ID: 1112032434

View in Genome Browser
Species Human (GRCh38)
Location 13:95470097-95470119
Sequence AACCCTGCAAATATGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112032431_1112032434 24 Left 1112032431 13:95470050-95470072 CCACTACATACAATGTACTGGGC 0: 1
1: 0
2: 0
3: 9
4: 66
Right 1112032434 13:95470097-95470119 AACCCTGCAAATATGGAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 139
1112032428_1112032434 27 Left 1112032428 13:95470047-95470069 CCACCACTACATACAATGTACTG 0: 1
1: 0
2: 0
3: 3
4: 110
Right 1112032434 13:95470097-95470119 AACCCTGCAAATATGGAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112032434 Original CRISPR AACCCTGCAAATATGGAACT AGG Intronic
901361220 1:8702925-8702947 GACCCTAGAAAGATGGAACTCGG - Intronic
907081818 1:51630373-51630395 AACCCAGAAAATATGGCACTTGG - Intronic
907658039 1:56364966-56364988 AACCCTGCATATTTTGGACTTGG - Intergenic
910119520 1:83770708-83770730 AATCCTCCAAATATCGAAGTTGG + Intergenic
911121777 1:94303444-94303466 CATCTTGCAAATCTGGAACTCGG - Intergenic
912011848 1:104976597-104976619 AACCCTACAAACCTGGAACAAGG - Intergenic
912870756 1:113303162-113303184 AACCGTTCAAATGTGGAACGGGG + Intergenic
916919758 1:169451952-169451974 AATCAAGTAAATATGGAACTAGG + Intronic
920462150 1:206149239-206149261 TACTCTCCAAATATGGAACCCGG - Intergenic
920462209 1:206149833-206149855 CACCTTCCAAGTATGGAACTTGG - Intergenic
921289666 1:213645733-213645755 AACCCTGCAAATCGGAAATTGGG + Intergenic
922033124 1:221823721-221823743 AACCTTGGAAATAAGCAACTAGG - Intergenic
922054718 1:222029909-222029931 ACCCCTGCATATATGAAACGTGG - Intergenic
922389158 1:225120772-225120794 AACCCTGAAAAAATGAATCTGGG + Intronic
923008895 1:230072882-230072904 ACCCCTGCAAATGTGCCACTTGG + Intronic
1063051101 10:2448538-2448560 AAACCTGGAAATATAGTACTAGG + Intergenic
1064833569 10:19499552-19499574 CACCCTGCAGATATTGGACTTGG + Intronic
1065456488 10:25911421-25911443 AATCCTTCAAATATGTAACTTGG + Intergenic
1067019097 10:42779789-42779811 TGCTCTGCAAAAATGGAACTGGG - Intergenic
1067660174 10:48231236-48231258 AACCCTACTAAAATGGAGCTGGG + Intronic
1072188849 10:93064771-93064793 AAACCTGCAAAGATGGGCCTAGG - Intronic
1074245077 10:111681399-111681421 AACCCAGCAATCATGGCACTTGG + Intergenic
1074831563 10:117253409-117253431 AATCCCGCAAATATGGGAATTGG - Exonic
1076535231 10:131172801-131172823 AACCATTCATATATGGAAATGGG - Intronic
1077753894 11:5004686-5004708 TACTCTGCAACAATGGAACTGGG - Intergenic
1079776704 11:24540706-24540728 AACTCTGGAAAGATGGAACATGG + Intronic
1079928300 11:26523972-26523994 AAAGCTACAAATATGGAAATTGG - Intronic
1085048653 11:73368101-73368123 AACCCTCCAAATATTGCACATGG - Exonic
1087150319 11:94854073-94854095 AACCCAGCAGGTAAGGAACTGGG + Exonic
1095642683 12:44502706-44502728 AACCCTGCGAAGAGGGAAATTGG + Intergenic
1099770309 12:87044086-87044108 AACCCTCCTAGTAAGGAACTTGG + Intergenic
1106129659 13:26929736-26929758 AACTCTGCAAATATGGCAAAGGG + Intergenic
1107838305 13:44430171-44430193 AATCCTGGATTTATGGAACTTGG + Intergenic
1108211554 13:48144669-48144691 TACCCAGCAGATATGGGACTGGG - Intergenic
1109080238 13:57890075-57890097 TACTCTGAAAACATGGAACTAGG - Intergenic
1111149158 13:84225909-84225931 AATCCTTCAAATATGAAATTTGG + Intergenic
1111660836 13:91208654-91208676 ATCCCTGCATATAAGGAACAAGG + Intergenic
1112032434 13:95470097-95470119 AACCCTGCAAATATGGAACTAGG + Intronic
1113366070 13:109676996-109677018 AACCTTGCATGTATGGAATTTGG - Intergenic
1120038476 14:79725536-79725558 AAACTTGCAAATGTGGAAGTTGG + Intronic
1126273179 15:46845709-46845731 TAACCTGAAAATGTGGAACTGGG - Intergenic
1127745657 15:61969001-61969023 AACCCTGGAAATGTGGCCCTAGG - Intronic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1134795367 16:17030715-17030737 AACCACTCAAATATGGAATTGGG - Intergenic
1148977654 17:51543832-51543854 AAAGATGCAAATATAGAACTAGG - Intergenic
1149225763 17:54468467-54468489 ACCCATGCAAATATGGAAGATGG + Intergenic
1153463936 18:5368043-5368065 AGCCCTGCAAAGTTGGAGCTGGG + Intergenic
1155155902 18:23157275-23157297 AAGTCTGCAAATATAGAACCTGG + Intronic
1156160093 18:34349334-34349356 CACCCTCCAAATACTGAACTAGG + Intergenic
1164556692 19:29258531-29258553 GAACCTGCAAAGATGGAAATGGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
925830177 2:7886173-7886195 AGCCATGCAAAGATGGCACTCGG - Intergenic
926459110 2:13106415-13106437 AACCCTGACAAAATGGAACCAGG + Intergenic
927942441 2:27113495-27113517 AAGCTTGCAAATATGTAAGTAGG + Intronic
929030153 2:37642631-37642653 AATCCTCCTAATATGGAACCTGG - Exonic
929183766 2:39071231-39071253 AATACTGCAAATATTGAACCTGG + Intronic
930462639 2:51702854-51702876 AAGCCTGCATATGTGGAACTGGG + Intergenic
932658997 2:73636035-73636057 AACCCTGCTCAAATGCAACTAGG + Intergenic
937792729 2:125979531-125979553 AAATCTGCAAATATGAAAGTGGG + Intergenic
942494463 2:176525273-176525295 AATCCTGCAAATAAGGAACATGG - Intergenic
944931398 2:204523835-204523857 AACCCTGCAACTGGAGAACTAGG + Intergenic
1171169567 20:23003363-23003385 TCCCCTGGAATTATGGAACTAGG + Intergenic
1172943114 20:38668049-38668071 AACTCTGCATATTTGGAAATAGG + Intergenic
1173057216 20:39626629-39626651 AACCCTCAAAATATGGAGGTTGG - Intergenic
1173606144 20:44333181-44333203 AAACCTGCCAAAATGCAACTGGG + Intergenic
1178455951 21:32751450-32751472 AACCCTACAAATATGTAATTGGG + Intronic
1180031507 21:45211805-45211827 CAGCCTGCAAAGAGGGAACTAGG - Intronic
1181293998 22:21820224-21820246 GACCCTGTAAATAGGGCACTTGG + Intronic
1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG + Exonic
949542012 3:5039915-5039937 AACCAGGCAAATATGGTACCTGG - Intergenic
949645279 3:6086234-6086256 AACCCTGGAAATATTTAATTTGG + Intergenic
954829208 3:53404330-53404352 ATCTCTTCAAATATGGAATTTGG - Intergenic
956453574 3:69398614-69398636 AGCCCTGGAAATAAGGAGCTGGG - Intronic
957602568 3:82356993-82357015 ACTCCTGCAAATACAGAACTGGG - Intergenic
960588273 3:119341563-119341585 AACCCTTGAAATATGGTTCTAGG + Intronic
966050779 3:175616538-175616560 AACTCTGAAAATATGAATCTGGG + Intronic
966152880 3:176884186-176884208 AACCCTGCACAAAAGCAACTGGG + Intergenic
966660410 3:182408319-182408341 GACCCTGCAAATATTTAACAAGG - Intergenic
967327606 3:188257795-188257817 CACTTTGCAAATAAGGAACTGGG + Intronic
970303658 4:14707813-14707835 AACCCTAAGAAAATGGAACTGGG - Intergenic
974204878 4:58688841-58688863 CACTCTGCAAATATAAAACTAGG - Intergenic
975344820 4:73281838-73281860 AACCCTGGAAATTGGGAACTGGG + Intergenic
976622282 4:87141319-87141341 TACCCAGCAAATTTGGAAATAGG - Intergenic
977289427 4:95147784-95147806 AGCCCTGCCAACATGGTACTAGG - Intronic
978817502 4:112925553-112925575 GTCCCTGCTAATATGAAACTTGG + Intronic
980549452 4:134315143-134315165 AAACCTTCATATATGGAACATGG + Intergenic
982484905 4:155954615-155954637 AACCCTGCAAATTATGTACTTGG - Intergenic
983015848 4:162610461-162610483 AAAGCTGGAAATATTGAACTGGG - Intergenic
984341438 4:178461884-178461906 AACCCTGCAAATATTGGAGGAGG + Intergenic
984457521 4:179988902-179988924 CACCCTGAAATTATGGATCTGGG - Intergenic
987504923 5:18755514-18755536 AACACTGAAAATATGTAACTGGG - Intergenic
989779442 5:45246895-45246917 AACCCTGGAGACATGGAACAAGG + Intergenic
991579217 5:68136773-68136795 AACCCTCCAAATATGCAAGTGGG - Intergenic
992975757 5:82117842-82117864 AACCATGAAAATATGGATTTGGG + Intronic
994755253 5:103787327-103787349 AAACCTGCAAATCAGGAATTTGG - Intergenic
996615189 5:125432989-125433011 AACCCTACAAATTAGCAACTTGG - Intergenic
996621559 5:125510333-125510355 AACCCAACAAACATTGAACTAGG - Intergenic
1000794712 5:165650728-165650750 ACCCCTGCAAATCTGGAAATGGG + Intergenic
1001861788 5:175062160-175062182 AACTCTGGAAAAATGGAGCTGGG + Intergenic
1002511304 5:179720177-179720199 TACCCTGAAATTAGGGAACTTGG - Intronic
1002561204 5:180083475-180083497 AACTCTGAAAATCTAGAACTTGG + Intergenic
1002838296 6:884070-884092 AACACTGAAAATAGGGCACTGGG + Intergenic
1005069430 6:21850903-21850925 AGCCATGCAGATATGGAAATTGG + Intergenic
1007346133 6:41230379-41230401 AACCCAGAAAATGTGGAAATTGG + Intronic
1007980894 6:46156998-46157020 AACCCTGGTGATATGGAAGTTGG + Intergenic
1011125983 6:84008328-84008350 AATACTGTAAATGTGGAACTAGG - Intergenic
1011773916 6:90707096-90707118 CACCCTGGGAAAATGGAACTTGG - Intergenic
1012649776 6:101738060-101738082 AACTCTTCTAATATGTAACTTGG + Intronic
1012650036 6:101741106-101741128 AAGCATGCAAGTATGCAACTAGG + Intronic
1015823878 6:137291674-137291696 AACTCTGTAAATGTGGAAGTTGG - Intergenic
1016198958 6:141384216-141384238 AACTATGCAAATAATGAACTAGG + Intergenic
1018002723 6:159594011-159594033 AATTATTCAAATATGGAACTAGG - Intergenic
1019002564 6:168767382-168767404 ACCCCTGCAAATATGGTATGAGG + Intergenic
1019228801 6:170539449-170539471 TAACCTGCAAATAAGGAAATGGG + Intronic
1020528511 7:9296597-9296619 TTTCCTGCAAATATGCAACTAGG - Intergenic
1021362170 7:19728996-19729018 AACCATTTAAATATGGAACTGGG - Intronic
1023356641 7:39373960-39373982 GACCCTTTAAATATTGAACTTGG + Intronic
1024602127 7:50992890-50992912 CACCCTGCAAATTTTGGACTTGG + Intergenic
1027580831 7:79993156-79993178 TAGTCTGTAAATATGGAACTAGG + Intergenic
1027830379 7:83169539-83169561 AACCTGGCAAATCTAGAACTTGG - Intergenic
1030367632 7:108663488-108663510 AATCCTGAAAAGATGGAAGTAGG + Intergenic
1031586787 7:123540077-123540099 TCCCCTGCAATTATGCAACTTGG - Exonic
1032468115 7:132159472-132159494 AAAGCTGCAGATATGGATCTGGG - Exonic
1032492836 7:132336978-132337000 CACCCAGGAAATCTGGAACTTGG + Intronic
1033736600 7:144228631-144228653 AACACTGAAAATTTGGAAATGGG + Intergenic
1033746456 7:144322319-144322341 AACACTGAAAATTTGGAAATGGG - Intergenic
1033944453 7:146699081-146699103 AACTTTGCAATTATTGAACTGGG - Intronic
1034331902 7:150290061-150290083 AAACTTGCAAATGTGGAGCTGGG - Intronic
1034666136 7:152819809-152819831 AAACTTGCAAATGTGGAGCTGGG + Intronic
1036495554 8:9267108-9267130 AACCCTGAAACTGTGAAACTGGG - Intergenic
1038898966 8:31820258-31820280 AACCCTGGAATTATGAAACTTGG + Intronic
1040815784 8:51507448-51507470 AACTCTGCAAAGATGGACTTGGG + Intronic
1042889034 8:73586495-73586517 CACCCTGCAAATAAGGAGATGGG + Intronic
1044317381 8:90765530-90765552 CAACCTACATATATGGAACTTGG - Intronic
1045500025 8:102738088-102738110 AACCCTGGCAATGTGGGACTGGG + Intergenic
1047942663 8:129840617-129840639 AACCCTTCAAAGATGAAAGTTGG + Exonic
1048641136 8:136363179-136363201 AACCTTGAAATTATGAAACTTGG + Intergenic
1048874012 8:138822555-138822577 AACCTTGCAGAGATGGAACAAGG - Intronic
1050859301 9:10405154-10405176 AACCTTCCAAAAAAGGAACTGGG + Intronic
1054314176 9:63563322-63563344 AAACATGCAGATATGAAACTTGG + Intergenic
1055170650 9:73254161-73254183 ATACCTGAAAATGTGGAACTGGG + Intergenic
1057866299 9:98684424-98684446 AACTCTCCAAATATGAAAATAGG + Intronic
1060120729 9:120987164-120987186 AAACCTAGAAATATGGATCTAGG + Intronic
1187110212 X:16290665-16290687 GACTTTGCAAATATGGCACTAGG - Intergenic
1188957465 X:36450101-36450123 ATACCTGAAAATGTGGAACTGGG - Intergenic
1191206344 X:57837136-57837158 AGCACAGCAAATATGGAATTAGG + Intergenic
1192163001 X:68802657-68802679 TAGGCTGCAGATATGGAACTGGG + Intergenic
1194252156 X:91589230-91589252 CACCCTCCAAAGATGGAACCAGG + Intergenic
1195557747 X:106246393-106246415 AACCCTCCAGATATAGTACTAGG - Intergenic
1196573563 X:117291875-117291897 AAACCTGCTAAGATTGAACTAGG + Intergenic
1200571087 Y:4830469-4830491 CACCCTCCAAAGATGGAACCAGG + Intergenic