-29031067 TATGTTAAGAAGGAAGACTGTGG + Intronic
1022634648 7:32120153-32120175 CCCGTGAGGAAGGATGAGTCAGG - Intronic
1023178378 7:37456097-37456119 CCTGTGGGGAAGGAAGAGTAAGG + Intergenic
1023464165 7:40435330-40435352 TCTGTGAGGAAGGAAGTTTGGGG + Intronic
1023475419 7:40572770-40572792 GCTGTGATGAACGAAGAATGAGG + Intronic
1023867797 7:44247047-44247069 GCTGTGTACAAGGAAGTGTGAGG - Intronic
1024013393 7:45290099-45290121 CCTGTGAAGAGAAAATAGTGGGG - Intergenic
1024238164 7:47413840-47413862 CCTGTCCCGCAGGAAGAGTGTGG - Intronic
1025235299 7:57230656-57230678 CCTGTGGAGAGGGACCAGTGAGG - Intergenic
1026384680 7:69834365-69834387 CAGGTGAAGAAGGCAGAGTGAGG - Intronic
1026391561 7:69907791-69907813 CAAGAGAAGAAGGAAGAGAGAGG + Intronic
1028644339 7:93078176-93078198 CCTGACAAGACAGAAGAGTGTGG + Intergenic
1028718210 7:93999212-93999234 CCTGTGAAGAAGAAAATGAGAGG - Exonic
1028897584 7:96059735-96059757 CCTGTGAAGATGGAGGACAGAGG + Intronic
1030161775 7:106516633-106516655 CCTGTGAAAAAGGAAGAAATGGG - Intergenic
1030366528 7:108653325-108653347 TCACTGAAGAAGGAAGAGTGAGG + Intergenic
1031894073 7:127327838-127327860 TCTGGGAAGAAGGAAAACTGAGG + Intergenic
1032491906 7:132330114-132330136 ATTGTGAAGACGGAAGAGAGAGG + Intronic
1032574773 7:133041632-133041654 CCTGTGAAAAAGGAAGATTTAGG - Intronic
1032696723 7:134343242-134343264 CCTGTGCAGAAGTGAGACTGGGG + Intergenic
1033658883 7:143390556-143390578 CCTGGGAAGAAGGAAGGGTGAGG - Exonic
1033659099 7:143391535-143391557 CCTGTGGGCAAGGAAGGGTGGGG + Exonic
1033705459 7:143882065-143882087 CCTGGGAGGAAAGAAGAGAGTGG - Intronic
1033966986 7:146987593-146987615 CCTGCGAAGAAGATAGAATGAGG - Intronic
1034336808 7:150329255-150329277 CCTGAGAAGAGTAAAGAGTGAGG + Intronic
1034878840 7:154748685-154748707 ACTGTGAAGGGGAAAGAGTGAGG - Intronic
1036863429 8:12373877-12373899 CCTGTGAAGAAATAAGAGGAAGG - Intergenic
1037351078 8:17956924-17956946 CCTGTGAAGAAAGATGAATAGGG + Intronic
1037697154 8:21233594-21233616 CCAGTGTAGGAGGAAGAGTTGGG - Intergenic
1038345039 8:26724940-26724962 CCACTGCAGAAGGGAGAGTGTGG + Intergenic
1038478436 8:27885165-27885187 CAAGTGAACAAGGAAGAGGGTGG + Intronic
1039402241 8:37279642-37279664 CCAGTGAGGAAGGATGAGTCAGG - Intergenic
1039421932 8:37450566-37450588 GCTGGGAAGAAGGGAGAGTCAGG + Intergenic
1040398029 8:47018378-47018400 CTTTTGAAGACTGAAGAGTGAGG + Intergenic
1040807104 8:51406952-51406974 CCTGTGATGCAGGAGGAATGGGG + Intronic
1041140840 8:54817492-54817514 CCTGTCTAGAAGGCAGAGAGTGG + Intergenic
1043057731 8:75461335-75461357 GCTTTGAAGAAGGAAGATGGCGG - Intronic
1043087430 8:75852470-75852492 CCTGTGAAGAAGTAAGAAACGGG - Intergenic
1043916813 8:85932403-85932425 GCTGGGGAGAAGGAAGAATGAGG + Intergenic
1044028468 8:87204084-87204106 CCTTTGAAGGATGAGGAGTGTGG + Intronic
1045129859 8:99139220-99139242 CCAGTAAAGGAGGCAGAGTGTGG - Intronic
1045578622 8:103453622-103453644 CATTTGTACAAGGAAGAGTGTGG + Intergenic
1046705124 8:117441099-117441121 GCTTTGAAGATGGAAGAATGGGG - Intergenic
1047462511 8:125080606-125080628 ACTGTCAAGAAGGAGGAGTCAGG - Intronic
1048254083 8:132892147-132892169 CCTGTGAAGAGGAAAGACTGTGG - Intronic
1048445091 8:134487386-134487408 CCTGTGAGGAAGGCAGGGTGAGG + Intronic
1048794598 8:138138186-138138208 CCTGTGGAGGAGGAGGAGGGAGG - Intronic
1051003624 9:12315266-12315288 CCAGTGAAGAGGGATGAGTCAGG + Intergenic
1051040388 9:12802441-12802463 CCAGAGCAGAAGGAAGAGAGTGG - Intronic
1051567362 9:18515720-18515742 CATGTCAAGATGTAAGAGTGGGG + Intronic
1052546655 9:29889009-29889031 CCAGTGAAGAAGGATGGGTCAGG - Intergenic
1052638082 9:31128558-31128580 CCTGTGTATAAGGAATAGAGGGG + Intergenic
1052740434 9:32387117-32387139 CCTATGTAGAAGGAAGAGTGGGG - Intronic
1052968142 9:34357879-34357901 CCATTGAAGAAGGAAGAAGGAGG - Intergenic
1052998583 9:34564915-34564937 CCTGTGAGGATGGATGAGTGAGG + Intronic
1053147811 9:35723841-35723863 CCTCGGAAGAAGAAATAGTGGGG + Intronic
1054926299 9:70592028-70592050 CATGGAAAGAAGGAAGAATGAGG - Intronic
1055920872 9:81459642-81459664 CATGAGAAGAAGAAACAGTGTGG - Intergenic
1056328347 9:85500963-85500985 GCTGAGAAGAGGGAATAGTGGGG - Intergenic
1056431804 9:86535357-86535379 CCTGTGAAGACAAAATAGTGTGG + Intergenic
1056715151 9:89022327-89022349 GCTTTGAAGAAGGAAGTGGGAGG - Intronic
1056798921 9:89677925-89677947 CCTAAGAAGAAGAAAGAGAGAGG + Intergenic
1057262860 9:93595650-93595672 TCTGTGAACAAGGATGAGTGCGG + Intronic
1057307890 9:93922759-93922781 ACAGAGAAGAAGGAAGAGGGAGG + Intergenic
1057445537 9:95111911-95111933 GCACTGAAGAAGGAAGACTGCGG + Intronic
1057935635 9:99236399-99236421 CCCGAGCAGAAGGAAGAGAGAGG - Intergenic
1057945752 9:99326537-99326559 CCTGAGACCAAGGAAGAGAGGGG + Intergenic
1058182076 9:101810306-101810328 CTGGAGAAGAAGGAAGAGAGAGG - Intergenic
1058555660 9:106163860-106163882 GCTTTGAAGATGGAAGAATGTGG + Intergenic
1059044960 9:110856363-110856385 CCTGTGAAGGAGTAACAGTCAGG - Intergenic
1059574124 9:115472186-115472208 CCTGGGAAAAACCAAGAGTGGGG - Intergenic
1059747266 9:117215002-117215024 CTTGTGAAGAAGGAAGAGCAGGG - Intronic
1060464082 9:123887236-123887258 CCTGTTAGGTAGGCAGAGTGAGG + Intronic
1060702855 9:125774168-125774190 CCGGAGCAGGAGGAAGAGTGTGG + Intronic
1187197706 X:17103899-17103921 CCTGTGAAGAGAGCAGAGAGTGG + Intronic
1187478541 X:19633800-19633822 TCTGTGAACTAGGAAGAGGGTGG - Intronic
1187592973 X:20739272-20739294 CCAGTGAAGGAGGGAGAGAGTGG - Intergenic
1188817697 X:34735674-34735696 CCTGTAAAGAAGAAATAGAGTGG + Intergenic
1189208121 X:39259310-39259332 GCTGAGAAGAAGGAAGGGGGAGG - Intergenic
1189297163 X:39927005-39927027 CCTGTAAAGAAGGGAGCTTGGGG - Intergenic
1190569012 X:51763098-51763120 CCTGTGAAGAGGTAACAGAGGGG + Intergenic
1190591424 X:52006441-52006463 CCTCTGAAAAGAGAAGAGTGCGG - Intergenic
1190789716 X:53686999-53687021 CTTGTGAAGAATGGGGAGTGTGG + Intergenic
1191083348 X:56537662-56537684 CGTGAGGAGAGGGAAGAGTGGGG + Intergenic
1192163642 X:68808815-68808837 ACTGTGAAGGAGGCAGAGAGAGG - Intergenic
1193216957 X:78875285-78875307 CCAGTGAAGAAGGATGGGTTGGG - Intergenic
1193629675 X:83867631-83867653 ACTCTGAAGGAGGAAGAATGGGG - Intronic
1193974905 X:88105793-88105815 CCTGTGAAAAATGAAGAGAGAGG + Intergenic
1194348248 X:92793285-92793307 GGTGAGGAGAAGGAAGAGTGGGG + Intergenic
1194561513 X:95427704-95427726 GGAGAGAAGAAGGAAGAGTGGGG + Intergenic
1194733714 X:97486917-97486939 TCTGGGGAGAAGGAGGAGTGGGG - Intronic
1195812674 X:108851599-108851621 CCAGTGAAGAGGGATGAGTCAGG - Intergenic
1195822366 X:108959706-108959728 CCTGTGTAGAAGGAAAAGACTGG + Intergenic
1195979349 X:110561151-110561173 CCAGTGAGGAAGGATGAGTCAGG + Intergenic
1196038045 X:111168527-111168549 CCTGTGAAGGGCGATGAGTGTGG + Intronic
1196054484 X:111340287-111340309 CCAGTGAGGAAGGATGAGTCAGG - Intronic
1197030099 X:121802916-121802938 CCAGTGAAGAAGCATGAGTCAGG + Intergenic
1197035801 X:121871316-121871338 TGTGTGAAGAAGCAAAAGTGGGG - Intergenic
1197738293 X:129869667-129869689 ACAGTGAATAAGGAAGAGGGAGG - Intergenic
1199308731 X:146297882-146297904 GGAGAGAAGAAGGAAGAGTGGGG - Intergenic
1199677347 X:150199549-150199571 CCAGGGAAGAAGGCAGAGTTGGG - Intergenic
1200656578 Y:5909914-5909936 GGTGAGGAGAAGGAAGAGTGGGG + Intergenic
1201261866 Y:12166422-12166444 CATTTGAAGTAGGCAGAGTGAGG + Intergenic
1201723341 Y:17128470-17128492 CCTGGGAAGAATGAGGACTGAGG + Intergenic