ID: 1112029066

View in Genome Browser
Species Human (GRCh38)
Location 13:95440431-95440453
Sequence TTGGGGAGGCTGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8159
Summary {0: 4, 1: 37, 2: 424, 3: 2158, 4: 5536}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112029066 Original CRISPR TTGGGGAGGCTGAAGCAGGA GGG Intronic
Too many off-targets to display for this crispr