ID: 1112020623

View in Genome Browser
Species Human (GRCh38)
Location 13:95368080-95368102
Sequence CCACACCCGCTCCCAGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112020620_1112020623 11 Left 1112020620 13:95368046-95368068 CCTCTCAAAGTGCTGGAATTACA 0: 569
1: 23909
2: 322154
3: 260693
4: 142716
Right 1112020623 13:95368080-95368102 CCACACCCGCTCCCAGAGCTAGG No data
1112020619_1112020623 17 Left 1112020619 13:95368040-95368062 CCTTGGCCTCTCAAAGTGCTGGA 0: 245
1: 8211
2: 100201
3: 220185
4: 234666
Right 1112020623 13:95368080-95368102 CCACACCCGCTCCCAGAGCTAGG No data
1112020616_1112020623 21 Left 1112020616 13:95368036-95368058 CCCACCTTGGCCTCTCAAAGTGC 0: 1335
1: 34717
2: 137865
3: 236710
4: 214074
Right 1112020623 13:95368080-95368102 CCACACCCGCTCCCAGAGCTAGG No data
1112020617_1112020623 20 Left 1112020617 13:95368037-95368059 CCACCTTGGCCTCTCAAAGTGCT 0: 2348
1: 61485
2: 150722
3: 159544
4: 96134
Right 1112020623 13:95368080-95368102 CCACACCCGCTCCCAGAGCTAGG No data
1112020615_1112020623 24 Left 1112020615 13:95368033-95368055 CCACCCACCTTGGCCTCTCAAAG 0: 964
1: 24718
2: 77336
3: 156016
4: 160132
Right 1112020623 13:95368080-95368102 CCACACCCGCTCCCAGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112020623 Original CRISPR CCACACCCGCTCCCAGAGCT AGG Intergenic
No off target data available for this crispr