ID: 1112029527

View in Genome Browser
Species Human (GRCh38)
Location 13:95444315-95444337
Sequence CTTGAATTGCAGAAGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112029524_1112029527 1 Left 1112029524 13:95444291-95444313 CCTAAATGAACTTGGGATAATTG 0: 1
1: 0
2: 1
3: 9
4: 235
Right 1112029527 13:95444315-95444337 CTTGAATTGCAGAAGGCAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 184
1112029521_1112029527 9 Left 1112029521 13:95444283-95444305 CCACTGCTCCTAAATGAACTTGG 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1112029527 13:95444315-95444337 CTTGAATTGCAGAAGGCAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112029527 Original CRISPR CTTGAATTGCAGAAGGCAGC AGG Intronic
902067322 1:13699456-13699478 CTTGAAGTGCTGAAGGCTCCAGG + Intergenic
907719136 1:56955033-56955055 GTTGTATTCCAGAAAGCAGCAGG + Intronic
908092299 1:60698982-60699004 CTTGATTTGCAAAAGGAACCAGG + Intergenic
909098894 1:71325151-71325173 CTTGAGTAGGAGAAGGAAGCTGG - Intergenic
909469458 1:76010752-76010774 CTTTAATATCAGAAGACAGCTGG + Intergenic
910290584 1:85596660-85596682 CTGGAATTGTAGAAGGAAGCGGG - Intergenic
910899316 1:92102313-92102335 CTAAAATAGCAGAAGCCAGCTGG - Intronic
912417598 1:109520637-109520659 GTTGAAAGGCAGAAGGCAGGAGG - Intergenic
915101521 1:153504294-153504316 ATGGCATTGCAGAAGGCAGCAGG - Intergenic
915225457 1:154407882-154407904 CTTGCATTGCAGTAGGAAGAGGG - Intronic
915577174 1:156787052-156787074 CTTGAATTCAAGATGGCAGCAGG + Exonic
916748047 1:167699439-167699461 CATGAATTGCAGCAGCCACCAGG - Intronic
916801351 1:168219588-168219610 CCTGAATTCCAAAAGGCAGGAGG + Intergenic
917005416 1:170410823-170410845 CAAGAATTGCAGAGGGCAGAGGG - Intergenic
917539056 1:175895933-175895955 CTTGAATTGCATATGGTAGGGGG + Intergenic
922241173 1:223756288-223756310 CTTGTTTTGCAGAAGGGAGTGGG - Intronic
922966406 1:229694537-229694559 CTTAATTTGCAGCAGGAAGCGGG + Intergenic
1062784271 10:248899-248921 CTTCCATTTCAGAACGCAGCTGG - Exonic
1063306267 10:4903649-4903671 CATGCACTGCAGAAGGCTGCAGG - Intergenic
1063453254 10:6165154-6165176 CATGCACTGCAGAAGGCTGCAGG - Intronic
1063939596 10:11113641-11113663 CTTAAATTGGAGAAGGCCTCTGG + Intronic
1064484278 10:15768591-15768613 TTTTAATTCCACAAGGCAGCTGG + Intergenic
1064522721 10:16220231-16220253 AAGGAATTGCAGAAGGCAACAGG + Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065472186 10:26093826-26093848 CTTGAATTTGAGATGGTAGCAGG - Intronic
1066350465 10:34632285-34632307 ATGGAATTGCTGAAGTCAGCAGG - Intronic
1070171817 10:73938632-73938654 CCTGAATTCCAAAAGGCAGGAGG - Intergenic
1071170126 10:82854511-82854533 CTTCAAATGCAGAAGGTATCTGG - Intronic
1071699347 10:87913403-87913425 CTTGAAGGACAGAAGGCAGTGGG - Intronic
1071711886 10:88057982-88058004 CTTGAATTGCAGATGCCATTTGG + Intergenic
1072035988 10:91563319-91563341 CTTCAACTGCATGAGGCAGCAGG - Intergenic
1072179522 10:92967845-92967867 CAGTAATTCCAGAAGGCAGCTGG - Intronic
1072583840 10:96764158-96764180 CTGGGATTACAGGAGGCAGCTGG + Intergenic
1074467792 10:113698766-113698788 CTTGAGAGACAGAAGGCAGCAGG + Intronic
1076296496 10:129389337-129389359 CCCGAATAGCAGAAGGGAGCAGG - Intergenic
1076593098 10:131603857-131603879 CTTAAAATCCAGCAGGCAGCAGG - Intergenic
1081946758 11:47002635-47002657 CTTAACTTGTAGAAGGCAGGGGG - Intronic
1083166711 11:60892978-60893000 CCTGAACTGCAGAAGGGAGTAGG - Intronic
1083234553 11:61343330-61343352 CTGGTATTGCAGAGGGCCGCGGG + Exonic
1089017686 11:115180408-115180430 GTTTAATTGGAGAAGGGAGCTGG + Intronic
1091152815 11:133344467-133344489 CTTGAATGTCAGAACGCAACAGG - Intronic
1091603344 12:1930864-1930886 CCTGAAATGCTGAGGGCAGCAGG - Intergenic
1091888000 12:4030977-4030999 CCACCATTGCAGAAGGCAGCGGG - Intergenic
1093591093 12:20903706-20903728 GTTGAATTGGAGAAGGAACCTGG - Intronic
1093777894 12:23098783-23098805 ATTCAATTGCAGAAGTCAGCAGG + Intergenic
1093983879 12:25506506-25506528 CTTGAATTACAGAAGAACGCTGG + Intronic
1096056881 12:48660498-48660520 CTGGAAATGCAGTGGGCAGCAGG + Exonic
1097606340 12:61759075-61759097 CTTGAAATACAGAAGGAAGCTGG - Intronic
1099308069 12:80982993-80983015 CTTGAATTCCAAAAGGAAGAAGG - Intronic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1101291190 12:103371362-103371384 CTTAAATGGCAAGAGGCAGCTGG + Intronic
1105766332 13:23563425-23563447 GTTGGAGAGCAGAAGGCAGCTGG + Intergenic
1105967493 13:25397918-25397940 CCTGAATTGTTGAAGGCAGCGGG + Intronic
1106749332 13:32743609-32743631 ATGGAAAGGCAGAAGGCAGCTGG - Intronic
1107876082 13:44791569-44791591 CTCACATGGCAGAAGGCAGCAGG - Intergenic
1108917868 13:55638016-55638038 CTTGAATGACAGAAGACAGTGGG + Intergenic
1110823435 13:79943527-79943549 ATTAAATTGAAGAAGTCAGCAGG - Intergenic
1112029527 13:95444315-95444337 CTTGAATTGCAGAAGGCAGCAGG + Intronic
1115418830 14:33168753-33168775 CGTGAATGGCAGAAGGAAGAGGG - Intronic
1116857585 14:49966564-49966586 TTTGCATTCCAGAGGGCAGCTGG + Intergenic
1118132692 14:62985048-62985070 CTTGATTTGCAGAAAGAAACAGG + Intronic
1119310855 14:73645131-73645153 CTTGAACAGCGGAAGGGAGCCGG + Intronic
1120781634 14:88490777-88490799 CTTGTATTTCAGACTGCAGCAGG - Intronic
1121577275 14:94998420-94998442 CTTGATTTGGAGAAGGAAGTAGG + Intergenic
1122821680 14:104349693-104349715 CTTGACCTACAGAATGCAGCAGG - Intergenic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1125039217 15:35163807-35163829 CTTGAACAGCAAAAGGCAACTGG + Intergenic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1131368095 15:91856244-91856266 GGTGACTTGCAGAAAGCAGCTGG + Intronic
1133442797 16:5835147-5835169 GTAGAATTGCAGAAGGCAACTGG + Intergenic
1133929698 16:10222304-10222326 CTAGAATTGCAGATGGAAGAAGG + Intergenic
1134432568 16:14224653-14224675 CTTGAAGACCAGAAGGCAGTGGG + Intronic
1135641720 16:24125470-24125492 TGTGAATTGCAGGAAGCAGCCGG - Intronic
1137384233 16:48026801-48026823 CTTACATGGCAGAAGGCAGAAGG + Intergenic
1137424886 16:48370039-48370061 ATTGAATAGCAGAAGACAGTGGG - Intronic
1138470459 16:57230775-57230797 CTTGCTTTTCAGGAGGCAGCTGG - Exonic
1138633293 16:58316515-58316537 CCTGAATTCCAGAAGGGAGGAGG - Intronic
1140133475 16:72184353-72184375 ATTGAATTGCAGAAGCCTGTGGG - Intergenic
1141035268 16:80620762-80620784 CTCGGATTGCAGAAGCCATCAGG - Exonic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1143996179 17:11008341-11008363 CTTCATTTCCAGAAGGCTGCTGG + Intergenic
1144436712 17:15249163-15249185 GTAGAATTGCAGTAGGCAGAGGG - Intronic
1146931683 17:36782464-36782486 CTTGGCTTTCAGAAGGCTGCAGG + Intergenic
1146980161 17:37152860-37152882 CTGGAAATGAAGAAGGGAGCAGG - Intronic
1149358194 17:55866075-55866097 CTTCAAATGCAGATGGCACCAGG + Intergenic
1149662094 17:58339354-58339376 CTTGAGTAGCAGAAGGCAGAGGG - Intergenic
1152237582 17:79146653-79146675 CTGGACTCGCAGATGGCAGCTGG - Intronic
1152293024 17:79451541-79451563 CTTGAATTGCAACTGGCAGGAGG + Intronic
1153238368 18:3010016-3010038 CTTGATTTTCAGCAGGAAGCTGG - Intronic
1153416037 18:4846651-4846673 GCTGAGTTGCAGAAGGAAGCAGG - Intergenic
1153616067 18:6934857-6934879 CATGAAGTCCAGAAGACAGCAGG - Intergenic
1154287656 18:13075194-13075216 CTCGCATGGCAGAAGGCAGAAGG - Intronic
1155873529 18:31056115-31056137 TATGAATTTCAGAAGGCAGAAGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1160035608 18:75299143-75299165 TTTGAATTGCAGTGAGCAGCTGG + Intergenic
1164415025 19:28039818-28039840 CTGGAATTGCTGAGTGCAGCTGG - Intergenic
1165360843 19:35336058-35336080 CTTGAATTTCTGGAGGGAGCTGG - Exonic
1167471723 19:49679450-49679472 CATGAATAGCAGAAGGGAGCGGG - Intronic
925455617 2:4014261-4014283 CTTGCATGGCGGAAGGCAGAAGG + Intergenic
926152579 2:10433053-10433075 CGTGAACTGCAGGAGGCAGGTGG - Intergenic
927674077 2:25091611-25091633 TTGGATCTGCAGAAGGCAGCTGG + Intronic
928047835 2:27955297-27955319 CTCAGTTTGCAGAAGGCAGCTGG + Intronic
929982916 2:46698541-46698563 CTTGAATTGCAGGAGGTGCCCGG + Intergenic
931676405 2:64700985-64701007 CTTGAATTAAAGAAGGCTGTGGG - Intronic
931891046 2:66672674-66672696 CTTGAATTGTAAAAAGCATCAGG - Intergenic
933326906 2:80849513-80849535 CATGAATAGCAGAGGGTAGCTGG + Intergenic
933750089 2:85597662-85597684 CCTAAATCGCAGAAGGCACCAGG + Intergenic
934559231 2:95303716-95303738 CTTGAGTGGCAGAGAGCAGCTGG + Intronic
934869643 2:97851315-97851337 GCTGAATTGAAGAAGGCAGAGGG - Intronic
936009238 2:108914789-108914811 CTTGATTTGGGGATGGCAGCTGG - Intronic
937952289 2:127397892-127397914 CTTGACTTGCAGGAAGCAGTTGG - Intergenic
938478159 2:131634792-131634814 GTTCAAGTGCAGAAAGCAGCCGG + Intergenic
938794914 2:134709761-134709783 CCTGAATTCCAGAAGGGAGGAGG - Intronic
939574056 2:143874750-143874772 CTTGAAGAGCAGAAGCCAGGCGG - Intergenic
940916890 2:159265952-159265974 CTGGCATAGCAGAAGACAGCTGG - Intronic
941220814 2:162778346-162778368 CTTAAATTGTAGTAGGCAGATGG + Intronic
941339105 2:164283600-164283622 GGTGAAATTCAGAAGGCAGCAGG + Intergenic
942891877 2:181000069-181000091 CAAAAATTGCAAAAGGCAGCTGG - Intronic
947888811 2:233597314-233597336 CTTGAAATGCAAGAGGCAGAAGG + Intergenic
948619213 2:239223447-239223469 GTGGAAATGCAGAAGGCAGGGGG + Intronic
1169843193 20:9961968-9961990 TTTGAAATCCAGAAGTCAGCTGG - Intergenic
1169853815 20:10081985-10082007 CTTTAATCACAGTAGGCAGCCGG + Intergenic
1171119751 20:22558118-22558140 CTTGTCTAGCAGAAGGGAGCAGG + Intergenic
1174225352 20:48994453-48994475 CTTGAAATGCATCAGCCAGCTGG + Exonic
1174839279 20:53886363-53886385 CTTGAATTACAAAAGGGAGGAGG - Intergenic
1177485660 21:21752057-21752079 CTTGAATTGGAGTATGCAGTGGG + Intergenic
1179349247 21:40591982-40592004 TCTGAATGCCAGAAGGCAGCTGG - Intronic
1182376248 22:29850530-29850552 CTTGCATGGCAGAAGGAAGAAGG + Intergenic
1184490767 22:44807503-44807525 TTAGAAATGCAGCAGGCAGCCGG + Intronic
953778324 3:45842285-45842307 CTGCAGTTGCAGAAGGTAGCGGG + Intronic
954314837 3:49795509-49795531 CTGGTCTTGGAGAAGGCAGCAGG - Intronic
959437392 3:106333257-106333279 CTTGAACTGCTGCAGTCAGCTGG - Intergenic
960292999 3:115909217-115909239 GTGGAATTTCAGAAGGCATCTGG - Intronic
960962477 3:123082105-123082127 CTGGACTTGCAGAAAGCAGAGGG + Intronic
961067651 3:123890045-123890067 CATGAATGGCAGCAGGCAGAGGG + Intergenic
962430438 3:135313801-135313823 CATGTATTGGAGAAGGCAGGTGG - Intergenic
962991089 3:140578050-140578072 CTTGAATTCCTCAGGGCAGCAGG + Intergenic
963065796 3:141263426-141263448 TTTGAATTGTAGAAGGGAACAGG + Intronic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
966084136 3:176046760-176046782 CATCAATTACAGTAGGCAGCAGG - Intergenic
984959109 4:185077393-185077415 CTGAACTTCCAGAAGGCAGCAGG - Intergenic
987075092 5:14373851-14373873 CTTGAGCTGCAGAACTCAGCTGG - Intronic
988897616 5:35694748-35694770 ATTGTATTGCAGAAGGCTGTAGG + Intronic
989312115 5:40031924-40031946 CTTGAATTTCAGAAGAGACCTGG - Intergenic
989398258 5:40981599-40981621 CTTGGAATCCAGCAGGCAGCTGG + Exonic
992162728 5:74018092-74018114 TCTGAATTGGAGTAGGCAGCAGG - Intergenic
994758066 5:103818862-103818884 CTTGGCTTGCAGATGGCTGCTGG - Intergenic
995236085 5:109832315-109832337 CAAAAACTGCAGAAGGCAGCAGG - Intronic
997919284 5:137963300-137963322 TTTGACTTACAGAAGACAGCTGG - Intronic
1000521720 5:162302880-162302902 CTTTAATGGCAGAAGGCAGAAGG + Intergenic
1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG + Intergenic
1002890083 6:1324648-1324670 ATTGAAGTGCAGCAGGCACCAGG - Intergenic
1003172234 6:3728994-3729016 CTTGGATTTGAGAAGGCACCAGG - Intronic
1006337176 6:33426869-33426891 CTTGAATTCCTGAAGGGAGGGGG - Intronic
1007827903 6:44615101-44615123 CATGAATACCAGGAGGCAGCAGG + Intergenic
1009384953 6:63076802-63076824 CTTTAACTGCAGTAGTCAGCAGG + Intergenic
1009658788 6:66581994-66582016 CTTGCATGGCAGAAGGCAGAAGG + Intergenic
1011150590 6:84268758-84268780 ATTGAATTGCAGAAGCTTGCAGG + Intergenic
1012956446 6:105576070-105576092 CTTCCATTCAAGAAGGCAGCAGG + Intergenic
1013535152 6:111057078-111057100 CTGGATTTGCACAAGCCAGCGGG + Intergenic
1015565176 6:134562860-134562882 CCTCAATTGCAGAGGGCAGGTGG - Intergenic
1016091671 6:139986626-139986648 TTTGAATTGCAGTAGGCTGCAGG + Intergenic
1018866488 6:167750587-167750609 CTTGAATTCCAAAAGGGAGGTGG - Intergenic
1018958557 6:168430494-168430516 CTGGACTTCCAGGAGGCAGCAGG + Intergenic
1025985776 7:66450226-66450248 CTTGAATTGCAGACTCCAGCGGG - Intergenic
1026002626 7:66573540-66573562 CTTGAATTGCAGACTCCAGCGGG - Intergenic
1026029229 7:66775215-66775237 CTTGAATTGCAGACTCCAGCGGG + Exonic
1026073661 7:67145684-67145706 CTTGAAATACAGTGGGCAGCAGG - Intronic
1026703225 7:72666492-72666514 CTTGAAATACAGTGGGCAGCAGG + Intronic
1027209002 7:76128772-76128794 CTTGAATTGCAGACTCCAGTGGG - Intergenic
1027735564 7:81928438-81928460 CTTGAATGTGAGAAGGCAGTAGG - Intergenic
1028318094 7:89429086-89429108 CTTGAAGTGCAAAATGCAGATGG + Intergenic
1029963598 7:104714241-104714263 ATTGAATTGAAAAAGGCAGTAGG - Intronic
1029990958 7:104962176-104962198 ATTGCGTTGCAGAAGGCAGAAGG - Intergenic
1032989559 7:137377613-137377635 CATGGAGTCCAGAAGGCAGCAGG - Intergenic
1033668810 7:143469782-143469804 CTTACATTGTAGAAGGCAGAAGG - Intergenic
1036950173 8:13132962-13132984 CTTGATGTGCAGAAAGAAGCCGG - Intronic
1037740645 8:21606335-21606357 CTTACATGGCAGAAGGCAGAAGG - Intergenic
1042335397 8:67624903-67624925 CTTTATGTGCAGAAAGCAGCAGG - Intronic
1046437323 8:114208390-114208412 GTTGAATTGCTGAAGGAAGCAGG - Intergenic
1047454957 8:124999770-124999792 TTTGAATTGCAAAAGGCGGCAGG + Intronic
1047504305 8:125466755-125466777 CTTGGACTGTGGAAGGCAGCTGG + Intergenic
1048421281 8:134280657-134280679 TTTAAAAAGCAGAAGGCAGCTGG + Intergenic
1050636484 9:7618251-7618273 CTTGAATTCCAAAAGGGAGGGGG - Intergenic
1053357439 9:37458349-37458371 CTTGTATTTCAGAATGCAGGAGG - Intronic
1054969356 9:71067416-71067438 GTTGAAGTGCAGAAGTTAGCAGG + Intronic
1058206509 9:102115403-102115425 CTTGCACTGCTGAAGGAAGCTGG + Intergenic
1060331415 9:122674412-122674434 CTTGCATGGCAGAAAGCAGGGGG - Intergenic
1061538877 9:131266617-131266639 GTTGAATAGCAGGAGGCACCTGG - Intronic
1062492310 9:136811851-136811873 CCTGAATTCCAGAAGGGAGGAGG + Intronic
1062598541 9:137309960-137309982 CTGGGATTGGAGAGGGCAGCTGG - Intronic
1186077339 X:5895013-5895035 CCTGCATGGCAGAAGGCTGCAGG + Intronic
1186873302 X:13793053-13793075 CCTGAATTCCAGAAGGGAGGAGG - Intronic
1187346773 X:18472729-18472751 CTTGCACTGCAGAAGACAGAAGG - Intronic
1188370938 X:29368966-29368988 ATTGAAAAGCAGAAGACAGCTGG + Intronic
1188507694 X:30900369-30900391 CTTGACTTGCAGAAGGCATGGGG + Intronic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1189448791 X:41107357-41107379 CTTGAAGGCCAGAAGGCAGTGGG - Intronic
1189486517 X:41437038-41437060 CTTGCATGGCAGAAGGCAGAAGG + Intergenic
1190739656 X:53280696-53280718 CTTTAATCGCAGGAGGCAGGAGG - Intronic
1192268035 X:69553660-69553682 CTTGAATTGGAGACTGCAGTAGG + Intergenic
1193487754 X:82107735-82107757 CTTGGATTGCAGAAGTCACACGG - Intergenic
1193782665 X:85722979-85723001 CTTGTATTTCAGAATGCAGGAGG + Intergenic
1195124513 X:101793251-101793273 TTACAAATGCAGAAGGCAGCAGG + Intergenic
1195178776 X:102336834-102336856 TTAAAAATGCAGAAGGCAGCAGG + Intergenic
1195180088 X:102350249-102350271 TTAAAAATGCAGAAGGCAGCAGG - Intergenic