ID: 1112022133

View in Genome Browser
Species Human (GRCh38)
Location 13:95380718-95380740
Sequence GAGTGGGTTAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112022128_1112022133 4 Left 1112022128 13:95380691-95380713 CCCACTTTCGACTATATGCAAAT No data
Right 1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG No data
1112022129_1112022133 3 Left 1112022129 13:95380692-95380714 CCACTTTCGACTATATGCAAATT No data
Right 1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112022133 Original CRISPR GAGTGGGTTAATGCAAATTG AGG Intergenic
No off target data available for this crispr