ID: 1112032570

View in Genome Browser
Species Human (GRCh38)
Location 13:95471121-95471143
Sequence CACTGTGACCTGAAGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 324}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112032564_1112032570 22 Left 1112032564 13:95471076-95471098 CCTAGCCTCACAGAGGATTAGAA 0: 1
1: 0
2: 0
3: 13
4: 217
Right 1112032570 13:95471121-95471143 CACTGTGACCTGAAGGAAAAGGG 0: 1
1: 0
2: 3
3: 44
4: 324
1112032565_1112032570 17 Left 1112032565 13:95471081-95471103 CCTCACAGAGGATTAGAAGCCAC 0: 1
1: 1
2: 0
3: 10
4: 170
Right 1112032570 13:95471121-95471143 CACTGTGACCTGAAGGAAAAGGG 0: 1
1: 0
2: 3
3: 44
4: 324
1112032566_1112032570 -2 Left 1112032566 13:95471100-95471122 CCACTCTGAGCCAAATGATTTCA 0: 1
1: 0
2: 1
3: 25
4: 224
Right 1112032570 13:95471121-95471143 CACTGTGACCTGAAGGAAAAGGG 0: 1
1: 0
2: 3
3: 44
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112032570 Original CRISPR CACTGTGACCTGAAGGAAAA GGG Intronic
901130481 1:6959730-6959752 CAACGTAACCTCAAGGAAAATGG - Intronic
901318283 1:8323683-8323705 CAATGGGTGCTGAAGGAAAAGGG + Intronic
902315973 1:15618500-15618522 AACTGTGACCTGAAAGAAAAAGG - Intronic
902441264 1:16431615-16431637 CACTATGACCCTGAGGAAAAGGG + Intronic
903758795 1:25683619-25683641 AGCTGGGACCTGAAGGAAGATGG + Intronic
904339324 1:29823967-29823989 CAATTTCATCTGAAGGAAAAAGG - Intergenic
904366189 1:30012242-30012264 CACTGTGACCTTCAGCAAGATGG + Intergenic
904503733 1:30933814-30933836 CACTGTGACCTGGAGAGACAGGG - Intronic
904867161 1:33589215-33589237 CACTTTGCCCTCCAGGAAAATGG + Intronic
905188620 1:36215409-36215431 CGCTGTGGCCTGAAGGAACGTGG - Intergenic
905549982 1:38829830-38829852 TACTTTGAACTGAAGGAAAGGGG + Intergenic
906418688 1:45643953-45643975 CACTGTGCCCAGCAGGAAAATGG + Intronic
907580680 1:55569832-55569854 TACTGCTACCTGAAGGAAGAGGG - Intergenic
907720069 1:56963652-56963674 CTCTGAGACCTGAATGAAACTGG + Intronic
909043090 1:70676879-70676901 CCTTGTGACCTGCAGGAAGATGG + Intergenic
910329192 1:86050124-86050146 AACTGGGACCTGAAGGAGAACGG - Exonic
910854316 1:91679650-91679672 AACTGTATCCTGAAGGCAAATGG + Intergenic
911155703 1:94634797-94634819 GAATGTGACTAGAAGGAAAAAGG - Intergenic
911504824 1:98735914-98735936 CACTGTCACCTGCAGAAAGAAGG - Intronic
911873683 1:103132011-103132033 CACAGTGACCTGGATGAAATTGG - Intergenic
911912131 1:103650390-103650412 CAATGTCACCTGGAGAAAAAGGG + Intergenic
911916323 1:103701558-103701580 CAATGTCACCTGGAGAAAAAGGG - Intronic
911919546 1:103744528-103744550 CAATGTCACCTGGAGAAAAAGGG + Intronic
912008230 1:104930515-104930537 CACTGTGGCTTTAAGAAAAATGG + Intergenic
912667993 1:111600241-111600263 CAATGTGAGCTGAAAGAAGAGGG - Intronic
913107709 1:115629697-115629719 CTCTGGAACCAGAAGGAAAAGGG - Intergenic
914440653 1:147703213-147703235 CACTGTGCCCTGTAAGAGAATGG + Intergenic
915170489 1:153973851-153973873 CACTGTGAGGTGAAGGCAAGAGG - Exonic
916459015 1:165002346-165002368 TACTTTGACATGAATGAAAACGG + Intergenic
917298622 1:173549360-173549382 CACTGTAACCTGGAGCAAAGAGG + Intronic
917994452 1:180420775-180420797 CCCTGTGCCTTGAAGGGAAAAGG - Intronic
920656599 1:207880448-207880470 GACTGTGGCCTGAAGAAAAGTGG - Intergenic
921347958 1:214206658-214206680 CCATGTGACCAGAAGCAAAAGGG - Intergenic
923327245 1:232891141-232891163 CACTGTGAACTGGAACAAAATGG - Intergenic
923766267 1:236894997-236895019 CACTGTTCACTGCAGGAAAAGGG - Intronic
924882597 1:248178770-248178792 CACTATGACCTGTATGAACAGGG + Intergenic
924884686 1:248201865-248201887 CACTGTGACCTGTATGCACAGGG + Intergenic
1063914939 10:10871782-10871804 CACTGGGAGCTGAAGGAGAGAGG + Intergenic
1064973554 10:21090096-21090118 CACTGTGAGCTCCAGGAGAATGG + Intronic
1065178423 10:23100826-23100848 CACTGTGACAAGATGGAAAAAGG + Intronic
1065444340 10:25782030-25782052 TACTTTAACCTGAAGGACAATGG - Intergenic
1067925775 10:50506726-50506748 CTCTGTGACAGGAAGTAAAAAGG + Intronic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1069848916 10:71392544-71392566 CACTGTGCCCTGCAGGCAGAAGG + Intergenic
1071773081 10:88751888-88751910 CACTGTGACCTGAAGAATGGAGG + Intronic
1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG + Exonic
1072988249 10:100163529-100163551 CACAGTGACCTGGAGTATAAGGG + Intronic
1076055919 10:127372820-127372842 CACTCTAAACTGAAGGAAGATGG - Intronic
1077362741 11:2147907-2147929 CAAGGTGACCTGAAGGAACCCGG - Intronic
1077444352 11:2583421-2583443 GACTGTGACCTGCAGGGAGAGGG - Exonic
1078148301 11:8737467-8737489 CACTGTGACCTGACGAAGAGAGG + Intronic
1078466044 11:11551322-11551344 CACCCTCCCCTGAAGGAAAACGG + Intronic
1079743930 11:24101252-24101274 CACTGTGACCTGAGGGGAGCAGG - Intergenic
1080476675 11:32600151-32600173 AATAGTGACCTGAAGCAAAATGG + Intronic
1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG + Intronic
1083844274 11:65321804-65321826 CCCAGGGACCTGAAGGAAGAAGG - Exonic
1084264877 11:67999725-67999747 CACTGTGGCCTGAAGCCAAACGG + Intronic
1084425638 11:69083182-69083204 AACTGTGACTTTAAGGGAAATGG + Intronic
1084770543 11:71340311-71340333 GACTGTGACCTGCAGGACATGGG - Intergenic
1085023371 11:73222615-73222637 AAGTGTGACCTGCTGGAAAAAGG - Intronic
1085215789 11:74829838-74829860 CACTGGGGCCTGCAGGAGAATGG + Intronic
1085296359 11:75433932-75433954 GGGTGTGACCTGAGGGAAAAGGG - Intergenic
1086429121 11:86718250-86718272 TACTTTGAACTGAAGGAAAATGG - Intergenic
1086871010 11:92036573-92036595 CACTCTGGGCTGAAGGACAATGG - Intergenic
1087182754 11:95156002-95156024 CCCTGTTACCTGAAGGACAGGGG + Intergenic
1087245501 11:95831153-95831175 AACTGAGACCTGGAGAAAAAAGG + Exonic
1087826623 11:102771718-102771740 CATAGTGACCTGAAAGATAATGG + Intronic
1088792154 11:113235528-113235550 CCCTGTGACTTGCAGGAAGAGGG + Intronic
1089760538 11:120719631-120719653 TCCTGAGACCTGAAGGAAAGGGG - Intronic
1091651204 12:2311465-2311487 CACTGTTTTCTGAAGGTAAAGGG - Intronic
1092714273 12:11372262-11372284 CATTATTAACTGAAGGAAAATGG + Intronic
1095290534 12:40474692-40474714 CACTGTGACCTGAAACAACTTGG - Intronic
1095586054 12:43850563-43850585 AACTGAGATTTGAAGGAAAATGG - Intronic
1097226484 12:57479416-57479438 CACTGTCACCTGTGAGAAAAAGG + Exonic
1097473692 12:60027254-60027276 CACTTTGAATTGAAGGAAACTGG + Intergenic
1098214281 12:68199378-68199400 CAGAGAGACCTGAAGGAAATGGG + Intergenic
1101692429 12:107094062-107094084 CACTGGCTCCTGAAGGAAACCGG - Intergenic
1101848616 12:108384274-108384296 TACTGTCACCTGTAGTAAAATGG + Intergenic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1105904891 13:24798275-24798297 AACTGTGACTTTAAGCAAAATGG - Intronic
1106257023 13:28031339-28031361 AACTGAGTCCTGAAGAAAAATGG + Intronic
1106729130 13:32520706-32520728 CACAGTGATATGAAGGGAAAAGG + Intronic
1106762982 13:32885233-32885255 CAGAATGACCTGAATGAAAATGG + Intergenic
1107004290 13:35590186-35590208 CATTGTGGCTTGAAGGTAAAAGG + Intronic
1107124276 13:36829342-36829364 CAGTGAGAGCTGAATGAAAAGGG + Intergenic
1107528064 13:41253544-41253566 AGCTGTGACCAGAAAGAAAAAGG + Intronic
1108534925 13:51365595-51365617 CACTGTAAAATGATGGAAAAAGG + Exonic
1108941247 13:55956940-55956962 CATTATGAACTGAAGAAAAATGG + Intergenic
1109743882 13:66594662-66594684 CACTGGGACCTGATGGAGGAGGG - Intronic
1110140601 13:72124252-72124274 AACTGCGACTTGAAGCAAAATGG - Intergenic
1110335690 13:74327697-74327719 CACTGTGACATTTTGGAAAAAGG + Intergenic
1110663390 13:78085850-78085872 CACGTTCACCTTAAGGAAAAGGG - Intergenic
1110755796 13:79172262-79172284 CACAGTGACCTGAATAAAATTGG - Intergenic
1111176014 13:84597279-84597301 CATTATTACCTGAAGAAAAATGG - Intergenic
1111908685 13:94285611-94285633 TACTGTGGCCTGGGGGAAAAAGG - Intronic
1112032570 13:95471121-95471143 CACTGTGACCTGAAGGAAAAGGG + Intronic
1112093898 13:96111174-96111196 CAATGTGTCCTAAAGGAAAAAGG + Intronic
1112398021 13:99051130-99051152 CACTGTCACCTGAAGCAATGGGG + Intronic
1112594897 13:100798839-100798861 GACTGTGACATTAAGGAACAAGG - Intergenic
1113797009 13:113064290-113064312 CATTATGACCTGGAGGAGAAAGG - Exonic
1114600998 14:23955209-23955231 CACGGTGAGCTGCAGGGAAATGG + Exonic
1114610665 14:24037917-24037939 CACAGTGAGCTGCAGGGAAATGG + Intergenic
1115870962 14:37802221-37802243 CACTGGGGCCTGTAGGAAAAAGG + Intronic
1118355075 14:65006816-65006838 CACTGAGATATGAGGGAAAATGG + Intronic
1118454843 14:65935156-65935178 GAGTGAGACCTGAAGGAAATAGG + Intergenic
1119381309 14:74230667-74230689 CATTTTGACCTGCCGGAAAATGG - Intergenic
1122131573 14:99606874-99606896 AACAGCGTCCTGAAGGAAAAGGG + Intergenic
1122326578 14:100884355-100884377 CACACTGACCTGAAGGAATCGGG - Exonic
1123174537 14:106403886-106403908 CACTGCTAACTGAAGGACAATGG - Intergenic
1124764751 15:32479960-32479982 CCCTGTGACCTTAGGGAAAATGG - Intergenic
1125084209 15:35711693-35711715 AACTGAGACCTGTAGGAATAAGG - Intergenic
1125403786 15:39332335-39332357 CACTAAGACCTGAAGGAAAGAGG + Intergenic
1125681240 15:41531469-41531491 AACTGTGACCTGAAACCAAAGGG - Intronic
1125905556 15:43388825-43388847 AGCTGTGCCCTGAAGGAAAAGGG + Intronic
1127131341 15:55867742-55867764 CTCTGTGATTTGAAGAAAAAAGG + Intronic
1127211165 15:56776389-56776411 TACTTTGAACTGAAGGAAATTGG + Intronic
1127835293 15:62786043-62786065 CAGTGTGACCTGGAGTGAAAAGG + Intronic
1129275653 15:74443551-74443573 CGCTGAGACCTGAAGGGTAAGGG - Intergenic
1130328313 15:82899448-82899470 AACAGAGAACTGAAGGAAAAAGG + Intronic
1131388621 15:92029014-92029036 CTCTGGGGCCTGAAGGAAACAGG - Intronic
1131721616 15:95174681-95174703 CAATGTGACCTGGAGGAGAAGGG - Intergenic
1132423854 15:101697360-101697382 CACTGTCACCAGAAGTAACATGG + Intronic
1132473677 16:121311-121333 ATCTGTGAGCTGAAGTAAAAAGG + Intronic
1132562982 16:606946-606968 CACTGTGCCCTGCAGGAACATGG + Intronic
1133546505 16:6812877-6812899 CACTCTGACATGATGGACAAAGG - Intronic
1134447682 16:14343252-14343274 CTCTGTGAGCTGGAGGAAAATGG - Intergenic
1136538269 16:30913290-30913312 AACTGTGAGCTGAAGGAAGGAGG + Intergenic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1136875205 16:33848809-33848831 CACCGGGGCCTGAAGGAACAGGG + Intergenic
1137368566 16:47883086-47883108 CACAGTGACCTGAATGAGACTGG + Intergenic
1139274884 16:65718489-65718511 CACTGTGGCATGAAGGGTAAGGG - Intergenic
1141086853 16:81101958-81101980 CACTCTGACCTAGAGGAAAAGGG - Intergenic
1144379887 17:14684215-14684237 CACTGGGACCTGCTGGAGAATGG - Intergenic
1145110451 17:20156889-20156911 GACTGTCACGTGAAGCAAAAGGG + Intronic
1145992956 17:29090178-29090200 CACAGTGACCAGAAGGCAAGGGG + Intronic
1146427994 17:32762206-32762228 CCCTGTGACTGGAAGGAGAAAGG + Intronic
1146804632 17:35855512-35855534 CACTGTGGCCCCAAGGAACAAGG + Intronic
1147110106 17:38256227-38256249 CACTGTCACTTGAGGGAAAGGGG + Intergenic
1147849118 17:43427531-43427553 TCCTGTCACCTGAAGGGAAAAGG - Intergenic
1148139057 17:45315828-45315850 CACAGCCATCTGAAGGAAAACGG + Intronic
1148419407 17:47532194-47532216 CACTGTCACTTGAGGGAAAGGGG - Intronic
1148743886 17:49907871-49907893 CACTGTGCCCAGAAGGAGAGAGG - Intergenic
1149132297 17:53317145-53317167 CACTGGGACCTAAGGGACAATGG - Intergenic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151572450 17:74933646-74933668 CTCTGGGACCAGAAGGAAATGGG - Exonic
1151943249 17:77305835-77305857 AACTGTGACCAGATGGAAATGGG - Intronic
1154316274 18:13306253-13306275 CCCTGAGCCTTGAAGGAAAAAGG + Intronic
1155160360 18:23190384-23190406 CACTGTGAGCCGAAGGAAACCGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155707994 18:28839504-28839526 CATTGTTAACTGAAGAAAAATGG - Intergenic
1156069005 18:33182037-33182059 CATTGTGACTTGCAAGAAAAAGG + Intronic
1156852835 18:41747937-41747959 CACAGTGTCTGGAAGGAAAAAGG + Intergenic
1158130015 18:54142165-54142187 CCCTGTGACCTGAAGGTATTGGG + Intergenic
1159136180 18:64339313-64339335 CACTCTGTTCTGGAGGAAAAAGG + Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160422738 18:78758725-78758747 CACCGTGACCAGGAGGAAAAGGG + Intergenic
1161558070 19:4955593-4955615 GAATGTGGCCTGAAGGAAATGGG - Intronic
1162265153 19:9567063-9567085 CTCTGTGACTTTATGGAAAATGG - Exonic
1162876153 19:13622474-13622496 CTCTGTGTCTTGGAGGAAAATGG + Intronic
1165173884 19:33913217-33913239 CACTGTGACCTTATGAAAAGAGG + Intergenic
1165393401 19:35550917-35550939 CACTGGAACCTGAAGGCACATGG + Exonic
1166050371 19:40255597-40255619 AACTAAGCCCTGAAGGAAAAGGG + Intronic
1166546076 19:43635560-43635582 TCCTGTGTCCGGAAGGAAAAGGG - Intronic
1167978674 19:53254590-53254612 CACACTGACCTAAAGCAAAAAGG + Intronic
1168012043 19:53540845-53540867 CAGAGTGACGTGATGGAAAAGGG - Intronic
1168438168 19:56338880-56338902 CACTGTGAACTGAACTGAAAAGG + Intronic
925290155 2:2742540-2742562 CACTGAGACCTAAGGAAAAATGG + Intergenic
925342091 2:3144951-3144973 CACCCTGACCTAAAGGAACACGG + Intergenic
925783189 2:7402868-7402890 CTGGGTGCCCTGAAGGAAAAGGG + Intergenic
926144823 2:10390635-10390657 CACTGGGACCTGCAGAAAACCGG - Intronic
927945012 2:27130437-27130459 CACTTTGGCCCCAAGGAAAATGG + Intronic
928277321 2:29914835-29914857 AACTCTGACTTGAAGGAAAGGGG + Intronic
928464565 2:31511511-31511533 CACTGTTAGCTGAAGAAAAATGG + Intergenic
928564699 2:32533192-32533214 TACCGGAACCTGAAGGAAAAGGG + Intronic
929668567 2:43852275-43852297 CATTGTGACCCCAAGGATAAAGG - Intronic
929991767 2:46796280-46796302 CACTGTGACCTGGAGTAACCTGG - Intergenic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
933764817 2:85699536-85699558 CACTGTGTCCTGGAGAATAATGG + Intergenic
935279609 2:101506169-101506191 CACTCAGACCTGCAGGAAAGGGG + Intergenic
935682346 2:105648756-105648778 CACTGTGGCTTGAAGGAGCACGG - Intergenic
936029521 2:109059859-109059881 CACTGTGCCCAGGAGGATAATGG + Intergenic
937644683 2:124253116-124253138 AACTGTGACTTTAAGCAAAATGG + Intronic
938172240 2:129089483-129089505 CACTTTGCCCTGAAGGAGAAAGG - Intergenic
938942159 2:136178826-136178848 TACTTTGAACTGAAGGAAATTGG - Intergenic
939139100 2:138331989-138332011 CACAGTGACCTGGATGAAATTGG - Intergenic
939655484 2:144819007-144819029 AACTGGGAGCTGAAAGAAAAAGG - Intergenic
940192819 2:151060688-151060710 CACTGTGTGGTGAAGGTAAAGGG - Intergenic
941964894 2:171291326-171291348 CATTGTCAACTGAAGAAAAATGG - Intergenic
941967601 2:171314917-171314939 CACTGTGACCTTATGGAAAGTGG - Intergenic
942471392 2:176264269-176264291 GCCTGTGACAAGAAGGAAAATGG - Intergenic
942523250 2:176826600-176826622 AACTGTGACCTCAAGAACAAGGG - Intergenic
945068484 2:205967457-205967479 CAATGGATCCTGAAGGAAAAAGG + Intergenic
945610534 2:211995750-211995772 AACTGAGACCTGAAGGAACTGGG - Intronic
946521208 2:220467004-220467026 CAATATTACCTGAAGAAAAAAGG + Intergenic
948834369 2:240618686-240618708 AACTGTTACCTGTAGGAAACAGG - Intronic
1168882050 20:1215461-1215483 CACTGTGACATGAAGGTACAGGG - Intergenic
1172029302 20:31970271-31970293 CACTTTAGGCTGAAGGAAAAGGG - Intronic
1172336234 20:34118389-34118411 ACCTGTGACCTGAATGAAATGGG + Intergenic
1172675774 20:36670676-36670698 AAATGTTATCTGAAGGAAAATGG - Intronic
1173457734 20:43216843-43216865 CACTGTGCCCCGAAGCAAGAAGG + Intergenic
1173792575 20:45837235-45837257 CAGTGTGTCCTGAAGAAAACTGG + Intronic
1174349212 20:49955166-49955188 AACTGAGACCTGAATGAAATGGG + Intergenic
1174690426 20:52498899-52498921 CTCTGGGACCTGAATGACAAAGG - Intergenic
1175327243 20:58138243-58138265 CACTGTGAACTGAACTAAACTGG + Intergenic
1177139066 21:17339400-17339422 CAATGTGACCTGCAGAAAAATGG - Intergenic
1177991997 21:28047953-28047975 CATTGTGAGCTCAAGGAAGAAGG - Intergenic
1180166083 21:46030226-46030248 CACTGTCACCTGAGGGAACATGG + Intergenic
1181472699 22:23150760-23150782 CGCTGAGACCTGAAGGGGAAGGG - Intronic
1181990957 22:26836291-26836313 AACAGAGACCTGAAGGAACAAGG - Intergenic
1182659886 22:31917630-31917652 CACTGTGACCTGCAGCCCAAGGG - Intergenic
1184128557 22:42503677-42503699 AAATGTGAACTGAAGGAACAAGG + Intergenic
1184137351 22:42556992-42557014 AAATGTGAACTGAAGGAACAAGG + Intronic
1184524007 22:45010734-45010756 CACTCCGACCTGAATGAAGATGG - Intergenic
1184609494 22:45593721-45593743 CACTTTGTCCTGAAGGAAAGGGG - Intronic
1185014449 22:48334955-48334977 CTCTGTGAACTGAAGGAAAGAGG + Intergenic
1185051797 22:48557880-48557902 CATTGTGACCTCAAGGGACAGGG - Intronic
949786219 3:7744633-7744655 CACTTTCATCTGAAGGAAGAAGG + Intergenic
950531167 3:13553064-13553086 CACTGTGATATGAAGGTACAGGG + Intronic
950988141 3:17399188-17399210 CCCTGTGCCCTGAAGAAGAATGG - Intronic
951653787 3:24981973-24981995 TACTGTGACCTTAAGACAAAAGG + Intergenic
953778870 3:45847700-45847722 CTCTGAGCCTTGAAGGAAAAAGG - Intronic
954960204 3:54557917-54557939 CTCAGTGATCTGAAGGAATAAGG + Intronic
956037721 3:65113265-65113287 CACTGTGACTTGACGGATGAAGG - Intergenic
956084387 3:65594861-65594883 CACTGAGCACTGAAGGTAAAAGG - Intronic
956251842 3:67242213-67242235 TACAGTGACTTAAAGGAAAAGGG + Intergenic
958872818 3:99581202-99581224 AACTATTACCTGAAGGAAACAGG + Intergenic
959376895 3:105599151-105599173 CACATTGACCTAAAAGAAAAAGG - Intergenic
961443606 3:126967406-126967428 CCCAGTGACCTGAGGGAAAACGG - Intergenic
963114361 3:141713737-141713759 CAATGTGACCTGAGGAAGAAGGG + Intergenic
964086762 3:152827979-152828001 CACTTTGGCCTGGAGGAGAAGGG - Intergenic
964925588 3:161952776-161952798 AAGTGTGACCTGATGGAAACAGG - Intergenic
964989966 3:162798125-162798147 GACTCTTACCTGAAAGAAAATGG - Intergenic
965478870 3:169191424-169191446 CGTTGAGACCTAAAGGAAAAGGG + Intronic
965512184 3:169580424-169580446 CACAGTGAGCTAAAGGAAAAAGG - Intronic
965676953 3:171207563-171207585 CACTGCCACCTCAAGGAAAACGG - Intronic
966216278 3:177506484-177506506 CTCTGTGACCTTAAGTAAAGTGG - Intergenic
966907991 3:184541644-184541666 GGCTGGGACCTGAAGGAAAAAGG - Intronic
967374405 3:188784219-188784241 CACAGTGACCTGGATGAAATTGG - Intronic
967476604 3:189928470-189928492 CAGTCTCACCTGAAGGGAAATGG - Intergenic
967899512 3:194435295-194435317 AACTGGGGCCTGAAGGAAAGCGG - Intronic
968187332 3:196642135-196642157 CTCAGAGACGTGAAGGAAAAAGG + Intronic
969389845 4:6884284-6884306 CATTGTGAACTGAAGAGAAATGG + Intergenic
970090175 4:12397734-12397756 CAATGTGATCTAAAAGAAAATGG + Intergenic
970229361 4:13892911-13892933 CTCTGTGAGCTGGAGGAAACAGG - Intergenic
970548834 4:17158134-17158156 CACAGTGACCTGGATGAAATTGG - Intergenic
970873087 4:20838778-20838800 AACTATGACTTGAAAGAAAATGG + Intronic
971666888 4:29498718-29498740 CACTGTTCCATGAAGTAAAAAGG - Intergenic
971931450 4:33089389-33089411 CACTGTGGCCTGTAGATAAAAGG - Intergenic
971937748 4:33174341-33174363 CACTGTAAGCTGAAGAGAAAAGG + Intergenic
972965861 4:44508763-44508785 CACAGTGAGGAGAAGGAAAAAGG + Intergenic
974460002 4:62175012-62175034 CACTGTGGCCTCATGGAACATGG - Intergenic
976111505 4:81679225-81679247 CACTGTGACCTTACTGACAAAGG + Intronic
976604938 4:86973809-86973831 ATCTGTGGCATGAAGGAAAAGGG - Intronic
976969877 4:91091831-91091853 CACGGTCACCTGGAGAAAAAGGG + Intronic
977176235 4:93823337-93823359 GGCTGTGACATGAAGAAAAATGG - Intergenic
977866846 4:102038981-102039003 CACTGCTGCATGAAGGAAAATGG - Intronic
981011127 4:139926129-139926151 TTATTTGACCTGAAGGAAAAAGG + Intronic
981674062 4:147320678-147320700 CACTGTCACAGGAAGGAAGAAGG - Intergenic
982148228 4:152422013-152422035 CACAGTGAGCTGCTGGAAAATGG + Intronic
982678179 4:158399948-158399970 TACTTTGAACTGAAGGAAACTGG + Intronic
983029445 4:162781195-162781217 CACTGAGACCTAAAGGAAGAGGG - Intergenic
983167096 4:164491118-164491140 CACTGTTAACTGAAGAAAAATGG + Intergenic
983276341 4:165622195-165622217 CATTGTTACCTGGAGGAAACTGG - Intergenic
984331480 4:178325892-178325914 CACTGTGGACTGAAGACAAAAGG + Intergenic
984415572 4:179454032-179454054 CTCTGTGACCTTAATGACAAAGG + Intergenic
986376584 5:7138028-7138050 CACTGTTACCATAAGAAAAATGG - Intergenic
987035871 5:14017629-14017651 CACAATGACCAGCAGGAAAACGG - Intergenic
987639180 5:20589532-20589554 CACTGTCACCTAAAGTAATAGGG - Intergenic
988316772 5:29641374-29641396 CACTATTAACTGAAGGAAAATGG + Intergenic
988955450 5:36311885-36311907 TACTGTGAACTCAAGGCAAAAGG + Intergenic
989248765 5:39283124-39283146 CACTAGGACCTGATGGATAAAGG - Intergenic
990393756 5:55355281-55355303 CACTGGAGCCTGATGGAAAAGGG + Intronic
991289732 5:65021813-65021835 CACTGTGGCCTGTATGGAAAAGG + Intergenic
993188595 5:84652362-84652384 CATTGAGCCCTGAAGGAAATTGG - Intergenic
993189182 5:84659324-84659346 CATTGAGCCCTGAAGGAAATTGG - Intergenic
993887703 5:93435679-93435701 AACTATGACTTGAAGGAAATGGG - Intergenic
996347871 5:122507154-122507176 TTCTGTGTCCTGAAGGAAATAGG + Intergenic
997496353 5:134330194-134330216 CATTGTTAACTGAAGAAAAATGG + Intronic
997750760 5:136343315-136343337 CACTTTGAACTGAAGGAGATTGG + Intronic
998278013 5:140776882-140776904 CATTATTAACTGAAGGAAAATGG + Intergenic
998623160 5:143816499-143816521 CACAGTGACCTGGATGAGAATGG - Intronic
998835596 5:146200223-146200245 CATTATGAACTGAAGAAAAATGG - Intergenic
999117248 5:149174671-149174693 CAGTGTATCCTGAAGGAAAGAGG - Intronic
999197688 5:149793609-149793631 CACTGGGGTCTGAAGGAGAATGG - Intronic
999583576 5:153065816-153065838 CACTGTGACCTGGAGCAGCAGGG + Intergenic
1000199674 5:158995765-158995787 CACTGTGATATGAAGAAAGAAGG - Intronic
1000204632 5:159047177-159047199 CTCTGAGAACTGAAGGGAAAGGG + Intronic
1002823974 6:755867-755889 CTCTTTGACCTGAAGGGGAAAGG - Intergenic
1003429399 6:6025197-6025219 CATTGAAACCTGAAGGAAAAAGG + Intergenic
1004082973 6:12414122-12414144 CACTGAGACCTGAAAGTACATGG - Intergenic
1004661810 6:17717410-17717432 GAATGTGACCTGAAGGGAGAAGG + Intergenic
1004744208 6:18493650-18493672 CACTGTGTCCTGAATGAAATAGG + Intergenic
1005143482 6:22661404-22661426 CATTGTGGCAGGAAGGAAAAGGG + Intergenic
1005247570 6:23905933-23905955 CACTGGGGCCTGTAGGAAAAAGG - Intergenic
1005667974 6:28077329-28077351 ATCTGTGACCTTAAGGATAATGG - Intergenic
1007249131 6:40483772-40483794 AACTGAGACCTGAGGGTAAAGGG - Intronic
1007289139 6:40771819-40771841 CTCTGTATCATGAAGGAAAAAGG - Intergenic
1008612467 6:53197081-53197103 CACTTTAAACAGAAGGAAAATGG - Intergenic
1008675495 6:53813646-53813668 CACTGTGAGCTGTAGGAATCAGG + Intronic
1010469942 6:76215615-76215637 GACTTTGACCTGAAGGAAAAGGG - Intergenic
1010795549 6:80113285-80113307 CAGTGTTACCTGAAGGCCAAGGG - Intronic
1011217046 6:85015987-85016009 CACTGAGTCCTGAACCAAAAAGG - Intergenic
1011399848 6:86948650-86948672 CAGTGTGACCTGAACGATATGGG - Intronic
1011795168 6:90945314-90945336 CACTGTGACCTGAAAACAAGAGG - Intergenic
1011957682 6:93043663-93043685 CAATTGGACTTGAAGGAAAATGG - Intergenic
1013156333 6:107493584-107493606 CTCTGTGAGCTGAAAGAAAAAGG + Intronic
1013468769 6:110441855-110441877 CACTATTAACTGAAGAAAAATGG - Intronic
1013943151 6:115690254-115690276 CTCTCTGACCTCAAGGAACATGG - Intergenic
1014237369 6:118973520-118973542 GACTTTGACATGAAGGATAATGG + Intronic
1014296412 6:119623833-119623855 TTCTGTGACCTAAAGGAAGAAGG + Intergenic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1016863568 6:148745974-148745996 CTATGGGACGTGAAGGAAAAGGG + Intergenic
1017299436 6:152838842-152838864 CACTATTAACTGAAGAAAAATGG + Intergenic
1019269959 7:141464-141486 CACTGTGACCCGAACTCAAAGGG + Intergenic
1019587908 7:1814890-1814912 CCCTGAGACCTGGAGGAAAAGGG + Intergenic
1019995442 7:4721398-4721420 CACTGTCACCTGCAGGAAACAGG - Intronic
1020209803 7:6150192-6150214 GACAGTGACCCGAAAGAAAACGG + Exonic
1020258801 7:6518790-6518812 CACTGTGATCTAAAGGAATTTGG + Intronic
1022506144 7:30909712-30909734 GCCTGTGGCCTGAAGGGAAATGG + Intergenic
1029787270 7:102805376-102805398 CACAGTGACCTGAATGAGACTGG + Intronic
1030484256 7:110146563-110146585 CTCTGTGATCTTAAGAAAAAGGG + Intergenic
1030547382 7:110913748-110913770 CACTGTTAACTGAAGAAAAATGG + Intronic
1030644179 7:112041292-112041314 TCCTCTGACCTGAAGGAATACGG + Intronic
1031485991 7:122325209-122325231 CACAGTTACCTGAAGGAAGTAGG - Intronic
1032522255 7:132554285-132554307 CTCTGTCCCCTAAAGGAAAAGGG - Intronic
1032674008 7:134111415-134111437 CACTGTTACTTGAAGGTAAGTGG + Intergenic
1035108837 7:156463754-156463776 CACTGTGACCTGAGAATAAAAGG + Intergenic
1035325745 7:158064794-158064816 CGCTGTGACTTGGAGGAGAATGG - Intronic
1036463940 8:8978900-8978922 CACTGTGGCTTGGAGGCAAATGG - Intergenic
1039888805 8:41670877-41670899 CAAGGTGACCTGGAGGAAAGGGG + Intronic
1040974498 8:53175067-53175089 GACTGTGACCTTAAGAAAAAGGG + Intergenic
1041380206 8:57246930-57246952 CACTGTGACATTATAGAAAAAGG + Intergenic
1042973758 8:74441230-74441252 CACAATGTCCTGAAGGAAAGTGG - Intronic
1043741721 8:83822257-83822279 CTCAGTGACATGAAGAAAAATGG - Intergenic
1045210866 8:100098178-100098200 GATTGTGAACTGGAGGAAAAGGG + Intronic
1045499675 8:102735525-102735547 CAGAGTGACAAGAAGGAAAATGG + Intergenic
1046478095 8:114775964-114775986 CACTTTGAACTGAATGACAATGG + Intergenic
1047673175 8:127171256-127171278 AACTGAGACTTGAAGGAAACTGG - Intergenic
1047802604 8:128325632-128325654 ACCTGTGACCTGCAGGAAAAGGG - Intergenic
1048348065 8:133593007-133593029 CACTGTGGCCTTAAATAAAAAGG + Intergenic
1048706778 8:137162501-137162523 CACTGAAAACTGAAGGAAAGTGG + Intergenic
1049481395 8:142825423-142825445 CACCAGGACCAGAAGGAAAATGG - Intergenic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1052330022 9:27258303-27258325 CACTGTGTCGTCAAGGAATAAGG + Intergenic
1052662870 9:31458319-31458341 GATTGTGTGCTGAAGGAAAATGG - Intergenic
1052733410 9:32315981-32316003 CAATGTGAACTGAGGGAAAATGG - Intergenic
1053281214 9:36820750-36820772 CCCTGAGGCCTGAAGGACAAGGG + Intergenic
1055487573 9:76772124-76772146 CCTTGTAAGCTGAAGGAAAAGGG + Intronic
1055864531 9:80797145-80797167 CTCTGTGTGCTGAAAGAAAAGGG + Intergenic
1056485697 9:87055004-87055026 CACAGTGACCTTAGGGAGAAGGG + Intergenic
1056785412 9:89589196-89589218 CACAGTGACCTGAAGACAACAGG - Intergenic
1060047236 9:120350582-120350604 AACTGGGACCTGAAGGACCAGGG + Intergenic
1060192517 9:121602062-121602084 AACTGTGACCTGCAGGAAAATGG - Intronic
1060416081 9:123431735-123431757 CACTGAGACCTGGAGGGAATGGG - Intronic
1061717730 9:132531445-132531467 TACTGGGACCCGAAGGCAAAGGG + Intronic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1062731342 9:138111808-138111830 CTGTGTGCCCTGAAGGTAAAAGG - Intronic
1186457874 X:9724626-9724648 CACTATTAACTGAAGAAAAATGG - Intergenic
1186713471 X:12225719-12225741 TAGTGTGACCTGAAGGCAATTGG + Intronic
1187343473 X:18442059-18442081 CACTGTGACAGAAAGGACAATGG - Intronic
1187570855 X:20499916-20499938 CACTATGCTCTGAAGGAGAAGGG + Intergenic
1188245522 X:27832112-27832134 CTCTGTGACCTAGAGGAAAGAGG - Intergenic
1189188480 X:39074493-39074515 CACTGTGACCTGAGGAACAGAGG - Intergenic
1190034960 X:47013615-47013637 CATTATTAACTGAAGGAAAATGG + Intronic
1192201341 X:69068575-69068597 CTGTGGGCCCTGAAGGAAAAAGG - Intergenic
1194955220 X:100171067-100171089 CACTGATAACTGAAGGACAAGGG + Intergenic
1195382942 X:104288283-104288305 CACTGTGTCTGGAAGAAAAATGG + Intergenic
1195640484 X:107169413-107169435 CACTGTTACCTTAAGGAAATTGG - Intronic
1197094408 X:122575702-122575724 AACTGTGACCAAAAGCAAAAGGG + Intergenic
1197282791 X:124556693-124556715 CATTGTTAACTGAAGAAAAATGG - Intronic
1198970224 X:142271117-142271139 CACAGTCACCTGGAGAAAAAGGG - Intergenic
1199637975 X:149831603-149831625 CACTGTGACCTTGAGGATGAGGG - Intergenic