ID: 1112033840

View in Genome Browser
Species Human (GRCh38)
Location 13:95479949-95479971
Sequence CTTTATTAGCAGTGTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7013
Summary {0: 1, 1: 121, 2: 1390, 3: 1914, 4: 3587}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112033840_1112033848 14 Left 1112033840 13:95479949-95479971 CCATCTTCACACTGCTAATAAAG 0: 1
1: 121
2: 1390
3: 1914
4: 3587
Right 1112033848 13:95479986-95480008 GGGGAATTTATAAAGGAAGGAGG 0: 1
1: 124
2: 3981
3: 9062
4: 11232
1112033840_1112033849 22 Left 1112033840 13:95479949-95479971 CCATCTTCACACTGCTAATAAAG 0: 1
1: 121
2: 1390
3: 1914
4: 3587
Right 1112033849 13:95479994-95480016 TATAAAGGAAGGAGGTTTAATGG 0: 8
1: 736
2: 1080
3: 1755
4: 2080
1112033840_1112033843 -5 Left 1112033840 13:95479949-95479971 CCATCTTCACACTGCTAATAAAG 0: 1
1: 121
2: 1390
3: 1914
4: 3587
Right 1112033843 13:95479967-95479989 TAAAGACATACCCAAGACTGGGG 0: 24
1: 70
2: 85
3: 118
4: 348
1112033840_1112033846 7 Left 1112033840 13:95479949-95479971 CCATCTTCACACTGCTAATAAAG 0: 1
1: 121
2: 1390
3: 1914
4: 3587
Right 1112033846 13:95479979-95480001 CAAGACTGGGGAATTTATAAAGG 0: 6
1: 1472
2: 2590
3: 4265
4: 3857
1112033840_1112033841 -7 Left 1112033840 13:95479949-95479971 CCATCTTCACACTGCTAATAAAG 0: 1
1: 121
2: 1390
3: 1914
4: 3587
Right 1112033841 13:95479965-95479987 AATAAAGACATACCCAAGACTGG 0: 851
1: 2918
2: 5260
3: 7049
4: 8377
1112033840_1112033847 11 Left 1112033840 13:95479949-95479971 CCATCTTCACACTGCTAATAAAG 0: 1
1: 121
2: 1390
3: 1914
4: 3587
Right 1112033847 13:95479983-95480005 ACTGGGGAATTTATAAAGGAAGG 0: 2
1: 126
2: 430
3: 679
4: 885
1112033840_1112033842 -6 Left 1112033840 13:95479949-95479971 CCATCTTCACACTGCTAATAAAG 0: 1
1: 121
2: 1390
3: 1914
4: 3587
Right 1112033842 13:95479966-95479988 ATAAAGACATACCCAAGACTGGG 0: 2136
1: 4078
2: 7251
3: 8542
4: 9456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112033840 Original CRISPR CTTTATTAGCAGTGTGAAGA TGG (reversed) Intronic
Too many off-targets to display for this crispr