ID: 1112026852

View in Genome Browser
Species Human (GRCh38)
Location 13:95419251-95419273
Sequence TTGGCACTATTGACATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112026852_1112026861 12 Left 1112026852 13:95419251-95419273 CCTCCAAATGTCAATAGTGCCAA No data
Right 1112026861 13:95419286-95419308 CTGCTCTCGGCCTGGCATGGTGG No data
1112026852_1112026856 -1 Left 1112026852 13:95419251-95419273 CCTCCAAATGTCAATAGTGCCAA No data
Right 1112026856 13:95419273-95419295 AGGTTGAGAAACCCTGCTCTCGG No data
1112026852_1112026858 9 Left 1112026852 13:95419251-95419273 CCTCCAAATGTCAATAGTGCCAA No data
Right 1112026858 13:95419283-95419305 ACCCTGCTCTCGGCCTGGCATGG No data
1112026852_1112026857 4 Left 1112026852 13:95419251-95419273 CCTCCAAATGTCAATAGTGCCAA No data
Right 1112026857 13:95419278-95419300 GAGAAACCCTGCTCTCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112026852 Original CRISPR TTGGCACTATTGACATTTGG AGG (reversed) Intergenic
No off target data available for this crispr