ID: 1112035869

View in Genome Browser
Species Human (GRCh38)
Location 13:95496109-95496131
Sequence ATGCAGACACAGCCTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 367}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112035869_1112035873 27 Left 1112035869 13:95496109-95496131 CCTTTCTCAGGCTGTGTCTGCAT 0: 1
1: 0
2: 5
3: 32
4: 367
Right 1112035873 13:95496159-95496181 CCCTCGCCTATACAACTTTATGG 0: 1
1: 0
2: 0
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112035869 Original CRISPR ATGCAGACACAGCCTGAGAA AGG (reversed) Intronic
900470761 1:2853854-2853876 CTGCAGACATAGCCTGTGTAGGG + Intergenic
901454909 1:9357708-9357730 CTGCATTCACAGTCTGAGAAAGG - Intronic
903809707 1:26028572-26028594 AGGCACACACAGCCTGAGTGTGG + Intronic
904790284 1:33015172-33015194 ATGCAAACACTGCCAGATAATGG + Intronic
904882177 1:33709141-33709163 ATCCAGACCCAGCCAGGGAAGGG - Exonic
905433408 1:37940852-37940874 ATGCAGCCTAAGCCTGAGAATGG + Intronic
907593514 1:55698615-55698637 ATGCAGCCTCAGCATGAAAAGGG - Intergenic
907739240 1:57148105-57148127 ATGGAGAGACAGCTTGAAAATGG + Intronic
907787974 1:57632572-57632594 AGGCAGACACAGACAGAGGAAGG + Intronic
908238506 1:62169778-62169800 GTGCAGACTCAGTCTGAGACTGG - Intergenic
909689198 1:78387642-78387664 ATGCAGCTACTACCTGAGAAAGG - Intronic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
912460220 1:109825475-109825497 ATGCAGAAACAGGCAGAGAGAGG + Intergenic
913315814 1:117550323-117550345 ATCCAGCAGCAGCCTGAGAAGGG - Intergenic
914907231 1:151756603-151756625 GTGCAGTCATAGTCTGAGAAGGG + Intergenic
914937394 1:151993321-151993343 ATGCAGACCCGGCCTGCGAGCGG + Intronic
916157087 1:161863111-161863133 ATTCAGACATAGCCTTAGAATGG + Intronic
917247945 1:173024688-173024710 ATGCAGGCACTGCCTGAAAGCGG - Intergenic
917444862 1:175098627-175098649 ATGTAGACAGACCCTGAGCATGG - Intronic
919007325 1:191913886-191913908 ATACAGAAACATCCTGAAAATGG + Intergenic
920903970 1:210142076-210142098 ATCAAAACAAAGCCTGAGAATGG + Intronic
920946677 1:210535701-210535723 ATGCAGATACAGCACAAGAAGGG - Intronic
922740376 1:228011001-228011023 GTGCAGACACTGGCTGAGCAGGG - Intronic
922788096 1:228293486-228293508 AGACAGACACAGCCTGAGGCAGG + Exonic
924000012 1:239540144-239540166 ATGAGGACACATTCTGAGAAAGG - Intronic
924000620 1:239547846-239547868 ATGCAAACATAGCTTGAGTATGG + Intronic
924561241 1:245157176-245157198 ACACACACACAGACTGAGAAGGG - Intronic
924833369 1:247622375-247622397 ATGGAGACACAGCCAGTCAACGG - Intergenic
924847082 1:247784732-247784754 ATGCAGGCACAACCAGAGAGTGG - Intergenic
1063818728 10:9809208-9809230 TTGCAGAGACAGCCTATGAAAGG - Intergenic
1065673176 10:28144523-28144545 ATGCAAAAGCAGCCTCAGAACGG - Intronic
1067264181 10:44722877-44722899 ATGAAGAGACAGCCAAAGAAAGG + Intergenic
1067461510 10:46461790-46461812 ATGCAGAGGCAGCCAGAGCACGG + Exonic
1067558721 10:47289644-47289666 AAGGAGCCACAGCTTGAGAAGGG - Intergenic
1067561431 10:47307500-47307522 ATGCAGAAACATCCAGAGAGAGG + Intronic
1067625684 10:47922811-47922833 ATGCAGAGGCAGCCAGAGCACGG - Intergenic
1069781256 10:70957120-70957142 CTGCAGAGAGAGTCTGAGAAGGG - Intergenic
1072268808 10:93755537-93755559 ATGAAGACACAGCCGAAGAAAGG - Intergenic
1072523706 10:96253220-96253242 ATGCAGATAAAGCCTAAGGATGG - Intronic
1073818859 10:107237226-107237248 CAACAGCCACAGCCTGAGAAGGG + Intergenic
1074366541 10:112862048-112862070 AAACAGACAGAGCCTGAGCAAGG + Intergenic
1075114494 10:119614458-119614480 ATGAAGACACTACCTGAGACTGG - Intergenic
1075603507 10:123787987-123788009 ATGCAAATACAGGCTGAGAGCGG + Intronic
1075742427 10:124704028-124704050 AGGCAGTCCCACCCTGAGAAGGG + Intronic
1076173021 10:128338772-128338794 ATACAGAGACAGGCTGCGAATGG + Intergenic
1077414155 11:2416749-2416771 AGGCAGACACAGCCCCAGCAGGG - Intronic
1077630965 11:3810736-3810758 AGGCACACAGAGCCTGGGAAGGG + Intronic
1078549474 11:12270286-12270308 ATACAGAGCCAGCCAGAGAAGGG - Intergenic
1078560056 11:12363539-12363561 ATGCAGACTCAGCCAGGCAAGGG - Intergenic
1079588296 11:22152268-22152290 ATTCAGACAGATCCAGAGAAGGG + Intergenic
1082165619 11:48946833-48946855 ATACTGACTCAGCCTTAGAAGGG - Intergenic
1082237590 11:49838157-49838179 ATACTGACTCAGCCTTAGAAGGG + Intergenic
1082658962 11:55886568-55886590 ATACTGACTCAGCCTTAGAAGGG - Intronic
1084789421 11:71463937-71463959 ATGCAGAGTCAGCTTGAGAATGG - Intronic
1086696752 11:89856093-89856115 ATACTGACTCAGCCTTAGAAGGG - Intergenic
1086709406 11:89988397-89988419 ATACTGACTCAGCCTTAGAAGGG + Intergenic
1087643183 11:100777290-100777312 ATGCACACCCAGCCTCAGAGAGG - Intronic
1087833990 11:102851547-102851569 ATGCTGACACATCCTTTGAATGG + Intergenic
1088401975 11:109431366-109431388 ACCCAGACACAGCCTTGGAAAGG - Intergenic
1088408297 11:109505108-109505130 ATGCAGAGACAGTATGAGTAGGG + Intergenic
1089335222 11:117718245-117718267 AGGCTGACACAGCCTGAGGATGG + Intronic
1091366647 11:135027129-135027151 ATGCACACACAACCTGAGGAGGG - Intergenic
1091656743 12:2351644-2351666 CTGCAGACACACCCTGGGGAAGG - Intronic
1092012369 12:5125224-5125246 ACGCAGACACTACCTGAGAGGGG - Intergenic
1092956303 12:13553454-13553476 CTGTAGACAAAGCCTCAGAAAGG + Exonic
1093202023 12:16199240-16199262 ATACACTCACAGCCTGGGAAAGG - Intronic
1093225319 12:16476149-16476171 ATGCAGCCAAAGACTAAGAAAGG + Intronic
1096479025 12:51925806-51925828 ATGCAGAAACAGACTTACAAGGG + Intergenic
1097290954 12:57914522-57914544 ATGAAGACACAGACTTAGAGGGG + Intergenic
1097660698 12:62427519-62427541 ATGGAGACAGACCCAGAGAAAGG - Intergenic
1097674782 12:62588135-62588157 AAGAAAACTCAGCCTGAGAATGG + Exonic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100850705 12:98707763-98707785 AGGCAGAGAAAGACTGAGAAAGG + Intronic
1102819403 12:115895115-115895137 ATGAAAACACACCCTGAGAAAGG - Intergenic
1103100567 12:118170814-118170836 ATGCAGAAAGAGCCTGAGCCTGG + Intronic
1103744774 12:123115048-123115070 ATGGAGACCCAGCCTCAGAAGGG - Intronic
1104308325 12:127630739-127630761 ATGCTTACACAGACAGAGAAGGG - Intergenic
1104725530 12:131073179-131073201 AGGCAGCCACAGCCTGATAGAGG - Intronic
1105852713 13:24349924-24349946 ATGCAGACACCACCTGAAAATGG - Intergenic
1106214339 13:27681320-27681342 ATGCAGTCTCAGTGTGAGAAAGG + Intergenic
1107130436 13:36888462-36888484 ATAAAGAAACAGCCTGAGACTGG - Intronic
1107831683 13:44379987-44380009 GTGCAGACATAGCCTTAAAAGGG + Intronic
1109829346 13:67766359-67766381 ATGCAAACACAGCTTTAGAAAGG - Intergenic
1110568275 13:76977920-76977942 ATGCAGATACAGGCTGGGCATGG + Intergenic
1110814691 13:79848414-79848436 TTGCAAGCACAGTCTGAGAAAGG + Intergenic
1112035869 13:95496109-95496131 ATGCAGACACAGCCTGAGAAAGG - Intronic
1112940308 13:104854090-104854112 ATGCAGTCACTGCCTGGGAATGG - Intergenic
1113811266 13:113144009-113144031 AACCAGACGCAGCCTGAGAGGGG + Exonic
1114027794 14:18544449-18544471 ATGCAAAACCAGCCTCAGAATGG + Intergenic
1114389759 14:22294301-22294323 AAGCAGACACAGACTGGGAGTGG - Intergenic
1114896299 14:26994914-26994936 ATGCAAGCACTGCCTGAAAATGG - Intergenic
1115310820 14:31976125-31976147 ATGCAGCCACCACCTGAGAGTGG - Intergenic
1117528156 14:56632260-56632282 ATGCAGACACAGTCACAGGAAGG - Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1119368525 14:74117189-74117211 ATGCAAGCACATCCTGAGTATGG - Intronic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1120016796 14:79483002-79483024 GTGCACACACAGCTTGAAAAAGG - Intronic
1120081972 14:80227150-80227172 ATGCAGGCACCACCTGAGAGTGG - Intronic
1120421570 14:84292624-84292646 ATGAAGACACAGGCAGAGACTGG - Intergenic
1120526630 14:85584407-85584429 ATTAAGACACAGCATAAGAAAGG - Intronic
1120555937 14:85930059-85930081 ATGCAGGCACCACCTGAAAATGG - Intergenic
1121611886 14:95286916-95286938 AGGCAGACCCAGGCTGTGAAAGG + Intronic
1121940070 14:98062115-98062137 ATGAACGCACATCCTGAGAAAGG - Intergenic
1122674686 14:103401845-103401867 ATGCAGGGAGAGCCTTAGAAGGG + Intronic
1122908593 14:104815376-104815398 ATGCAGACACAGCAAGGAAAGGG - Intergenic
1123116614 14:105897695-105897717 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123118669 14:105906944-105906966 ATGCGGGCAGAGCCTGAGCAGGG - Intergenic
1123120894 14:105916562-105916584 ATGCGGGCAGAGCCTGAGCAGGG - Intergenic
1123403614 15:20008143-20008165 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123512950 15:21014788-21014810 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1124469658 15:29971967-29971989 ATAAAGACAAACCCTGAGAATGG - Intergenic
1124864327 15:33474094-33474116 AAGCAGAAACAGCCTGAAAATGG - Intronic
1125193808 15:37023655-37023677 GTGCTGAGACTGCCTGAGAAAGG + Intronic
1126143773 15:45457684-45457706 ATTCAGGCACAGCCTGTGGAAGG + Intergenic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1126680338 15:51196189-51196211 CTGGAGACACAGCCTTAGATAGG + Intergenic
1127764149 15:62168300-62168322 ATGCAGAAACAGGCTCACAAAGG + Intergenic
1129002863 15:72348314-72348336 CTGTTGACACAGGCTGAGAAAGG + Intronic
1129268901 15:74409397-74409419 GGCCAGACACAGCCGGAGAAGGG + Exonic
1129821425 15:78604629-78604651 ATGCAGACCCAGCTGGAGACTGG + Intronic
1130441271 15:83956271-83956293 ATGCAGCCACTGCCAGGGAATGG + Intronic
1132595550 16:747599-747621 ATAAAGACACTGCCTGAGACTGG - Intronic
1133085657 16:3360849-3360871 ATCCAGACAGACTCTGAGAAGGG - Intergenic
1134837586 16:17375066-17375088 AGGCAGACACAGGCTCAGAGAGG + Intronic
1134886300 16:17795739-17795761 AAGCAGACACAGGCTGGGCACGG + Intergenic
1135137971 16:19898664-19898686 CAACAGCCACAGCCTGAGAAGGG - Intergenic
1136247454 16:28984142-28984164 AGACAGACAAAGCCAGAGAAGGG - Intronic
1139065107 16:63303039-63303061 GTGTAGACAGAGCCTGAGGAAGG + Intergenic
1139254345 16:65527069-65527091 ATGCAGACAGAGGCAGAGACTGG + Intergenic
1140032642 16:71350794-71350816 AAGCAGACACTGACTGAGATGGG - Intergenic
1140468753 16:75203189-75203211 ATCCGGACACATCCTGGGAAAGG + Intergenic
1140887644 16:79258923-79258945 AGGCAGAGGCAGCCTGAGACTGG - Intergenic
1141068840 16:80935077-80935099 AGGAAAACACTGCCTGAGAATGG + Intergenic
1141233665 16:82195323-82195345 AAGCAGCCACAGCCTGTGTAGGG + Intergenic
1141274053 16:82568972-82568994 ATGCAGTCACAGCTTGTGGATGG - Intergenic
1141772144 16:86096001-86096023 ATGCACACACACCCTGGGAGGGG + Intergenic
1142291225 16:89194462-89194484 ATGCAGACAGAGCCTCCGAAAGG + Intronic
1144065761 17:11622764-11622786 AAGCAGCAGCAGCCTGAGAAAGG - Intronic
1146611133 17:34305916-34305938 AAGCAGGCAATGCCTGAGAAAGG - Intergenic
1146905922 17:36617875-36617897 GTGCGGACACAGCCTCAGAGAGG - Intergenic
1147451169 17:40505412-40505434 GTGAAGACACAGACTGAGACTGG - Intergenic
1147680006 17:42236779-42236801 ATGTGGACATAGCCTGATAATGG - Intronic
1147757622 17:42779446-42779468 ATCCAGCACCAGCCTGAGAAGGG - Exonic
1148238417 17:45984100-45984122 GTGCGGCCACAGCCTGAGCACGG - Intronic
1149581413 17:57752940-57752962 ATGCAGGTACAGCTTGAGACTGG - Intergenic
1149887595 17:60356106-60356128 ATAAAGACAAAGCTTGAGAATGG - Intronic
1150060697 17:62065773-62065795 ACGAAGACAGAGCCAGAGAATGG - Intergenic
1151050202 17:70969687-70969709 ATGCAGACTGAGTCTGAAAATGG - Intergenic
1151734880 17:75933164-75933186 ATACAGAGACAGCTTGGGAAGGG - Intronic
1152292852 17:79450287-79450309 CTTCATTCACAGCCTGAGAAGGG - Intronic
1152548774 17:81018767-81018789 ATGCACACAAAGCCAGAGAGTGG + Intergenic
1152648305 17:81480465-81480487 ATGCAGAGGCAGCCTAAGATGGG - Intergenic
1153016260 18:584876-584898 CAACAGCCACAGCCTGAGAAGGG - Intergenic
1155724569 18:29063758-29063780 ATGCAGACATAGATGGAGAAGGG - Intergenic
1155746758 18:29363682-29363704 ATTCAGTCACTGCCTGGGAATGG - Intergenic
1155795573 18:30032461-30032483 ATGCTGACACAGGCTGTGTAGGG + Intergenic
1157480163 18:48048754-48048776 TTGAAGACACTCCCTGAGAAGGG + Intronic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1158940106 18:62399861-62399883 TCTCAGAAACAGCCTGAGAATGG - Intergenic
1159671835 18:71229915-71229937 TTGCTGCCACAGCCTGAGTAGGG + Intergenic
1159856476 18:73595773-73595795 ATGAAGACGCAGGCTGAGACTGG + Intergenic
1160196225 18:76758004-76758026 AGGCAGCCACAGCCTCAGAGAGG - Intergenic
1163014566 19:14446399-14446421 AGGCAGAGACAGTCTGAGAGAGG - Intronic
1163183097 19:15617825-15617847 ATGCCCACACAGACTGGGAAGGG + Intronic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163501445 19:17678822-17678844 ATGCTGACAGAGGCTGAGAAAGG + Intronic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1163827980 19:19534480-19534502 ATACAGAAACAGCCAGAGACAGG + Intronic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1164578731 19:29421264-29421286 GTGCAGACACGGCCTGGGCAGGG + Intergenic
1164617524 19:29675847-29675869 ATGCACACTCACTCTGAGAAAGG - Intergenic
1164821178 19:31252257-31252279 ATGCAGCCACAACCTCAGGAAGG - Intergenic
1165068505 19:33242048-33242070 ATACAGACCCAGACTGAGGACGG + Intergenic
1165284909 19:34833387-34833409 GTGCAGACAGCGCCAGAGAAAGG - Intergenic
1166880687 19:45928212-45928234 ATGCAGACACGGACAGAGACAGG + Intergenic
1167199053 19:48051334-48051356 ATAAAGACACTGCCTGAGACTGG + Intronic
1167409728 19:49337852-49337874 AGGCTGGCACAGCCTGAGAGGGG + Intronic
1168177514 19:54635568-54635590 AAGCACACACAGCCTGAGGATGG + Exonic
1168181794 19:54666708-54666730 AAGAACACACAGCCTGAGGACGG + Exonic
1168307670 19:55444196-55444218 AGGGAGATACAGGCTGAGAAAGG + Intergenic
925562442 2:5211506-5211528 AAGCAGAGACAACCAGAGAAGGG + Intergenic
926728014 2:16013628-16013650 ATTCAGACAGAGACTGAGAGAGG + Intergenic
926942451 2:18152611-18152633 ATGCAAACACAGAAAGAGAAAGG - Intronic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
928797655 2:35041321-35041343 ATAAAGATACAGCCTGAGACTGG - Intergenic
929089751 2:38203216-38203238 TTGCTGCCACATCCTGAGAAAGG - Intergenic
929620285 2:43347819-43347841 TGGCAGACACAGCTGGAGAAAGG + Intronic
930709317 2:54535188-54535210 ATGCAGACAGAGCCAGGAAAAGG - Intronic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931086064 2:58831765-58831787 ATGCAGCCACTGCCAGAGGATGG + Intergenic
931788646 2:65643891-65643913 ATACAGAAACAGCCTTGGAAAGG - Intergenic
933899464 2:86839258-86839280 ATTCAGACACAGTCTAATAAGGG - Intronic
933903040 2:86862603-86862625 AGGAAGACACAGCCTGAGCCAGG - Intergenic
934523448 2:95034119-95034141 ATGCAGCACCTGCCTGAGAATGG - Intronic
934896247 2:98122625-98122647 ATGCACACACACCCTGAGCCTGG - Intronic
935285447 2:101560303-101560325 AAGCAGACACAGCCTGACCATGG + Intergenic
935777506 2:106486667-106486689 AGGAAGACACAGCCTGAGCCAGG + Intergenic
935781097 2:106509968-106509990 ATTCAGACACAGTCTAATAAGGG + Intergenic
936241189 2:110790075-110790097 ATCTACACACAGCCTGTGAATGG - Intronic
936450072 2:112627257-112627279 ATGCAGCCACAGGCTGAGTTGGG + Intergenic
936822017 2:116533434-116533456 ATGCAGTCACATTCTGAGTATGG + Intergenic
937017737 2:118620987-118621009 ATGAAGGCACAGCCAGAAAAAGG - Intergenic
939273915 2:139975050-139975072 ATGCAGACAAAGACACAGAAAGG + Intergenic
939719964 2:145636187-145636209 ATGAGGACACATTCTGAGAAAGG - Intergenic
940015091 2:149095910-149095932 ATGCACACACAGACAGAGAGAGG + Intronic
940649549 2:156427891-156427913 ATGCAGACACAAGCCAAGAAAGG - Intergenic
941894101 2:170612257-170612279 ATGCAGACACACACTAGGAATGG - Intronic
942524678 2:176840609-176840631 ATGCATGCACATCATGAGAAGGG - Intergenic
942657183 2:178226141-178226163 ATGCAGTGACAGCCTGGGTAGGG + Intronic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
945946566 2:216001087-216001109 ATGCAGAGACAGCTAGAGAGAGG - Intronic
946430637 2:219625439-219625461 ATACTGAGACAGCCTGAGAAGGG - Intergenic
946527820 2:220539594-220539616 ATGCAGGCACCACCTGAAAATGG - Intergenic
946658522 2:221975276-221975298 ATGCAGGCACAGCCTCATGATGG + Intergenic
946669546 2:222088205-222088227 ATGCACACACAGATTGAGAGAGG - Intergenic
946774055 2:223119214-223119236 ATGCACACACAGCTTCAAAAGGG + Intronic
946869319 2:224071677-224071699 CAGCAGCCACAGCCTGAGAAGGG - Intergenic
947166179 2:227264371-227264393 ATGCAGACACAGCCTGGAAGTGG - Intronic
947504372 2:230695705-230695727 ATGCAGGCACTGCCTGAGTGGGG + Intergenic
1169484407 20:6014882-6014904 ATGCAGATACAGTCAGAGTATGG + Intronic
1170793904 20:19530174-19530196 ATGGAGACACAGCATGAAAGGGG + Intronic
1170815571 20:19711071-19711093 ATGCAGACACACACAGACAAAGG + Intronic
1171108439 20:22458317-22458339 AGGCAGACACCACCTGACAAAGG - Intergenic
1171400637 20:24871225-24871247 ATGCAGGGACAGGCTGAGCATGG + Intergenic
1172217858 20:33249189-33249211 AAGCAGGCACATGCTGAGAAGGG + Intergenic
1173061449 20:39665482-39665504 ATGCACACAAATCTTGAGAAAGG - Intergenic
1173188902 20:40861547-40861569 AGCCAGACACAGCCTGGGATGGG + Intergenic
1176121239 20:63455512-63455534 ATGCAGTCACAGACTGAGCATGG + Intronic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1178688002 21:34726546-34726568 ATGCAGCCACAGCCAAGGAAGGG + Intergenic
1179561072 21:42216583-42216605 ATGCAGAGACAGCCTGCCAGAGG + Intronic
1180451919 22:15471498-15471520 ATGCAAAACCAGCCTCAGAATGG + Intergenic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182978619 22:34646959-34646981 ATTCACACACAGCCCTAGAATGG + Intergenic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183554285 22:38513129-38513151 CTGCAGAAACAGCCTGGGCATGG + Intergenic
1183701533 22:39453932-39453954 AAGGAGACACCGCCTGAGATTGG + Intergenic
1184014148 22:41772943-41772965 AGGAAGACCCAGGCTGAGAAAGG - Intronic
1184506917 22:44909405-44909427 GTGCAGACACTGCCACAGAATGG + Intronic
1184687030 22:46100887-46100909 TGGCATCCACAGCCTGAGAATGG + Intronic
949095309 3:78656-78678 ATGCAAACACAGTCTGAGCTTGG + Intergenic
949417535 3:3830509-3830531 ATGCAGACACCACCTGAAAATGG - Intronic
949875287 3:8622718-8622740 GTGCAGACAGAGACAGAGAAGGG + Intronic
950154571 3:10711980-10712002 GTGCTGACATAGCCTGGGAAAGG + Intergenic
950247718 3:11437139-11437161 ATGCAGAGAGAACCAGAGAAAGG - Intronic
950455558 3:13090858-13090880 AGGCACAGACAGGCTGAGAATGG + Intergenic
951005009 3:17605172-17605194 ATGCAAAGACAACCTGAGATTGG - Intronic
952515728 3:34103361-34103383 ATGAGGAAACAGCCTCAGAAAGG - Intergenic
953114849 3:39982283-39982305 TTGCTGACACAGACTGTGAAAGG - Intronic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
953786845 3:45917410-45917432 TTGCTGACCCAGCCAGAGAAAGG + Intergenic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
954830560 3:53417857-53417879 CCGCAGCCATAGCCTGAGAAGGG - Intergenic
954863102 3:53706382-53706404 TTGCAGCCACATCCGGAGAAGGG - Intronic
955208328 3:56917638-56917660 ATGGGGACAAAGTCTGAGAAGGG + Intronic
957321939 3:78642583-78642605 AAGCAGAGAAAACCTGAGAAGGG - Intronic
958806828 3:98821755-98821777 ATGCAGACACTGGCTGGGCACGG + Intronic
959439565 3:106359558-106359580 ATGCAGACACCACCTGAAAGTGG + Intergenic
961782056 3:129326173-129326195 TTGCAGACACAGCCTGGGCCAGG - Intergenic
962635674 3:137329104-137329126 GTGTAGACACAGCCTGTGTAGGG + Intergenic
964513263 3:157476873-157476895 GAGCAGTCACAACCTGAGAAAGG + Intronic
965301403 3:167010357-167010379 ATGAAGACACTACCTGAGACTGG + Intergenic
965328343 3:167336439-167336461 ATACATACACAGCCTTACAATGG - Intronic
965553288 3:169992540-169992562 ATTCAAACACTGCCTCAGAAGGG - Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
967204964 3:187111061-187111083 AAGCAAACACATCCTGAGAGAGG - Intergenic
967952711 3:194853251-194853273 ATGCAGCCACAGGCTGTGGAAGG + Intergenic
968495361 4:912310-912332 ATGCTGGGACAGCCTGAGAAGGG + Intronic
969347128 4:6576491-6576513 ATGCAGACACACCTGGCGAATGG + Intronic
969829809 4:9786159-9786181 ATGGAGACCCAGCCTGAGCTGGG + Intronic
970066307 4:12097650-12097672 ATGTAGACACAACCATAGAAAGG - Intergenic
970076659 4:12229612-12229634 ATGAAGACACAGCCAGAAGATGG + Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970520427 4:16878318-16878340 ATAAAGATAAAGCCTGAGAAGGG + Intronic
970581481 4:17477695-17477717 ATGCAGACTGGGACTGAGAAGGG + Intronic
971422957 4:26490590-26490612 AAGCAGCCACACGCTGAGAATGG - Intergenic
971700923 4:29974238-29974260 ATGAAGACACAGTGTAAGAAAGG - Intergenic
975176726 4:71298024-71298046 ATGGAAACAGAGCCTCAGAAAGG - Intronic
975290330 4:72670729-72670751 CAGCAGCCACAACCTGAGAAAGG - Intergenic
975662496 4:76701449-76701471 ATGCAGAGACAGCCTCATAGAGG - Intronic
977063621 4:92286927-92286949 ATGAAGAGACAACCTGTGAATGG - Intergenic
978682469 4:111398043-111398065 AAGAAGACACAGCCAGAGACAGG + Intergenic
979375323 4:119939706-119939728 ATGAAAACAGAGGCTGAGAAAGG + Intergenic
980064954 4:128176828-128176850 ATGCAGACACAGCACAAAAAGGG + Intronic
980990179 4:139732744-139732766 ATGAAGACACTGCCTGGGAGAGG - Intronic
981107915 4:140902373-140902395 ATGCAAATACAGCATGAAAAAGG + Intronic
983276656 4:165626109-165626131 AAGTAGACACAACGTGAGAATGG + Intergenic
983871274 4:172827368-172827390 AGGCAGACAGAGTCTGAGATAGG - Intronic
983994207 4:174161136-174161158 ATGCAGAGACAGCCTGCCCAGGG - Intergenic
984590852 4:181616181-181616203 ATACATACACAGGCTGAAAAGGG + Intergenic
985605751 5:857318-857340 ATGGAGTCCCAGTCTGAGAAGGG - Intronic
985821377 5:2163178-2163200 ATGAGAACACAGTCTGAGAACGG - Intergenic
991432727 5:66565420-66565442 AATAAGACACAGCCTGATAAGGG + Intergenic
992625792 5:78634809-78634831 ATGGGAACACAGCCTGTGAAAGG - Intronic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
996058719 5:119009237-119009259 ATGCTGACTCAGACTGAGGATGG + Intergenic
997890038 5:137667968-137667990 ATGAGGAAACAGCCTGAGAGAGG + Intronic
998247526 5:140521011-140521033 AAGCAGACTGAGCCTCAGAAAGG - Intronic
998397148 5:141826045-141826067 ATGCAGGCACGGCCTGGGAGAGG + Intergenic
998984500 5:147740708-147740730 ATGAAGACAGAGCCTGACACTGG - Intronic
999640108 5:153663931-153663953 ATGCTGACCCAGCATGAAAAAGG - Intronic
999908384 5:156168913-156168935 ATGCAGAGAGTGCCTGGGAAGGG - Intronic
1002147654 5:177197917-177197939 ATGGAGACAGAGACAGAGAAGGG + Intronic
1003126673 6:3361387-3361409 ATCCAGCCACAGCCTGAGCCAGG - Intronic
1003257864 6:4489906-4489928 ATGCAGACACATCCAGGGAAAGG + Intergenic
1004176680 6:13346200-13346222 ATGCAGAGACGGCCTGAGATAGG - Intergenic
1005736668 6:28754351-28754373 ATGAAGACACTACCTGAGACTGG + Intergenic
1005856445 6:29866646-29866668 ATGCAGGAACATCCTGAGAGAGG - Intergenic
1005977805 6:30813589-30813611 AAGCAGTCACAGCCAGAGCAGGG + Intergenic
1006530070 6:34644536-34644558 TAGCAGACACTGCCTGAAAATGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007703193 6:43776148-43776170 ATGCTGAAACAGGCTGAAAAAGG - Intronic
1008385665 6:50887088-50887110 AACCACACACAGCCTCAGAAAGG + Intergenic
1008475200 6:51928779-51928801 ATGCAGAGACAGCCAGGGTAAGG + Intronic
1009361838 6:62824464-62824486 ATGCAGACACACCAGGAGTAAGG - Intergenic
1011172620 6:84522724-84522746 AGGGAGAAAGAGCCTGAGAATGG - Intergenic
1011762198 6:90579337-90579359 AAGCAGAGACAGGCAGAGAAGGG - Intronic
1013176234 6:107679710-107679732 ATCCACACACATCCTTAGAATGG + Intergenic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1016776340 6:147908881-147908903 ATGCAGGCTAAGCCTGAGATAGG + Intergenic
1018043544 6:159946068-159946090 CAGCAGCCACAGCCTGAGAAGGG - Intergenic
1018157572 6:161001754-161001776 ATGCGGAAACAGACTGAGAGAGG - Intronic
1018758550 6:166870794-166870816 AAGCAGACAGAGCCAGAGAGAGG + Intronic
1019653007 7:2170790-2170812 AAGGCGACACAGGCTGAGAAGGG + Intronic
1021314503 7:19130597-19130619 TTGAAGACACATTCTGAGAATGG - Intergenic
1021489778 7:21207016-21207038 GTGGAGACACATCATGAGAAGGG - Intergenic
1021556494 7:21923932-21923954 ATGGAGACTCAGGCTGACAAAGG - Intronic
1021820361 7:24492121-24492143 ATGCAGACATAGCCTGAAAAAGG - Intergenic
1022231618 7:28419420-28419442 ATGCAGACAGAGACTGCAAATGG - Intronic
1022520162 7:31000984-31001006 ATTCAGACACAGACAGACAAAGG + Intergenic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1023618643 7:42047347-42047369 ATGCACACCCAGCCTCAGGAAGG + Intronic
1023812992 7:43926712-43926734 AAGCGAACGCAGCCTGAGAAAGG + Intronic
1024244973 7:47462617-47462639 ATGAAGTGACAGCCTGACAATGG - Intronic
1024644043 7:51356484-51356506 ATGGAGACAAAGCCAGAGCAGGG - Intergenic
1025191429 7:56898655-56898677 ACACAGCCACAGCCTGAGAGGGG - Intergenic
1025680519 7:63678279-63678301 ACACAGCCACAGCCTGAGAGGGG + Intergenic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1028003469 7:85531400-85531422 ATGAAGACAGAGGCTGAGACTGG - Intergenic
1028642871 7:93062842-93062864 CAGCAGTCACGGCCTGAGAAGGG - Intergenic
1030136558 7:106257324-106257346 ATGCACATACAGGCTGGGAATGG + Intronic
1030714769 7:112794524-112794546 AGGAAGCCACATCCTGAGAATGG - Intergenic
1030933534 7:115555782-115555804 AGGCAGAGACAGCATGTGAAAGG + Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032080366 7:128855529-128855551 AGGCAGACACACCCTGAGAAAGG - Intronic
1033761276 7:144439086-144439108 AGGGAGACAGAGCTTGAGAAAGG + Intergenic
1034872842 7:154699072-154699094 AAGCAGACACTGTCTGAGAAGGG + Intronic
1034990835 7:155547268-155547290 ATTCGGACACAGGATGAGAAGGG - Intergenic
1035044566 7:155955164-155955186 ATCCACTGACAGCCTGAGAATGG - Intergenic
1035522627 8:287345-287367 CTGCAGCCTGAGCCTGAGAAAGG - Intergenic
1037902828 8:22697695-22697717 ATGCAAACACCCTCTGAGAAGGG - Intergenic
1038051561 8:23818756-23818778 ATACAGACACTGCCGGAGACTGG + Intergenic
1038848874 8:31255040-31255062 AGGAAGACACAGTTTGAGAAAGG - Intergenic
1043264208 8:78242562-78242584 ATGCAGATACAGCCTGAGAGGGG - Intergenic
1044124157 8:88437288-88437310 ATGCAGCCACTGCCAGAAAATGG - Intergenic
1044370279 8:91402409-91402431 ATGCTAACAAAGCCTGAGAGAGG + Intergenic
1044611366 8:94095494-94095516 AGGCAGAGCCAGCATGAGAATGG + Intergenic
1045687872 8:104729849-104729871 ATGCAGTGAGGGCCTGAGAAGGG + Intronic
1047019563 8:120760525-120760547 CTGGAGACCCAGCCTGAGAGAGG + Intronic
1047120648 8:121900550-121900572 ATCCAGTCAGAGACTGAGAAGGG - Intergenic
1047700154 8:127441630-127441652 GTGCACACACAGCCTGTGACTGG - Intergenic
1047843436 8:128779424-128779446 AGGTAGACACAGACTGATAATGG - Intergenic
1049229195 8:141473344-141473366 AGGCAGCCACAGGCAGAGAAGGG - Intergenic
1049511014 8:143026686-143026708 GTGCAGACAGAGCCTGGGAGGGG + Intergenic
1050008111 9:1156327-1156349 ATGCAGATACATCCTGAAACTGG + Intergenic
1050800033 9:9599284-9599306 AGGGAGACTCAGCCTTAGAAAGG + Intronic
1053654217 9:40198424-40198446 ATGAAGACAGAACCCGAGAATGG - Intergenic
1053904604 9:42827600-42827622 ATGAAGACAGAACCCGAGAATGG - Intergenic
1054366330 9:64344640-64344662 ATGAAGACAGAACCCGAGAATGG - Intergenic
1054530379 9:66177914-66177936 ATGAAGACAGAACCCGAGAATGG + Intergenic
1054673959 9:67834379-67834401 ATGAAGACAGAACCCGAGAATGG - Intergenic
1055096456 9:72419353-72419375 ATGCTGACACAGCCTCAGCCAGG - Intergenic
1056588005 9:87940769-87940791 ATGAAGAAACAACCAGAGAATGG - Intergenic
1056608862 9:88112176-88112198 ATGAAGAAACAACCAGAGAATGG + Intergenic
1057531319 9:95848657-95848679 ATGAAGCCACAGCTTGATAAAGG - Intergenic
1057851544 9:98570545-98570567 ATGGAGACAGAGCATGGGAAAGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1059253785 9:112910386-112910408 GAGCAGCCACAGTCTGAGAAAGG + Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1060050930 9:120377625-120377647 ATGCAGACACAGCAAGAAGATGG - Intergenic
1060685962 9:125612950-125612972 AAGCAGCTACATCCTGAGAAAGG + Intronic
1185735219 X:2490786-2490808 AGACAAACACAGCATGAGAAGGG + Intronic
1185856011 X:3535947-3535969 AGGCAGAGACAGACAGAGAAGGG - Intergenic
1185867401 X:3636255-3636277 GTGCAGACACAGGCTGCGAAGGG + Intronic
1186162687 X:6794159-6794181 ATGGGGACACACTCTGAGAAAGG + Intergenic
1186801175 X:13093496-13093518 ATGCAGGCAAAGCCAGAAAAAGG + Intergenic
1189192499 X:39122643-39122665 ACCCAGAGAAAGCCTGAGAAGGG + Intergenic
1190114076 X:47614317-47614339 CAGCAGCTACAGCCTGAGAAGGG + Intronic
1190460948 X:50674562-50674584 ATGCACACAAAACCTCAGAATGG + Intronic
1191061259 X:56299396-56299418 ATGCAGGCTGACCCTGAGAAAGG - Intergenic
1191062669 X:56316097-56316119 ATGCAGGCTGACCCTGAGAAAGG + Intergenic
1194467295 X:94248922-94248944 ATGAATTCACAGCTTGAGAAAGG + Intergenic
1197278903 X:124512139-124512161 ATGCAGACACAGGCGGACATCGG + Intronic
1198185946 X:134254217-134254239 CAGCAGCCCCAGCCTGAGAAGGG - Intergenic
1198551114 X:137745847-137745869 AGGCAGAAACAGGCTGAGAGAGG + Intergenic
1200407072 Y:2823167-2823189 ATGCAGCCACAGCCAAGGAATGG + Intergenic
1200796588 Y:7346437-7346459 GTGCAGACACGGGCTGCGAAGGG - Intergenic
1201686078 Y:16703838-16703860 CTACATACACAGCCTAAGAATGG - Intergenic
1202151625 Y:21848916-21848938 GTCCAGCCACTGCCTGAGAAAGG + Intergenic
1202337037 Y:23823221-23823243 ATGCTGACATAGCATGGGAATGG + Intergenic
1202533728 Y:25846850-25846872 ATGCTGACATAGCATGGGAATGG - Intergenic