ID: 1112039678

View in Genome Browser
Species Human (GRCh38)
Location 13:95534256-95534278
Sequence TCTTTTTCTTTCCTATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1980
Summary {0: 1, 1: 0, 2: 11, 3: 176, 4: 1792}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112039678_1112039680 18 Left 1112039678 13:95534256-95534278 CCTTCAAATAGGAAAGAAAAAGA 0: 1
1: 0
2: 11
3: 176
4: 1792
Right 1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 102
1112039678_1112039679 -9 Left 1112039678 13:95534256-95534278 CCTTCAAATAGGAAAGAAAAAGA 0: 1
1: 0
2: 11
3: 176
4: 1792
Right 1112039679 13:95534270-95534292 AGAAAAAGAAGAAGAAAACATGG 0: 1
1: 10
2: 187
3: 1405
4: 9102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112039678 Original CRISPR TCTTTTTCTTTCCTATTTGA AGG (reversed) Intronic
900295654 1:1947875-1947897 TCTTTTTTTTTTCTTTTAGACGG + Intronic
900588744 1:3448970-3448992 TATTTTCCTTTCATTTTTGAAGG + Intergenic
900671979 1:3859856-3859878 TATCTTTCTTTCCCATTTCAGGG + Intronic
900699478 1:4035399-4035421 TCTTTTTTCTTTGTATTTGATGG - Intergenic
900723109 1:4192941-4192963 TATTTATCTTTCATTTTTGAAGG + Intergenic
900820739 1:4885762-4885784 TCCTTTTCTTTCCAAATTAAGGG - Intergenic
900829238 1:4952723-4952745 TTTTTTGCTTTCCCTTTTGAAGG - Intergenic
900872119 1:5311619-5311641 GCTTCTTATTTCCTATTTGTAGG - Intergenic
901299870 1:8191836-8191858 TCTTTTTCTTTCTTTTTTTTTGG + Intergenic
901344991 1:8532401-8532423 TCTTTTTCTCTTTTATTTGGGGG + Intronic
901780235 1:11589458-11589480 TCTATTTCTTTCCAAATTAATGG + Intergenic
902085269 1:13855569-13855591 GGTTTTTCTTTTCTATTTCATGG - Intergenic
902120075 1:14157459-14157481 TATTTCTCTTTCATGTTTGAAGG + Intergenic
902177255 1:14659958-14659980 TTTTTTTCTTTCCCAACTGAAGG + Intronic
902457377 1:16544965-16544987 TTTTTTTCTTTCTTTTTTGACGG + Intergenic
902492490 1:16794656-16794678 TCTTTTTCAAATCTATTTGAAGG - Intronic
902591517 1:17478368-17478390 TCTTTTTCTTTCTTTTTTTTGGG + Intergenic
902741916 1:18444850-18444872 TCTTTTTCTCTCCTACTGGATGG - Intergenic
902832518 1:19026387-19026409 TCTTTTTTTTTTTTTTTTGAAGG + Intergenic
902888133 1:19421479-19421501 TGTTTTTCTTTTCTCTTTGCAGG - Intronic
902905592 1:19554469-19554491 TGTTTTTGTGTCCTATTTCAGGG - Intergenic
902990620 1:20185136-20185158 TCTTTTTCTTCCTTTTTTAAGGG - Intergenic
903017492 1:20370600-20370622 TCTTTTTCTTTCCCAGTTACTGG - Intergenic
903089601 1:20900018-20900040 TGTTTTCCTTTGCTTTTTGAAGG - Intronic
903446785 1:23427454-23427476 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
903936772 1:26900821-26900843 TCTTTTTCTTACCGATTTGTGGG - Intronic
903971897 1:27124260-27124282 GATTTTTCTTTCCTCTTTGCTGG + Intronic
904012580 1:27398340-27398362 TCTCTTTCTTTCCTGGATGAGGG + Intergenic
904112819 1:28139975-28139997 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
904325566 1:29725665-29725687 TCCTCTTCTTTCCTCTATGAGGG - Intergenic
904342282 1:29844516-29844538 TCTTTTTCTTCCTTCTTTGATGG + Intergenic
904371641 1:30051363-30051385 TTTTTTTCTTTCCTTTTGTATGG + Intergenic
904487125 1:30833276-30833298 TCTTTTTCTTACTCATTTGCAGG - Intergenic
904496818 1:30891846-30891868 TCTTTTTTTTTTTTTTTTGACGG - Intronic
904626475 1:31808100-31808122 TCTTTTTGTTTTCTATTTTCTGG - Intronic
905122131 1:35690478-35690500 TCTTTTTTTTTCCTTTGAGATGG + Intergenic
905123010 1:35696150-35696172 TCCTTTTCTGTGTTATTTGATGG + Intergenic
905255925 1:36684477-36684499 TCTTCTTCTTTTTTTTTTGATGG + Intergenic
905411168 1:37769290-37769312 TCTTTTTTTTTTTTATTTGACGG - Intergenic
905567992 1:38981142-38981164 TCTTTTTCTTTTTTTTTTCAGGG - Intergenic
905637687 1:39565906-39565928 TCCTTTTTTTTCCTATTTGTAGG - Intronic
905701251 1:40017019-40017041 TCCTTTTCTTTCCTAGGTCAGGG + Intergenic
906083747 1:43112126-43112148 TCTTTTTCTTATTCATTTGAAGG + Intergenic
906106429 1:43296082-43296104 TCTTTTTCTTTTCTTTTTTTTGG + Intergenic
906214003 1:44028749-44028771 TCTTTTTCTTTTTCTTTTGACGG - Intronic
906220874 1:44078436-44078458 TCTTTTTTTTTTTTTTTTGAAGG + Intergenic
906442643 1:45862348-45862370 CCTTGTTCTTTCCAATTGGAAGG + Intronic
906500505 1:46338664-46338686 TTTTTTTTTTTTCTTTTTGACGG - Intergenic
906554916 1:46702277-46702299 ACTTTTTCTTTACTATTTAAAGG - Intronic
906735076 1:48117717-48117739 TATTTTTCCTTCATATTTGGAGG - Intergenic
906947108 1:50304212-50304234 TCTTTTTCTTTTTTTTTTAAAGG - Intergenic
906969192 1:50493033-50493055 TCTTTTTTTTTTTTTTTTGAGGG + Intronic
907108171 1:51902843-51902865 TGTTTTTCTTTTCTTTTTGGGGG - Intergenic
907448210 1:54523518-54523540 TCTTTTTTTTTTCTTTTTTAAGG - Intergenic
907495340 1:54840250-54840272 TCTTTTTCTTTCATGTTACACGG + Intronic
907584667 1:55606548-55606570 TCTTTTTTTTTCCTTCTTCAAGG + Intergenic
907775076 1:57506385-57506407 TCTTTTTCCTTCATATTTCCTGG + Intronic
907782871 1:57583289-57583311 TCTTTTTTTTTTTTTTTTGATGG + Intronic
908005870 1:59728615-59728637 TCTTTCTCTTTCATGTTTGAAGG + Intronic
908058182 1:60315398-60315420 TGGTTTTCTTTCCAATTTGGAGG + Intergenic
908131121 1:61076630-61076652 TCTTTTTCTTTCCTAACCTAGGG + Intronic
908272673 1:62436502-62436524 TCTTCTTTTTTGCTATTAGATGG + Intronic
908301899 1:62770282-62770304 GCTTGTTCTTACCTATTTGTGGG - Intergenic
908402880 1:63787528-63787550 TTTTTTTTTTTCTTTTTTGATGG + Intronic
908411846 1:63874311-63874333 TTTTTTTCCTTCTTTTTTGAAGG + Intronic
908573935 1:65439475-65439497 TATTTGTCTTGCCCATTTGAAGG - Intronic
908773108 1:67613922-67613944 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
908867040 1:68560201-68560223 GCTATTTATTTCCTATTTGTGGG + Intergenic
909183401 1:72452368-72452390 TATTTCTTTTTCATATTTGAAGG - Intergenic
909262359 1:73507949-73507971 TCACTTTTTTTCTTATTTGATGG - Intergenic
909318882 1:74257537-74257559 TGTTTTTCTTTCATTTTTGGCGG + Intronic
909463761 1:75949126-75949148 TGTTCCTCTTTCTTATTTGAAGG + Intergenic
909586794 1:77299323-77299345 TCTTTTTCTTATTTATTTCAAGG + Intronic
909772697 1:79443508-79443530 TGTTTTTCTTAGCTATTTTAAGG - Intergenic
909786570 1:79621411-79621433 TTTTTTTTTTTTCTTTTTGATGG - Intergenic
909870842 1:80736293-80736315 TATTTATCTTTCGTGTTTGAAGG - Intergenic
909877024 1:80819270-80819292 TTTCTTTCTTTTCTATTTTAAGG - Intergenic
909908723 1:81233361-81233383 TCTTATTCTTTCTGATTTAATGG - Intergenic
910167807 1:84346123-84346145 TCATTTTCTTATCTATGTGATGG - Intronic
910269437 1:85377819-85377841 TCTTCTTCATTAATATTTGAAGG + Intronic
910298682 1:85680211-85680233 TCTTTTTCTTTATTTTTGGAGGG - Intronic
910465216 1:87491745-87491767 TATTTTTCTTTCATATTAAAAGG - Intergenic
910479647 1:87644468-87644490 TTTTTTTTTTTCTTTTTTGAAGG + Intergenic
910610001 1:89130578-89130600 TCTTGTTCTTTCCTCTTCCAAGG - Intronic
910787649 1:91017962-91017984 TCTTTTTCTTTCTTTTTGGTTGG - Intronic
910826088 1:91408713-91408735 TCTTTTTCTTTCTTTCTTCAGGG + Intergenic
910910582 1:92229813-92229835 TCTTTTTCTTATATATTTGTAGG - Intronic
911110914 1:94184287-94184309 TTTTTTTCTTTTCTATTGAAGGG - Exonic
911215915 1:95193866-95193888 TCTTGTTCTTACCTTTTTGCAGG + Exonic
911276245 1:95862745-95862767 CCTTTTTCTGTCCTTTTTAAAGG + Intergenic
911462620 1:98210088-98210110 TCTTTTTTTTTTTTTTTTGAGGG + Intergenic
911490334 1:98557453-98557475 TCTTTTTTTTTCTTTTTGGATGG - Intergenic
911628812 1:100158845-100158867 TTTTTTTTTTTCCTATTGCACGG - Intronic
911686752 1:100786190-100786212 TATTTTTATTTCCCAGTTGAAGG + Intergenic
911925746 1:103830375-103830397 TTTTTTTCTTTCCTTTTTGTAGG + Intergenic
911937803 1:104002748-104002770 TGTTTTTCTTTATTATTTGAGGG - Intergenic
911969029 1:104407066-104407088 ATTTTTTTTTTCCTATTTAAAGG - Intergenic
912039160 1:105363973-105363995 TCTTTAAATTTCATATTTGAGGG - Intergenic
912126789 1:106549379-106549401 TCTTTTTCTGTCTTATTTACAGG - Intergenic
912136342 1:106663764-106663786 TATTTCTCTTTCATGTTTGAGGG - Intergenic
912203180 1:107481128-107481150 TTTTTGTCTTTCCTGTTTGGGGG - Exonic
912262614 1:108124142-108124164 TGTTTTTCTTTTCTTTTTGTGGG + Intergenic
912672739 1:111646539-111646561 TCTTTTTCTTTCTTTTTTTTTGG + Intronic
912857174 1:113179639-113179661 TATTTTTCTTTCACATTGGAAGG - Intergenic
912892977 1:113555163-113555185 TATTTCTCTTTCATTTTTGAAGG - Intronic
912906804 1:113716178-113716200 TCTTTATCTTTGATCTTTGAGGG - Intronic
912993002 1:114508241-114508263 TCTTTATCCTTTCTTTTTGAAGG - Intronic
913002147 1:114591459-114591481 TCTTTTTCTTACTGATTTGCAGG + Intronic
913015494 1:114729785-114729807 TCTTTCTATTTCCTATTTAGTGG + Intronic
913263595 1:117023420-117023442 TCTTTTTCTTTTTTTTTAGACGG + Intronic
914419859 1:147519466-147519488 TTTTTTTCTTTTTTTTTTGATGG + Intergenic
914435968 1:147659525-147659547 TCTCTTTCTTCCCTACTTTAGGG - Exonic
914805910 1:150991545-150991567 TCTTTTTTTTTCCTTTGAGATGG + Intronic
914939748 1:152012532-152012554 TCCTTTTCTTTTTTTTTTGAGGG + Intergenic
914986662 1:152463295-152463317 AATTTTTATTTCTTATTTGATGG + Intergenic
915052947 1:153095182-153095204 TATATTCCTTTCCTCTTTGAGGG + Intronic
915422650 1:155797114-155797136 TTTTTTTCTTTCTTTTTTTAAGG + Intronic
915608097 1:156967576-156967598 TTTTTTTCTTTTCTATGTTACGG + Intronic
916008426 1:160682453-160682475 TCTTTTTTTTTTTTTTTTGAAGG - Intronic
916241092 1:162640590-162640612 GCTACTTCTTTCTTATTTGAAGG + Intronic
916279811 1:163037306-163037328 TTATTTTTTTTCCAATTTGATGG - Intergenic
916309722 1:163383314-163383336 TCTTTTTCTTTTCTATCTCCTGG + Intergenic
916396574 1:164395408-164395430 TATTTTACTTTCATTTTTGAAGG - Intergenic
916483142 1:165233446-165233468 TCTTTTTCTTTTCTTTGAGATGG - Intronic
916487815 1:165274966-165274988 CCATTTTCTTACCTGTTTGAGGG + Intronic
916539935 1:165743303-165743325 TTTTTTTCTTTTAGATTTGATGG - Exonic
917024413 1:170626701-170626723 TCTTTTTCTTTTTTTTTTGATGG + Intergenic
917077374 1:171219460-171219482 TGTTTCTCTTCCTTATTTGAAGG + Intergenic
917077864 1:171224458-171224480 TGTTTCTCTTCCTTATTTGAAGG + Intergenic
917221684 1:172737434-172737456 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
917221857 1:172740259-172740281 TCTTTTCCTTTCCATTTTCATGG + Intergenic
917606605 1:176637634-176637656 GCTTTTTCATGACTATTTGAAGG + Intronic
917619105 1:176777351-176777373 TTTTGTTCTTTCCTTCTTGATGG + Intronic
917756766 1:178109272-178109294 TGTTTTTTTTTCCTAGATGAGGG + Intronic
917882287 1:179349289-179349311 TCTTTTTCATTCGTTTTTCATGG + Intronic
917946582 1:179978754-179978776 TATTTTTCTTTTCTTTTTTATGG + Intronic
918347749 1:183620941-183620963 TCTTTTTCTTACTGATTTGTAGG - Intergenic
918394272 1:184097759-184097781 TCTTTTTCTTCCCTCCTGGAAGG - Intergenic
918475989 1:184926060-184926082 TATTTATCTTTCATGTTTGAAGG + Intronic
918812970 1:189144028-189144050 TCTTTTTAATTCCTCTTTTACGG - Intergenic
918849858 1:189673247-189673269 TCTTTTTCTTTTTCCTTTGATGG + Intergenic
918852980 1:189716725-189716747 TCTTTTTTTTTTCTTTTAGATGG + Intergenic
918951663 1:191148228-191148250 TCTATTACTTTTCTATTTTAAGG - Intergenic
919029402 1:192221327-192221349 TCTTTTTTTTTCTTTTTTAATGG - Intergenic
919068018 1:192717040-192717062 TATTTATCCTTCATATTTGAAGG - Intergenic
919181202 1:194084337-194084359 AATTTTTCTTTACTATTTAATGG + Intergenic
919257221 1:195140223-195140245 TCTCTTTCTTTCCTTTCTGCTGG - Intergenic
919278049 1:195446160-195446182 TATCTTTCTTTCATATATGATGG - Intergenic
919394020 1:197022621-197022643 GATTTTTCTTTCCTATTGCATGG - Intergenic
919482085 1:198102604-198102626 TCTTTTTCTTTCTGATTTATAGG + Intergenic
919574872 1:199295201-199295223 TCTTTGTTTTTCCCAGTTGAAGG + Intergenic
920483814 1:206349506-206349528 TCTTTTTTTTTTTTTTTTGAGGG - Intronic
920559275 1:206927692-206927714 TTTTTTTCTTTCTTCTGTGATGG - Intergenic
920706313 1:208253107-208253129 TCTTTTTCTTTCTTTTTTGCAGG + Intergenic
920780923 1:208990319-208990341 TATTTTTCTTTCAGATTTGGGGG - Intergenic
921024652 1:211266370-211266392 TATTTTCCTTTCCTAGTTGTTGG + Intronic
921193312 1:212728944-212728966 TCTTTTTCTTTCATATTCAAAGG - Intronic
921228956 1:213049766-213049788 TCTTTATTTTTCCTACTAGATGG + Intergenic
921255818 1:213338410-213338432 TCTTTTTCATTCATATTTGTTGG + Intergenic
921271375 1:213473430-213473452 TCTCTTTCTTGCCAATGTGAGGG + Intergenic
921462020 1:215439714-215439736 TATTTATCTTTCATTTTTGAAGG + Intergenic
921494560 1:215823269-215823291 CATTTCTCTTTCATATTTGAAGG + Intronic
921530594 1:216277825-216277847 TCTTTTCCTTCCCTAGTTAAAGG + Intronic
921969542 1:221132740-221132762 TCTTTCTTTTTCCTTTTTGAAGG + Intergenic
922050863 1:221989518-221989540 TTTTTTTTTTTCATTTTTGAGGG - Intergenic
922292845 1:224222904-224222926 TCTTTTTCTTTCTTTTTTTTTGG - Intergenic
922395549 1:225196865-225196887 TTTTTTTCTTGCTAATTTGATGG + Intronic
922495193 1:226051709-226051731 TGTTTTTCTCAACTATTTGATGG + Intergenic
922562777 1:226581064-226581086 TCTTTTCCTTTCCTATGGGCTGG - Intronic
922818016 1:228464754-228464776 GGTTCTTCTTTCCTATTGGACGG + Intergenic
923220367 1:231887395-231887417 ACTTGTTCTTTTCCATTTGAAGG + Intronic
923248943 1:232161470-232161492 TGTTTTTCTTTCCTTTTAGTAGG - Intergenic
923527958 1:234787876-234787898 TCTTTTTCAAATCTATTTGAAGG + Intergenic
923568874 1:235097122-235097144 TTTTTTTCTTTCAGATTTTATGG + Intergenic
923672611 1:236053616-236053638 TCTTCTTCCTGCCTATTTGTAGG + Intronic
923907218 1:238398689-238398711 TCTGTTTCTTTCCAAGTTGGTGG - Intergenic
923980163 1:239312528-239312550 TCCTTTCTTTTCCTATTTGGAGG - Intergenic
924079460 1:240378848-240378870 TGTTTTTCTTTAATATTTGAGGG + Intronic
924194059 1:241586658-241586680 TCTTTTTTTTTCTTGTTTCAGGG + Exonic
924217303 1:241836809-241836831 TTTTTTTTTTTACTATATGATGG - Intergenic
924317386 1:242812809-242812831 TTTTTTTCTTTTGTTTTTGATGG + Intergenic
924364913 1:243282642-243282664 TATTTTTCTTTCTCTTTTGAAGG + Intronic
924497108 1:244601461-244601483 CCTTTTTCTTTACTGTTTTATGG - Intronic
924499607 1:244624795-244624817 TCTTTTTTTTTTTTCTTTGATGG - Intronic
924702775 1:246470947-246470969 TATTTTTCTTAACTATTTGAGGG - Intronic
1062903228 10:1161539-1161561 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1062917113 10:1249065-1249087 TCTTTTCCTCTGCTACTTGATGG - Intronic
1063035986 10:2287379-2287401 TCTTTTTTTTTCCTTTTGCATGG + Intergenic
1063043188 10:2364618-2364640 TCTTTTTCTTTTTTTTTGGACGG + Intergenic
1063238357 10:4142330-4142352 TATTTTTTTTTCTTATTTTAAGG + Intergenic
1063345388 10:5307173-5307195 TATTTTTATTTTTTATTTGAGGG - Intergenic
1063399760 10:5731694-5731716 TCTTGGTCTTTCCTATTTCTTGG - Intronic
1063794613 10:9498747-9498769 CCTCTTTCTTTCCTCTGTGATGG + Intergenic
1064034785 10:11906458-11906480 TTTTTTTTTTTTCTTTTTGATGG - Intergenic
1064047959 10:12035380-12035402 TCTTTTTCTTCCATACTTGCTGG + Exonic
1064183459 10:13139778-13139800 TATTTCTCTTTCATTTTTGAAGG + Intergenic
1064277181 10:13916855-13916877 TCTGTTTCTTTCTTTTTTGGGGG - Intronic
1064403939 10:15043789-15043811 TCTTTTATTTTCCTAATAGATGG + Intronic
1064603128 10:17013441-17013463 TCTCTTTCTTTCCTTTCTGCTGG + Intronic
1064607587 10:17060123-17060145 TCTTTTTCTTTTTTTTTTCATGG + Intronic
1064768056 10:18695291-18695313 TATTTTTCTTTTCAACTTGAAGG - Intergenic
1064825637 10:19396140-19396162 TCTTTTTTTTTTTTTTTTGATGG + Intronic
1064826269 10:19405858-19405880 TTTTTTTTTTTCCTTTTTGCTGG + Intronic
1065071274 10:22026338-22026360 AATTTTTCTTTCATTTTTGAAGG + Intergenic
1065079557 10:22114246-22114268 TCTTTTTCTTGCTAATTTGTTGG + Intergenic
1065362873 10:24905644-24905666 TCTTTATCTTTCCTGCTGGATGG + Intronic
1065939328 10:30549815-30549837 TATTTTTCTTTCCTAATTAAGGG - Intergenic
1066263669 10:33753867-33753889 TCTTGTGATTTCCCATTTGATGG + Intergenic
1066339896 10:34521434-34521456 ACTTTTCCTTTACTTTTTGAAGG - Intronic
1066514453 10:36141611-36141633 TCATTTTCTTACCTATTCAAGGG + Intergenic
1066575306 10:36818501-36818523 TCTTTTTCTTCCTTTTTTGAGGG + Intergenic
1067486003 10:46650763-46650785 TCATTTTCTTAGCTACTTGAAGG + Intergenic
1067608753 10:47690891-47690913 TCATTTTCTTAGCTACTTGAAGG - Intergenic
1067637562 10:48012033-48012055 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1067765475 10:49082669-49082691 TCTTTTCCTTTTGTTTTTGATGG - Intronic
1068134037 10:52933325-52933347 CCTTTTTCTTTCCCCTTTAAAGG + Intergenic
1068217481 10:54001095-54001117 TATTTCTCCTTCCTGTTTGAAGG - Intronic
1068360101 10:55966673-55966695 TTTTTTTTTTTCCTTTTGGAAGG + Intergenic
1068418349 10:56755956-56755978 TCTCTTTGTGTCCTATTTGGAGG + Intergenic
1068473251 10:57491934-57491956 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
1068558869 10:58490057-58490079 TATTTTTCCTTCCTTTTTGAAGG + Intergenic
1068635966 10:59348641-59348663 TCTTTTTTTTTCCTTTGAGATGG + Intronic
1068982972 10:63081001-63081023 TTTTTTTCTGTACTATTTAATGG - Intergenic
1069126995 10:64648185-64648207 TGTTTTTTTTTCTTATTAGAGGG + Intergenic
1069135408 10:64757544-64757566 TTTTTTTCTTTCTTCTTTCATGG - Intergenic
1069144230 10:64869038-64869060 TATTTTACTCTCCTAATTGAAGG + Intergenic
1069220039 10:65871697-65871719 TCTTTTTCTGTCCTCTGAGAGGG - Intergenic
1069313609 10:67070254-67070276 TCTTTATCTTTTTTATTTGCAGG + Intronic
1069335610 10:67346461-67346483 TATTTCTCTTTCATCTTTGACGG + Intronic
1069395201 10:67980097-67980119 TATTTATCTTTCATGTTTGAAGG - Intronic
1069532372 10:69228859-69228881 TTTCTTTCTTTCTTTTTTGATGG - Intronic
1069701097 10:70426756-70426778 TGTTTTTCTTTCTTATTTTGAGG + Exonic
1070034557 10:72709582-72709604 TGTTTTTTTTTCTTTTTTGAGGG + Intronic
1070035911 10:72724425-72724447 TCTTTTTCTTTGTAATTTGTGGG + Intronic
1070484775 10:76919569-76919591 TCTATTTCTTTTCTATGTGCTGG - Intronic
1070626919 10:78057674-78057696 TCTTTTTCTTTCTTTTTTTTTGG + Intergenic
1070806376 10:79273357-79273379 TTTCTTTCTTTCCTTTTTGGAGG + Intronic
1070837216 10:79456751-79456773 TTTTTTTTTTTGCTATTAGACGG - Intergenic
1070861023 10:79661908-79661930 TCTTTTTTTTTCCAGTTTAATGG - Intergenic
1071003574 10:80858118-80858140 TCGTTTTCTTTTCTATTTCATGG - Intergenic
1071046456 10:81385496-81385518 TATTTCTCTTTCATGTTTGAAGG + Intergenic
1071624337 10:87152539-87152561 TCATTTTCTTAGCTACTTGAAGG - Exonic
1071663762 10:87532643-87532665 TATTCTCCTTTCCTATTTTAAGG - Intronic
1071739605 10:88342137-88342159 TCCATTTCTTTCCTATTTCCAGG + Intronic
1071891890 10:90018187-90018209 TATTTCTCTTTCATCTTTGAAGG + Intergenic
1072005517 10:91242748-91242770 TTTTTTTCTGAACTATTTGAGGG + Intronic
1072031132 10:91523685-91523707 TTTTTTACTTTTTTATTTGAAGG - Intergenic
1072324819 10:94287722-94287744 CCTTTTTTTTTTCTATTAGAAGG - Intronic
1072624508 10:97102418-97102440 TCTTTTTTTTTTTTTTTTGACGG - Intronic
1072709468 10:97706683-97706705 ATTTTTTTTTTCCTTTTTGATGG + Intergenic
1073246705 10:102095849-102095871 TTTTTTTTTTTCTTTTTTGATGG + Intergenic
1073384979 10:103118895-103118917 TCTTATTCTACCCTATTTGTGGG + Intronic
1073707777 10:106005406-106005428 TTTTTTTCTTTCTTTCTTGAGGG - Intergenic
1073838398 10:107470427-107470449 TCTTTTTCTTTCATATTTTTGGG + Intergenic
1073986861 10:109219353-109219375 TCATTTTCTTTTCTATTTACCGG + Intergenic
1074398313 10:113118882-113118904 TAATTTTCTTTGCTATTTGGAGG + Intronic
1074495936 10:113980156-113980178 TCTTTTTCTTCAATATTGGATGG - Intergenic
1074932009 10:118137721-118137743 TCTATTTCTTTCTAATTTGTTGG + Intergenic
1074992727 10:118724797-118724819 GCTTTTTCTCTCCTATTTCTGGG - Intronic
1075074885 10:119344072-119344094 TCTTTTTCTTTTTTTTTTGGCGG + Intronic
1075346719 10:121687547-121687569 TCTTTTTCTTTCCGCTTTGTAGG + Intergenic
1075496568 10:122924704-122924726 TCTTTCTCCTTCATGTTTGAAGG - Intergenic
1075750384 10:124765285-124765307 TGTTTTACTTTTCTATTTGTGGG - Intronic
1075754131 10:124797505-124797527 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1075760895 10:124855712-124855734 TTTTTTTCTTTCCTTTGAGAAGG + Intergenic
1076022525 10:127085750-127085772 TCTTTTTCTTTTTTTTTAGATGG - Intronic
1076796792 10:132802279-132802301 TCTTTTTCCTTCCTGTCTGCAGG - Intergenic
1076870773 10:133192600-133192622 TCTTTTTCTTTTCTATTCCTTGG - Intronic
1077645749 11:3922421-3922443 TCTTTTTCTTACTGATTTGTAGG + Intronic
1078064570 11:8069596-8069618 TCTTTTATTTTCCTATCTAATGG + Intronic
1078284832 11:9941776-9941798 TTTTTTTCTTTCTTATTTTCTGG - Intronic
1078513918 11:12007505-12007527 TCTTGTTCTGTCCTCTGTGATGG - Intronic
1078678921 11:13456642-13456664 TCTTTTTCTTTCCTTCTTTAAGG - Intronic
1078702888 11:13705661-13705683 TTTTTTTCTTCCTTAATTGAGGG - Intronic
1079439930 11:20501986-20502008 TGTTTTTCTTTCCTTTTTCTGGG + Intronic
1079450099 11:20593347-20593369 TCTTTTTTTGTCCTAGTTGGTGG - Intergenic
1079472528 11:20791736-20791758 TTTTTTTTTTTTCTATTTGTAGG + Intronic
1079631068 11:22676141-22676163 TCTTTTTCTGACCTATCTGTTGG - Intronic
1079662760 11:23061376-23061398 TCTTTTTCTTTCTGCTCTGACGG + Intergenic
1079819795 11:25111267-25111289 TTTTTTTTTTTCCTATTTGGAGG + Intergenic
1079872439 11:25816507-25816529 TTTTTTTTTTTCTCATTTGATGG - Intergenic
1079901420 11:26191272-26191294 TGTTTTTTTTTCTTTTTTGATGG - Intergenic
1080008229 11:27431659-27431681 TCTTTTTCTTCCATATTTCTTGG + Intronic
1080074383 11:28131511-28131533 TTTTTTTTTTTGCCATTTGAAGG + Intronic
1080129126 11:28772697-28772719 TCTTTTTCTCTGCTACTTCAGGG + Intergenic
1080149823 11:29038398-29038420 TTTTTTTTTCTCCTTTTTGAGGG + Intergenic
1080197179 11:29625407-29625429 TCTTTTTCTGTTGTTTTTGATGG + Intergenic
1080216292 11:29845112-29845134 TCTTTTGCTTACATTTTTGAAGG + Intergenic
1080238079 11:30095034-30095056 TCTTTTTTTTTACTGTTTCATGG + Intergenic
1080250193 11:30225316-30225338 TCTTTTTGCTTCTTCTTTGAAGG - Intergenic
1080315068 11:30938541-30938563 TTTTTTCCTTTCTTCTTTGAGGG + Intronic
1080351337 11:31388525-31388547 TATTTCTCCTTCATATTTGAAGG - Intronic
1080681182 11:34477567-34477589 TCTTTTTCTTTTTTTTTGGAAGG + Intergenic
1080718134 11:34823855-34823877 TCTTTTTTTTCCCTCTTTGGAGG + Intergenic
1080735853 11:35012957-35012979 TTTTTTTTTTTCCTTTTTAAGGG - Intronic
1081010216 11:37801680-37801702 TTTCTTTCTTTCATTTTTGATGG - Intergenic
1081035902 11:38146303-38146325 TCTTTTTCCTTCTTAATTGTTGG + Intergenic
1081155767 11:39687993-39688015 CATTTTGCTTTCCTATTTCAAGG - Intergenic
1081333910 11:41839681-41839703 TATTTTTCCTTCCTTTTTAAAGG - Intergenic
1081740923 11:45439964-45439986 TCTATTTTTTTTCTATCTGAAGG + Intergenic
1081945031 11:46984736-46984758 TTTTTTTTTTTTCTTTTTGATGG - Intronic
1082097947 11:48146365-48146387 TGCTTTTCTTTCCTAGTTGGTGG + Intronic
1082188570 11:49213889-49213911 CCTTTTTCTTTTTTATTTGTAGG + Intergenic
1082202534 11:49390257-49390279 TCTTTTCCTTACCTATTTCCTGG + Intergenic
1082676264 11:56107516-56107538 TGTTTTTCTCTGCTATTTAATGG + Intergenic
1082689898 11:56288231-56288253 TGTTTTTCTGTGCTATTTAAAGG - Intergenic
1083080246 11:60084931-60084953 TCTTTTTCTTTCCCTTCTCAGGG + Intergenic
1083129735 11:60613931-60613953 TCTTTTTCTTTTTTTTTTTATGG - Intergenic
1083360772 11:62106105-62106127 TGTTTTTTTTTCCTATGAGACGG + Intergenic
1083427007 11:62593428-62593450 TTTTTTTTTTTCCTAATTGGGGG - Exonic
1083512572 11:63225360-63225382 TATTTCTCATTCATATTTGAAGG + Intronic
1083967888 11:66053876-66053898 TTTTTTTTTTTCCTATTTTTTGG - Intronic
1083986925 11:66221638-66221660 TCTTTTTTTTTTTTTTTTGAGGG - Intronic
1084427428 11:69092837-69092859 TCTTTTTCTTCCTAATTTGTAGG - Intergenic
1084466927 11:69328771-69328793 TCTTTTTCTAACATATTGGACGG - Intronic
1085899628 11:80683504-80683526 TCTTTTTCTGAACAATTTGAGGG + Intergenic
1086277155 11:85145050-85145072 TATTTTTCCTTCATGTTTGAAGG + Intronic
1086379457 11:86236963-86236985 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1086597930 11:88596261-88596283 TCTGTTTCTTCCCTAATTCAAGG + Intronic
1086616348 11:88825132-88825154 TATTTTTATTACCTATCTGATGG + Intronic
1086677952 11:89632808-89632830 CCTTTTTCTTTTTTATTTGTAGG - Intergenic
1086733615 11:90279596-90279618 TCTTTTTCTTGCCCAATTGCAGG + Intergenic
1086748565 11:90461539-90461561 TCTTTTTTCTCCCTTTTTGAGGG + Intergenic
1086825235 11:91488392-91488414 TCTTTTTCTTTTGTCTTTGTTGG + Intergenic
1086885801 11:92204427-92204449 TCCTGATCTTTCCTATTTAATGG + Intergenic
1086999891 11:93406755-93406777 TGTTTTTCTTACTAATTTGAAGG - Intronic
1087017114 11:93564577-93564599 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1087299522 11:96415470-96415492 TATTTTTCTTTGATGTTTGAAGG - Intronic
1087398880 11:97638431-97638453 TCTTTTTTTTTTTTTTTTGAAGG - Intergenic
1087757611 11:102071914-102071936 TCTTTTTCTTTAACTTTTGATGG + Intronic
1087809865 11:102598969-102598991 TCATCTTCTTTCCTATTTGTGGG + Intronic
1087847291 11:102987872-102987894 TCTTTTTCTGTTCTCTTTGTTGG - Intergenic
1087927163 11:103932188-103932210 TTTTTTTTTTTACTTTTTGATGG + Intronic
1088101796 11:106164296-106164318 CCTTTTTCTTTCCTCTTTTAGGG + Intergenic
1088200861 11:107332456-107332478 TGTTTTTCTTTGCTGTATGAAGG - Intronic
1088372328 11:109105569-109105591 TCTTTTTTTTTTGTCTTTGATGG + Intergenic
1088481282 11:110298094-110298116 TTTTTTTCTTACCTACTTCATGG - Intergenic
1088601623 11:111483762-111483784 TCTTTGTCTGTCCTCTTTAAGGG - Intronic
1088771649 11:113041972-113041994 TCTCTTTCTTTCTAATTTCATGG + Intronic
1088854202 11:113732199-113732221 TCTTTCTTTTTCCTGTTTAAGGG - Intergenic
1088880108 11:113966668-113966690 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1089004329 11:115078364-115078386 TCTTTTTCTTTGCTAAATGATGG + Intergenic
1089192772 11:116666203-116666225 TCTCTTTCCTTCATGTTTGAAGG - Intergenic
1089372466 11:117971077-117971099 TCTCTTCCTTCCCTCTTTGAAGG + Intergenic
1089506722 11:118968311-118968333 TCTTTTTTTTTCTTAGATGAGGG + Intergenic
1089633432 11:119797341-119797363 TTCTTTTCTTTCCCACTTGAAGG - Intergenic
1090149344 11:124366098-124366120 TATGTTTGGTTCCTATTTGATGG - Intergenic
1090177621 11:124665033-124665055 TCCTTTGCATTCATATTTGATGG - Intronic
1090200846 11:124854913-124854935 TAATTTTGTTTCCTATTTCATGG + Intergenic
1090298175 11:125608897-125608919 TTTTTTTCTTTCCTATTGATTGG + Intronic
1090465982 11:126933768-126933790 TTTTTTTTTTTCCTTTTTGGTGG - Intronic
1090480361 11:127062260-127062282 GCTCTTTGTTTCCTCTTTGAGGG + Intergenic
1090491262 11:127162834-127162856 TGGTAATCTTTCCTATTTGAAGG + Intergenic
1090682275 11:129073999-129074021 TATTTCTCTTTCATTTTTGAGGG - Intronic
1090770888 11:129918939-129918961 TATGTATCTTTCCTATTTAATGG - Intronic
1090856162 11:130610805-130610827 TCTTTTTCCTTCATCTTGGAGGG + Intergenic
1090934196 11:131327187-131327209 GATTTTTCTTTCCTATTTTTAGG - Intergenic
1090937860 11:131361174-131361196 TTTTTTTTTTTTTTATTTGACGG + Intergenic
1090966727 11:131604703-131604725 TTTTTTTCTTTCCTTTTTTTGGG + Intronic
1091066701 11:132520401-132520423 TCTTTCTCTGACCTATTTTAGGG + Intronic
1091072987 11:132586510-132586532 CCTTTTCCTTTCCTATCAGAAGG + Intronic
1091098481 11:132846504-132846526 TCTAATTCTTAACTATTTGAGGG - Intronic
1091467523 12:698159-698181 TGTTCTTCTTCCTTATTTGAAGG + Intergenic
1091863684 12:3810591-3810613 TCTTTTTCTTTCTTTTTTTTTGG - Exonic
1092347463 12:7727608-7727630 TCTTTTTCTTTTTTTTTAGACGG - Intergenic
1092459593 12:8674538-8674560 CCTTTTTTTTTCCTTTTTTATGG + Intergenic
1092492477 12:8957976-8957998 TCTTATTCATTCCCTTTTGATGG + Intronic
1092561324 12:9616845-9616867 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1092664188 12:10776496-10776518 CTTTTTTCTTTCATAGTTGAGGG + Intergenic
1092853400 12:12651022-12651044 TCTTTTTTTTTCTTATTTTGAGG + Intergenic
1093142803 12:15528918-15528940 TATCTTTCCTTCATATTTGAAGG - Intronic
1093292335 12:17343237-17343259 TCTTTTTCTTTCCTCTTCTCTGG + Intergenic
1093566079 12:20605489-20605511 TTTTCTTTTTTCTTATTTGATGG + Intronic
1093847094 12:23985981-23986003 CCTTCTTCTTTCCCATTTGAGGG + Intergenic
1094114883 12:26900194-26900216 TCTTTTTCTTTGATCTTTGTTGG - Intergenic
1094158924 12:27369279-27369301 TCTTTTTTTTTCTTTTTTGGTGG + Intronic
1094196488 12:27755071-27755093 TTTTTTTCCTTCCTTTTTAAGGG - Intronic
1094228047 12:28068549-28068571 TCTTTGTCTTTGATATTTGATGG - Intergenic
1094564192 12:31584843-31584865 TCTTTTTCTTTCTTTTTTTTCGG - Intronic
1095133853 12:38573847-38573869 TATTTCTCCTTCATATTTGAAGG - Intergenic
1095192974 12:39279578-39279600 TATTTCTCTTTCATTTTTGAAGG - Intergenic
1095224479 12:39663904-39663926 TATTTCTCTTTCATTTTTGAAGG + Intronic
1095377887 12:41552891-41552913 TAATTTACTTTCCTAATTGAAGG - Intronic
1095449381 12:42313910-42313932 TTTTTTTCTTTCTTCTTTGGAGG + Exonic
1095572022 12:43694187-43694209 TGTCTTTATTTACTATTTGAAGG + Intergenic
1095807935 12:46341703-46341725 TATTTCTCTTTCTTGTTTGAAGG + Intergenic
1095811487 12:46376549-46376571 TTTTTTTCTTTTTTTTTTGAAGG - Intergenic
1095840926 12:46691553-46691575 TCATTTTCTTTGGTATTTGTTGG - Intergenic
1095877310 12:47095180-47095202 TATTCTACTTTCATATTTGAAGG + Intronic
1096046217 12:48564561-48564583 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1096090817 12:48899514-48899536 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1096136562 12:49207258-49207280 TCTTTTTTTTTTCTTTTTGACGG - Intronic
1096282661 12:50269914-50269936 TTTTTTTTTTTTTTATTTGACGG - Intronic
1096426556 12:51508861-51508883 TGTTTTTCTTTCTTAGGTGAAGG + Exonic
1096431687 12:51549594-51549616 TCTTTTAAGTTCATATTTGATGG + Intergenic
1096664572 12:53154683-53154705 GCCTTTATTTTCCTATTTGAGGG + Intergenic
1097409776 12:59237010-59237032 TCTTTTCCTTGCCAATTTAAAGG + Intergenic
1097441177 12:59610698-59610720 TCTTTATGTTTCCTATCAGAGGG - Intronic
1097551868 12:61082260-61082282 TTTTTTTTTTTTATATTTGAAGG - Intergenic
1097594534 12:61612022-61612044 TCTTTTTCTTCACAATTTCATGG + Intergenic
1097665227 12:62470679-62470701 TCTTATTATTTCCTATTTGCAGG + Intronic
1097870809 12:64600569-64600591 TTTTTTTCTTTCTCATTTGAGGG + Intergenic
1097900456 12:64867879-64867901 TGCTTTTTTTTTCTATTTGAAGG + Intronic
1098098624 12:66988381-66988403 TCTTTTTCTTTTTTTTTAGATGG + Intergenic
1098246762 12:68527135-68527157 TCTTTTTCTTTTATATTTAGAGG + Intergenic
1099025326 12:77458388-77458410 ACTTTTTTTTGCTTATTTGAGGG + Intergenic
1099068629 12:78016623-78016645 TGCTTTTCTTTCCTTTTTGTTGG + Intronic
1099339106 12:81404735-81404757 TATTTTGCTTTTCTACTTGAAGG + Intronic
1099373294 12:81865326-81865348 GCTGATTCTTTCCTATCTGAGGG + Intergenic
1099485679 12:83226591-83226613 TCTTTTTCTTTTTTTTTTGGTGG - Intergenic
1099496653 12:83355573-83355595 TCTCTTTTTTTCCTATTTAATGG + Intergenic
1099528226 12:83741733-83741755 TCTTTGTCTTTGATATTTGTTGG - Intergenic
1099702993 12:86112849-86112871 TCTTTTTGTTTCCTATAATATGG - Intronic
1099882433 12:88482400-88482422 TATTTCTTTTTCATATTTGAAGG - Intergenic
1100046947 12:90393770-90393792 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1100231327 12:92611305-92611327 TTTTTTTCATTCATATTTAAAGG + Intergenic
1100233444 12:92633540-92633562 TCTTGTTCTGTGCTATTAGAGGG - Intergenic
1100239777 12:92699755-92699777 GTTTTTTCTTTTATATTTGAAGG - Intergenic
1100248291 12:92787165-92787187 TCTGTTTCTTTCCTATGTTTGGG - Intronic
1100360587 12:93876038-93876060 TATTTCTCTTTCATATTTGAAGG + Intronic
1100479317 12:94962548-94962570 TTTTTTTTTTTTTTATTTGACGG - Intronic
1100506036 12:95221178-95221200 TCTTTTTCTTGCTGATTTGAAGG + Intronic
1100529195 12:95448606-95448628 TCTGTTTCTGTCCTATCAGAGGG + Intergenic
1100680518 12:96914982-96915004 TCTTTTTCTATTTTATTTAAAGG + Intronic
1100832210 12:98526953-98526975 TCTTTTTCTTTTTTTTTTGGAGG - Intronic
1101113451 12:101508394-101508416 TTTTTTTTTTTCCTTTTTCAAGG + Intergenic
1102049075 12:109849202-109849224 TCTTTTTTTTTTTTTTTTGAAGG - Intergenic
1102272066 12:111545557-111545579 TCTTTTTCTTTTTTTTTAGATGG - Intronic
1102636997 12:114333216-114333238 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1102814256 12:115850511-115850533 TCTTTTTTGTTCCCATTTGTAGG + Intergenic
1102900874 12:116635712-116635734 TCTTGTTTTTTCATATTTGGAGG - Intergenic
1104126023 12:125846991-125847013 TATTTTTGTTTCCTGTTTGGGGG - Intergenic
1104506411 12:129336565-129336587 TCTTTTTTTTTTCTTTTTGACGG - Intronic
1104512796 12:129396490-129396512 TCTTTTCCTTTCCTACTGGCTGG + Intronic
1104703957 12:130928922-130928944 TCATTGTTTTTTCTATTTGAGGG - Intergenic
1105006310 12:132723040-132723062 TTTTTTTTTTTCTTATTAGATGG - Intergenic
1105427291 13:20305099-20305121 TCTTTTTCTTTTCCATTTTTAGG - Intergenic
1105649256 13:22356678-22356700 TCTTTTTGTTTCTTAAGTGAAGG + Intergenic
1105709591 13:22994602-22994624 TCATTTTCTTTTCTATTTATGGG - Intergenic
1105876840 13:24562566-24562588 TTTTTTTTTTTCAAATTTGAGGG + Intergenic
1105900838 13:24751541-24751563 TTTTTTTCTTTTTTATATGAAGG + Intergenic
1106028718 13:25978970-25978992 TGTTTTTTATTCATATTTGATGG + Intronic
1106084729 13:26531242-26531264 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1106156648 13:27164078-27164100 TTTTTTTTTTTCCTTTTTGTAGG - Intronic
1106186479 13:27414371-27414393 TCTCTTTCTTTCTTATTTTTAGG + Intergenic
1106482070 13:30144101-30144123 CCTTTCTCTTTCCTACTTGCAGG - Intergenic
1106507726 13:30386023-30386045 TTTTTTTCTTTCCTTTTTTATGG - Intergenic
1106542953 13:30706201-30706223 TCTTTTTAACTCCTTTTTGATGG - Intergenic
1106553981 13:30794431-30794453 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1106642959 13:31604964-31604986 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1106744381 13:32684352-32684374 TCTTTTTCTTTCTTCTTTCAGGG + Intronic
1106801804 13:33263552-33263574 TGTTCTTCTTTCCTGTTTCACGG + Intronic
1106870808 13:34017521-34017543 TCTTTTTTTTTCCTCCTTGTAGG + Intergenic
1106915367 13:34508041-34508063 TCTTTTTCTTTTTTTTGTGACGG + Intergenic
1106954754 13:34924383-34924405 TTTCTTTCTTTTTTATTTGATGG + Intergenic
1107036863 13:35911287-35911309 TCTTTTTTTTTTTTTTTTGACGG - Intronic
1107071995 13:36280220-36280242 TCTTTTTGTTTCCTTTTTATAGG - Intronic
1107197924 13:37676223-37676245 TCTTTATCTTTTGTTTTTGACGG - Intronic
1107331005 13:39299784-39299806 TCCTTTTTTTTCCTAGTTGGTGG - Intergenic
1107589700 13:41890126-41890148 TCTGTTTCTTTACTGTTTGTGGG - Intronic
1107628073 13:42310852-42310874 TCTTTTTTTTTTTTTTTTGACGG - Intronic
1107754260 13:43601958-43601980 TATTTCTCCTTCCTATTTGAAGG - Intronic
1108068385 13:46602624-46602646 TATTATTATTTCCTAATTGAAGG + Intronic
1108648454 13:52452794-52452816 TTTTTTTCTTTCATAGTTCATGG + Intergenic
1108808971 13:54196852-54196874 TTTTTTTCTTTCTTACTTCATGG - Intergenic
1108849047 13:54705676-54705698 TCTTTCTCTTTCCTCTCTGCTGG - Intergenic
1109016537 13:57021942-57021964 TATTTTTCCTTCATGTTTGAAGG - Intergenic
1109100515 13:58179080-58179102 TATTTCTCTTTCATGTTTGAGGG + Intergenic
1109305919 13:60641408-60641430 TTTTTTGCTATACTATTTGAAGG + Intergenic
1109364928 13:61342005-61342027 TCTTTTTCTTTCTTTTTTTTTGG - Intergenic
1109554461 13:63953940-63953962 TATTTTTCCTTCATGTTTGAAGG + Intergenic
1109556226 13:63979339-63979361 TCTCTTTCTGTCCCATTTAATGG + Intergenic
1109582537 13:64361760-64361782 TATTTCTCTTTCATGTTTGAAGG + Intergenic
1109828652 13:67756884-67756906 CCTATTTCTTTCCTTTTAGAAGG + Intergenic
1110063157 13:71067136-71067158 TTATTTTCTTACCTATTTGTTGG + Intergenic
1110179960 13:72604816-72604838 TCTTTTGCTTTCCTGTTTTGAGG - Intergenic
1110197508 13:72806986-72807008 TTTTTTTTTTTTCTATTTTAAGG + Intronic
1110397941 13:75053746-75053768 TCTATTTATATCCTCTTTGAGGG - Intergenic
1110475596 13:75909692-75909714 TATTTTTCTTTCCTATTATAGGG + Intergenic
1110501460 13:76232591-76232613 TATTTTTCCTTCATGTTTGAAGG - Intergenic
1110541176 13:76708470-76708492 TCTCTTTTTTTCCTTTATGAAGG + Intergenic
1110558980 13:76889658-76889680 TCTGTTTCTTGCCTATTGGTTGG + Intergenic
1110602645 13:77393635-77393657 TTATTTTCTTTCATAATTGATGG + Intergenic
1110667063 13:78129296-78129318 TTTTTTTCTTTCTTATTTATAGG + Intergenic
1111254371 13:85646520-85646542 TCTTTTCACTTCGTATTTGAAGG - Intergenic
1111292103 13:86184303-86184325 TATTTATCTTTCATGTTTGAAGG - Intergenic
1111292867 13:86189899-86189921 TATTTCTCTTTCATGTTTGAAGG + Intergenic
1111300245 13:86340553-86340575 TATTTCTCTTTCATGTTTGAAGG + Intergenic
1111338817 13:86856855-86856877 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1111346685 13:86966264-86966286 TCTTTTTCTTTACTGCTTTAAGG - Intergenic
1111365038 13:87232731-87232753 TATTTCTCCTTCGTATTTGAAGG + Intergenic
1111783778 13:92762033-92762055 TCTTTTTTTTTTCTATTTGAAGG - Intronic
1112039678 13:95534256-95534278 TCTTTTTCTTTCCTATTTGAAGG - Intronic
1112219404 13:97472547-97472569 TCTTTTACTTACATATTTGTAGG + Intergenic
1112269763 13:97958019-97958041 TCTTTTTCTTTCTGATTGCAAGG - Intronic
1112618669 13:101032895-101032917 TATTTCTCTTTCATGTTTGAGGG + Intergenic
1112737486 13:102437613-102437635 TTTTTTTTTTTCCTTTTTGGGGG - Intergenic
1112765078 13:102733107-102733129 TCTTCTGCTTTCCACTTTGAAGG + Exonic
1113108863 13:106800225-106800247 TTTTTTTCTTTTCTTTTTGATGG - Intergenic
1113312409 13:109144025-109144047 TCTTTTTTTTTTTTTTTTGACGG + Intronic
1113538646 13:111088599-111088621 TCTTTTTCTTTCTTATTCACTGG + Intergenic
1113771191 13:112910182-112910204 TCTTTCTCTTTCCATTTTTATGG + Intronic
1114179300 14:20351853-20351875 TTTTTTTCTTTCCTTTTTTTTGG - Intronic
1114456762 14:22860039-22860061 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1114561951 14:23599437-23599459 TATATCTCTTTCATATTTGAAGG + Intergenic
1114723317 14:24906830-24906852 TCTTTGTTTTTCCTCTTAGAGGG - Intronic
1114870779 14:26655505-26655527 TTGTTTTCTTTGCTGTTTGAAGG - Intergenic
1114907428 14:27148071-27148093 TCTTTTTTTTTCCATTTTCATGG + Intergenic
1115039162 14:28899944-28899966 TCTTTTTCCTTACTATTTATAGG + Intergenic
1115039931 14:28911745-28911767 GCTTTTTCTATGTTATTTGAAGG + Intergenic
1115051696 14:29071499-29071521 ACTTTTTCTGTACCATTTGAGGG + Intergenic
1115470298 14:33761698-33761720 TCATCTTCTTTGCTATTTTATGG - Intronic
1115597491 14:34923256-34923278 GCTTTGTTTTTCCTCTTTGAAGG + Intergenic
1115821195 14:37213983-37214005 TATTTCTCTTTCATGTTTGAAGG - Intronic
1115873437 14:37833050-37833072 TCTTTTTTTTTTTTTTTTGATGG - Intronic
1116082410 14:40191321-40191343 TCTCTTTCTTTCATTTTTCAAGG - Intergenic
1116377398 14:44220878-44220900 TCATTTTATTTCCTTGTTGAAGG - Intergenic
1116577481 14:46592980-46593002 ACTTTTTCTTTCCTATTTCTTGG - Intergenic
1116579852 14:46626278-46626300 TGTCTCTTTTTCCTATTTGAAGG - Intergenic
1116665678 14:47771473-47771495 TCTTCTTCTTTCTTTTTTGATGG - Intergenic
1116933983 14:50718341-50718363 CATTTTTCTTTCCTGTTTGGAGG - Intergenic
1117110535 14:52448445-52448467 TATTTCTCCTTCATATTTGAAGG - Intronic
1117152303 14:52901945-52901967 TCTCTGTCTTTCCTGTTAGAAGG - Intronic
1117431452 14:55667908-55667930 TTTTTTTTTTTCTTATTTAATGG + Intronic
1117686695 14:58261182-58261204 TTTTTTTTTTTCCTTTTTGGGGG + Intronic
1117911944 14:60645176-60645198 TATTTTTCTTTCTTACTTAATGG - Exonic
1117935659 14:60903875-60903897 TTTTTTTTTTTTCTTTTTGATGG + Intronic
1118245295 14:64104377-64104399 TCTTTCTCTTTCGTCTGTGATGG + Intronic
1118300515 14:64611405-64611427 TTGTTTGCTTTCCTATTTGTAGG - Intergenic
1118421192 14:65605944-65605966 CCTTTTTCTTACAGATTTGAAGG + Intronic
1118614092 14:67563414-67563436 TCTTTTTCTTTTCTTTTTTTTGG + Intronic
1118647771 14:67856359-67856381 TTTTTTTTTTTCCTTTTTTATGG + Intronic
1118683365 14:68266156-68266178 TCTTTTTCTCACCTATTGCAAGG + Intronic
1118886880 14:69874837-69874859 TCTTTTTCCTTCCTGTTGGCTGG + Intronic
1118993848 14:70820029-70820051 GCTATTCCTTTCCTAGTTGAAGG + Intergenic
1119072775 14:71604612-71604634 TCTTTTTCCTTCATTTATGAAGG + Intronic
1119244037 14:73088065-73088087 GCTTTTTCTCTCCAATTTGCAGG - Exonic
1119247336 14:73123259-73123281 TCTTTTTTTCTCCTTTTTAATGG + Exonic
1119298902 14:73555414-73555436 TATTTCTCTTTCATGTTTGAAGG - Intronic
1119343234 14:73899270-73899292 TCTTTTTTTTTCCCTTTTTATGG + Intronic
1119559715 14:75580266-75580288 TCTCTTTCTTTCTTATTGGAAGG + Intronic
1119714129 14:76846474-76846496 TATTTTTTTTTCCTCTTTTATGG - Intronic
1119897205 14:78230419-78230441 TATTCTTCTTTCCTAGGTGATGG + Intergenic
1120203509 14:81563388-81563410 TCTCTTTCTCTCTTATCTGAGGG - Intergenic
1120237969 14:81914847-81914869 TTTTGTTATTTCCTTTTTGATGG + Intergenic
1120292873 14:82599193-82599215 TCTTTTTCTTTCTTTTCTCAAGG - Intergenic
1120315001 14:82880498-82880520 AATTTTTCTTTCGTATTTTAAGG + Intergenic
1120525269 14:85569787-85569809 TCTTTTTCTGTGCTTTTGGAGGG + Intronic
1120726893 14:87953676-87953698 TCATTTTCTTAGCTACTTGAAGG - Intronic
1121504645 14:94467680-94467702 TCCTTCTCTTTCCTCTTTGCAGG + Intronic
1121813267 14:96910212-96910234 GCTTTTTCTTATCTATTTGCAGG + Intronic
1121885882 14:97542366-97542388 TTTTTTTCTTTCTTCTTTGCAGG - Intergenic
1122220342 14:100234804-100234826 CCTATTTCCTTCCTACTTGAAGG + Intergenic
1122249512 14:100428046-100428068 CCCTTTCCTTTCCTTTTTGAGGG + Intronic
1123148459 14:106157337-106157359 TCTTTTTTTGTCCATTTTGATGG - Intergenic
1123675107 15:22703121-22703143 TCTTTTTTTTTCTTTTTTGAGGG + Intergenic
1124079923 15:26483322-26483344 TGTTTTTCTTTCCTTCCTGATGG - Intergenic
1124122046 15:26895808-26895830 TCTTTTTTTTTTTTTTTTGACGG - Intronic
1124128816 15:26966906-26966928 TTTTTTTTTTTTCTATTAGACGG - Intergenic
1124408955 15:29419717-29419739 TCTTTTTGTTACTTCTTTGAAGG - Intronic
1124529113 15:30488007-30488029 TTTTTTTTTTTCTTTTTTGAGGG + Intergenic
1124682517 15:31747062-31747084 TTTTTTTCTTTAGTATTTGATGG + Intronic
1124769547 15:32519686-32519708 TTTTTTTTTTTCTTTTTTGAGGG - Intergenic
1124892595 15:33746746-33746768 TCTTTTTCTTTTCTTTGAGATGG - Intronic
1124909170 15:33901263-33901285 TCTTTTTCTTTTCTTTTTTGAGG - Intronic
1125156871 15:36597636-36597658 TCTTTATCTTTCCTTTCTGACGG + Intronic
1125517242 15:40328749-40328771 TTTTTTTATTTCCAAGTTGAAGG + Intergenic
1125643352 15:41249843-41249865 TTTTTTACTTTCCTCTTTCAAGG + Intronic
1125935457 15:43631527-43631549 CCTTTTTTTTTCCTTTTAGAGGG + Intronic
1125948231 15:43728006-43728028 CCTTTTTTTTTCCTTTTAGAGGG + Intergenic
1125994945 15:44150416-44150438 TTTTTTTTTTTTCTTTTTGATGG - Intronic
1126040949 15:44590435-44590457 TTTTTTTCTTTCCTTTGTGTTGG + Intronic
1126055182 15:44723436-44723458 TTTTTTTTTTTCCTTTTTGAGGG - Intergenic
1126090215 15:45044701-45044723 TCTTTTTTTTTTTTTTTTGACGG + Intronic
1126184038 15:45813239-45813261 TATTTTTCCTTCATGTTTGAAGG - Intergenic
1126203223 15:46013376-46013398 TTTTTTTCTTTCTTTTTTGAAGG + Intergenic
1126442543 15:48705912-48705934 TCTCTTTCTTTCTTTTTTGGAGG - Intergenic
1126488955 15:49214955-49214977 TATTTCTCTTTCATGTTTGAAGG + Intronic
1126527087 15:49668012-49668034 TTTTTTTCTTCCCTTTTGGATGG - Intergenic
1126563831 15:50074292-50074314 TTCTTTTCTTTCAAATTTGAAGG + Intronic
1126993204 15:54407840-54407862 ACTTTTTCTTTCTTTTTTGTTGG - Intronic
1127012056 15:54642022-54642044 TCTTTTTCTTTCTTTTGAGATGG + Intergenic
1127012648 15:54646583-54646605 TATTTTTCCTTCATGTTTGAGGG - Intergenic
1127091051 15:55467872-55467894 TTTTTTTCTTGCCCATGTGAGGG - Intronic
1127102300 15:55579102-55579124 TCATTTTTTTTCAAATTTGATGG + Intronic
1127219945 15:56869183-56869205 TCTTTTTTTTTTCTTTCTGAAGG - Intronic
1128073359 15:64810993-64811015 TCTGTTTCCTTCCTAGTTGGGGG - Intergenic
1128333808 15:66773393-66773415 TCTTTTTCTTTTCTTTGTGAAGG - Intronic
1128599682 15:68985449-68985471 TTTTTTTTTTTCTTATTTGCTGG - Intronic
1128726715 15:69993230-69993252 TTTCTTTCTTTCTTTTTTGATGG - Intergenic
1128845919 15:70894266-70894288 TTTTTTTCTTTCTTAATAGAGGG + Intronic
1128993103 15:72276882-72276904 TCTTTTTTTTTTTTTTTTGACGG + Intronic
1129230193 15:74192769-74192791 TGTTCTTCTTTCCCCTTTGAGGG + Intronic
1129372721 15:75108194-75108216 TCCTTCTCTTTCCTCTTTGTAGG - Intronic
1129531891 15:76273192-76273214 TCTTTTTCTTTTCTCTTTGTAGG - Intronic
1129588891 15:76897382-76897404 TTTTTTTTTTTCCTCTTTGGAGG - Intronic
1129909747 15:79216554-79216576 TCTTTTTCTTACCAATTTGGAGG - Intergenic
1130238788 15:82165226-82165248 TCCTTTCCTGTCCTTTTTGACGG - Intronic
1130406466 15:83607001-83607023 TCTCTTATTTTCCAATTTGAAGG + Intronic
1130580071 15:85128975-85128997 TCTTTTTTCTTCCTTTTTTATGG + Intronic
1130603174 15:85291995-85292017 TCTCTTTCTCTCTTTTTTGATGG + Intergenic
1130632560 15:85583370-85583392 TCTTTTTCCTCCCCAGTTGAGGG + Intronic
1130778296 15:87008471-87008493 TCTTTTTCTTTCCAGTCTCAGGG + Intronic
1130806247 15:87326675-87326697 TCTTCTTTTTTCCTAATTGGAGG + Intergenic
1131163027 15:90121425-90121447 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1131252116 15:90837740-90837762 TCTTTTTTTTTCCTTTGAGACGG + Intergenic
1131292770 15:91121543-91121565 TTTTTTTCTTTTCTGTCTGAAGG + Intronic
1131298561 15:91173900-91173922 CCTTTTTCTTCTCTATCTGAGGG + Intronic
1131538411 15:93255998-93256020 TATTTTTATTTGCTATTTAATGG - Intergenic
1131591957 15:93759541-93759563 TCCTATTCTCTCCTTTTTGATGG - Intergenic
1132172773 15:99678895-99678917 TCTTTTTCTTACTGATTTGTAGG - Intronic
1132213293 15:100042442-100042464 TCTTTTTCTTCACAATTTCATGG + Intronic
1133325438 16:4939336-4939358 TCTTTTTCTTTCTTTTTTTTTGG + Intronic
1133561271 16:6952648-6952670 TCTTTTTCTTTTCTTTTTTTTGG - Intronic
1133758096 16:8777432-8777454 TCTTTTTCCTTCCTATTGCCTGG - Intronic
1133833685 16:9348564-9348586 TATTTCTCTTTCATGTTTGAAGG + Intergenic
1133944634 16:10337956-10337978 TCTTTTTTTTTTTTTTTTGACGG - Intronic
1134194189 16:12146265-12146287 TTTTTTTTTTTTCTTTTTGAAGG + Intronic
1134318819 16:13144049-13144071 TCTTTTACTTTTCTCATTGAAGG + Intronic
1134323311 16:13183822-13183844 AGTTTATCTTTCCTATTTCATGG + Intronic
1134355381 16:13477383-13477405 TCTTTTTCTTTCCTTTTGCATGG - Intergenic
1134369242 16:13607843-13607865 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1134470973 16:14525832-14525854 TCTTTTTCTTTTCTTTGAGATGG + Intronic
1134641572 16:15833290-15833312 TCTTTTTCTTTCTTTTGAGATGG - Intronic
1134815239 16:17200213-17200235 TTTTTTTCTTTTTTTTTTGATGG - Intronic
1135106264 16:19652494-19652516 TTTTTTTCTTTCCTCCTTAAAGG - Intronic
1135232892 16:20726173-20726195 TGCTTTTCTTTCTTTTTTGAGGG - Intronic
1135659682 16:24285009-24285031 TCTTTTTTTTTTTTTTTTGATGG - Intronic
1135846900 16:25927056-25927078 TCTTTTTTTTTTCTTTTAGACGG - Intronic
1135866996 16:26112672-26112694 TTTTTTTCTTTTTTATTTGTAGG - Intronic
1136094173 16:27942558-27942580 TCTTTTTCTTACCGATTTATAGG - Intronic
1136681751 16:31970303-31970325 TCTTTTTTTGTCCATTTTGATGG + Intergenic
1136782058 16:32911805-32911827 TCTTTTTTTGTCCATTTTGATGG + Intergenic
1136986061 16:35106245-35106267 TTTCTTTCTTTCTTTTTTGAGGG - Intergenic
1137266195 16:46871023-46871045 TTTCTTTCTTTCTTTTTTGATGG - Intergenic
1137703427 16:50516526-50516548 TCTTTTTCTCTCCTAATTTTTGG + Intergenic
1137874333 16:51981392-51981414 TCTTTTTTTTTCCCCTTGGAGGG + Intergenic
1137890066 16:52151045-52151067 TCTTTTTCTTTTGGATTTGTAGG - Intergenic
1137910130 16:52369522-52369544 CATATTTCTTTCCTATTGGAAGG + Intergenic
1138644629 16:58415386-58415408 TTTTTTTTTTTCCAATTTAATGG + Intergenic
1138769376 16:59645572-59645594 TCTTTTTCTTTCCATATTTAGGG + Intergenic
1138871270 16:60889973-60889995 TGTTTTTCTTTTCCAATTGAGGG + Intergenic
1139067557 16:63336983-63337005 TCTTTCTCTTTCATTTTTGGGGG - Intergenic
1139219636 16:65167982-65168004 TTTTTTTTTTTACTATTTTAAGG - Intergenic
1139254858 16:65531094-65531116 CCTTTTTTTTTCGTTTTTGAGGG - Intergenic
1139605220 16:68013394-68013416 TTTTTTTTTTTCTTTTTTGACGG - Intronic
1139765819 16:69229152-69229174 TTTTTTTCATTATTATTTGATGG + Intronic
1139769766 16:69264686-69264708 TTTTTTTCTTTCTTCTTTGGAGG - Intronic
1140915891 16:79492958-79492980 TCTTTTTCTTTTTTTTTTGGAGG + Intergenic
1141029918 16:80578790-80578812 TCCTTTTCTTTTTTTTTTGAAGG + Intergenic
1141186785 16:81793288-81793310 TGGTTTTCTTTCCTTTCTGAGGG + Intronic
1141402119 16:83758028-83758050 TCTTTTTCTTTCTTTTTTTTTGG - Intronic
1142120572 16:88384600-88384622 TCTTCCTCTTTTCTATTTGCAGG - Intergenic
1142333294 16:89469909-89469931 TCCTTTTCTTTTGTTTTTGACGG + Intronic
1142571277 17:876175-876197 TTTTTTTCTTTCTTTTCTGATGG - Intronic
1142633906 17:1244664-1244686 TCTTTTTCTTATCCATTTGTAGG + Intergenic
1142793477 17:2288307-2288329 TCTTTTTCTTTTTTTTGTGATGG - Intronic
1143379177 17:6485160-6485182 TCTTTTTTTTTTTTTTTTGATGG + Intronic
1143456366 17:7070481-7070503 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1143502153 17:7345655-7345677 TCTTTTTTTTTCTTTTTTGATGG + Intronic
1143506897 17:7371522-7371544 TCTTTTTTTTTTTTTTTTGAGGG - Intergenic
1143561680 17:7700049-7700071 TCTTTTTCTTTTTTTTTTGGGGG + Intronic
1143643763 17:8216068-8216090 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1143749589 17:9018756-9018778 TCTTTTCCATTCCTCTTTGCTGG + Intergenic
1143761779 17:9109965-9109987 TCTTTTTCTTATTTATTTGTTGG + Intronic
1143771167 17:9169858-9169880 TCTTTTTCTTTTCTTTGAGACGG - Intronic
1143878290 17:10010150-10010172 TTTTTTTCTTTCTTTTTTGGGGG + Intronic
1144045308 17:11449887-11449909 TCTTTTTCTTTTCTTTGAGACGG + Intronic
1144045436 17:11450689-11450711 TTTTTTTCTTTTCTTTTGGATGG - Intronic
1144377180 17:14655885-14655907 TCTTTATCTTTTATTTTTGAAGG + Intergenic
1144700660 17:17336553-17336575 TCTTTTTTTTTTTTTTTTGACGG + Intronic
1145030313 17:19500210-19500232 AGGGTTTCTTTCCTATTTGAGGG + Intronic
1145412981 17:22690146-22690168 TCTTTTTCTTTTTTTTTTCAGGG + Intergenic
1145835818 17:27953406-27953428 TCTTTTTTTTTTTTTTTTGAGGG - Intergenic
1146092503 17:29893918-29893940 TCTTTTTCAGTCTTATTTGCAGG + Intronic
1146287363 17:31582858-31582880 TCATTTTCTTTCCTCTTTGTTGG - Intergenic
1146352410 17:32105682-32105704 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
1146406900 17:32546543-32546565 TCTTTTTAATTCCTATGTGCTGG + Intronic
1146558472 17:33847825-33847847 TCTTCTTTTTTCCTCCTTGAAGG - Intronic
1146806295 17:35867645-35867667 ATTTTTTTTTTCCTAATTGAGGG - Intronic
1146834161 17:36096433-36096455 TCTTTTTCTTTTTTTTTGGATGG + Intergenic
1147393945 17:40126800-40126822 TCTTTTTTTTTTTTTTTTGACGG - Intronic
1147642494 17:42012475-42012497 TTGTTTTCTTTTCTTTTTGACGG - Intronic
1147762922 17:42812399-42812421 TTTTTTTCTTTTCTTTTTGTGGG - Intronic
1147971573 17:44221129-44221151 TCTTTTTTTTTTCTTTTTGCAGG + Intronic
1148004910 17:44419396-44419418 TATTTTTCATTCCTCTTTGATGG - Intronic
1148076520 17:44939502-44939524 TCTTTTTCTTGGCTATTTTTAGG + Intronic
1148401248 17:47363461-47363483 TCTTTTTTTTTTTTTTTTGAGGG + Intronic
1148508199 17:48145408-48145430 TTTTTTTTTTTCCTTGTTGATGG - Intronic
1148513337 17:48192291-48192313 TTTTTTTCTTTTCTTTTTAAAGG + Intronic
1148553632 17:48564948-48564970 TCTTGTTCTTTCCTGTAAGATGG + Intronic
1149079685 17:52639758-52639780 TGTATTACTTTCCTATTTTATGG - Intergenic
1149385159 17:56135773-56135795 ACTTTTTCTTTCATTTTTAAAGG - Intronic
1149527903 17:57371485-57371507 TTTTTTTCTGTCCTTTTTCATGG + Intronic
1149648719 17:58262101-58262123 TGTTCTTCTTTCCTTTCTGAAGG + Intronic
1149966258 17:61167139-61167161 ACTTTTCCTTTCCTAATTCAAGG + Intronic
1150037089 17:61814288-61814310 TATTTTTCTTTCCTTCTTTAAGG - Intronic
1150046827 17:61921827-61921849 TCTTTTTTTTTTCTTTTTTAAGG - Exonic
1150140400 17:62723796-62723818 TCGTTTTCTTCCCTCTCTGAAGG + Intronic
1150188142 17:63208074-63208096 TCTTTTCCTTACAGATTTGAAGG + Intronic
1150430734 17:65114602-65114624 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1150528782 17:65954801-65954823 TCTTTTTTCTTCATCTTTGATGG - Intronic
1150909217 17:69370842-69370864 TTTTTTTCTTTTTTTTTTGATGG + Intergenic
1151261536 17:72919665-72919687 TCTTTTTTTTTTTTTTTTGACGG - Intronic
1151347732 17:73513253-73513275 TCTTTTTCTTACTGATTTGTGGG - Intronic
1151628286 17:75291687-75291709 TCTTTTTCTTTTCTTTGAGACGG - Intergenic
1152110522 17:78355255-78355277 CGTTTTTCTTTCCTATTTCCTGG - Intergenic
1152208085 17:78987016-78987038 TCCTGTTTTTTCCTATTGGAAGG + Intergenic
1152369315 17:79876304-79876326 TCTTTTTCTCCCCTATTTCTGGG + Intergenic
1152576881 17:81145230-81145252 TCTTTTTTTTTTTTTTTTGATGG - Intronic
1152623033 17:81375058-81375080 TCTTTTTCTTATCAATTTGTAGG - Intergenic
1152673128 17:81621088-81621110 TCCTTTTCTTTCTTTCTTGAAGG - Intronic
1152692039 17:81722739-81722761 TTTTTTTCTCTCCTTTTGGATGG + Intergenic
1152912777 17:83014755-83014777 TCGTTTTCTTACTTATTTGTAGG - Intronic
1152973188 18:185643-185665 TCTTTTTTTTAGCTTTTTGAGGG + Intronic
1152973440 18:188515-188537 TTTTTTTTTTTCCTTTGTGAGGG + Intronic
1153041160 18:813403-813425 TCTCTTTATTTCCTCTTTGGTGG + Intergenic
1153111455 18:1594362-1594384 TCTTTTTCTTTTCATGTTGAGGG + Intergenic
1153113438 18:1622684-1622706 TCCTTCTCTTTCCTGTTTGTGGG - Intergenic
1153113518 18:1624371-1624393 ATTTTTTCTTACATATTTGAAGG + Intergenic
1153174930 18:2360536-2360558 TCTTTTTTTTTCCTTTTTGGAGG - Intergenic
1153216223 18:2823496-2823518 TCTTTGTCTTTCTTTTTTCAGGG + Intergenic
1153256277 18:3174687-3174709 TCTTTCTCTTCCCTATTTCCTGG - Intronic
1153356334 18:4140765-4140787 TATTTCTCCTTCATATTTGAAGG + Intronic
1153423191 18:4931815-4931837 TTTGTTTCTTTCCTATGAGAGGG + Intergenic
1153438242 18:5089098-5089120 TCTTTCTCTTTCCTTTCTGTTGG - Intergenic
1153649838 18:7230108-7230130 TATTTTTCTTTTATTTTTGATGG - Intergenic
1153847418 18:9062575-9062597 TCTTTTTCTCTCCCATTTCATGG + Intergenic
1153916419 18:9749631-9749653 TCCTTTTCTTTTCTAATTTAAGG - Intronic
1154058386 18:11034298-11034320 TCTTTTTTTTTTCTTTTTGGCGG + Intronic
1154284917 18:13045206-13045228 TCTTTCTATTTCCTATTTTCTGG + Intronic
1155161922 18:23202980-23203002 TCTTTTTTTTTTTTTTTTGATGG - Intronic
1155219943 18:23675617-23675639 TCTTTTTTTTTCTTATTTTTTGG - Intergenic
1155303358 18:24454458-24454480 TCTTTTTTTTTCCTCTTTTTTGG + Intergenic
1155404526 18:25473314-25473336 TCTTTTCCTTTCCTAGTTTCAGG - Intergenic
1155480285 18:26279055-26279077 TCCTTTTTTTTCCTATTTGGAGG - Intronic
1155534017 18:26796659-26796681 TTTTTTTTTTTTCTTTTTGATGG - Intergenic
1155597553 18:27504790-27504812 TCTTTTTTTTTTCTAATTGAAGG - Intergenic
1156017608 18:32564442-32564464 TCATTTTCTTCCTTATTTGGGGG + Intergenic
1156025789 18:32653670-32653692 TGTTTCTCTTTCATGTTTGAAGG + Intergenic
1156124937 18:33892660-33892682 TTTTTTTCTTTCCTTTGAGATGG + Intronic
1156393634 18:36676854-36676876 TCTTTTGCTTACTGATTTGAAGG + Intronic
1156417475 18:36912414-36912436 TCTTTTTCTTCTCTATTATAAGG + Intronic
1156441557 18:37194416-37194438 TCTTTTTCTTTTTTATTTATAGG + Intronic
1156700639 18:39820439-39820461 TGCTTTTCTTTCCTCTTTGTGGG - Intergenic
1156748310 18:40419254-40419276 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
1156805470 18:41173773-41173795 TCTTTTTCTTACTTATTTTCAGG + Intergenic
1156926961 18:42593801-42593823 TTTCTTTCTTTCTTTTTTGATGG + Intergenic
1157418201 18:47523703-47523725 TTTCTTTCTTTCTTTTTTGATGG + Intergenic
1157966735 18:52216951-52216973 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1158064500 18:53389633-53389655 GTTTTTTCTTTCCCATTTTATGG - Intronic
1158230005 18:55243877-55243899 TCCTTTTCTGTTCTATTTAATGG + Intronic
1158321096 18:56265497-56265519 GCCTTTTCTTTCCTTTTTGCAGG + Intergenic
1158369164 18:56778836-56778858 TTTTTTTCTTTCCAAATTGGGGG + Intronic
1158432880 18:57406335-57406357 TCTTTTGCCTTCACATTTGAAGG + Intergenic
1158504947 18:58039203-58039225 TCTCTTTCTTTCTTTTTTCAGGG + Intergenic
1158656011 18:59335115-59335137 TCCCTTTCTTTCTTATGTGACGG - Intronic
1158825275 18:61211527-61211549 TATTTTTGTTCCCTATTTTAGGG - Intergenic
1159015838 18:63101216-63101238 TCTTTTTCTTGGCCATTTGAGGG - Intergenic
1159336509 18:67074944-67074966 ACTTTTTTTTTTCTTTTTGATGG + Intergenic
1159522709 18:69546781-69546803 TATTTATCATTCCTATTTGTTGG + Intronic
1159975618 18:74708252-74708274 TCATTATATTTCCTATTTGTTGG - Intronic
1160076514 18:75682430-75682452 TCTCATTCTTTCTTATATGAAGG + Intergenic
1160133364 18:76249644-76249666 TCTGTTTCTTTCCTAATGCAAGG + Intergenic
1160138293 18:76294704-76294726 TATTTCTCCTTCCTGTTTGAAGG + Intergenic
1160185258 18:76671588-76671610 TCTTTGTTTTTACTATTTTAAGG + Intergenic
1160400449 18:78607147-78607169 TCCTTTTTCTTCATATTTGAGGG + Intergenic
1160655447 19:265152-265174 TCTTCCTCTTCCTTATTTGAAGG + Intergenic
1161063739 19:2227715-2227737 CGTTTTTCTCTCCTATTTGCAGG + Intronic
1161123639 19:2544015-2544037 TATTTTTCTTTCCTTTTTCGAGG - Intronic
1161396067 19:4045559-4045581 TCTTTTTCTTTCATTGTTAAAGG - Exonic
1161536299 19:4820877-4820899 TCTTTTTGTTTGTTTTTTGATGG - Intronic
1161643509 19:5438175-5438197 TCTTTTTTTTTCTTTTTAGACGG + Intergenic
1161893833 19:7064910-7064932 TTTTTTTTTTTCCTACTTGCTGG + Intergenic
1161893879 19:7065269-7065291 TCTTTTTCTTTTCTTTTTTATGG - Intergenic
1162302798 19:9853743-9853765 ACTTTTTCTTTCCGGTTTGCCGG - Exonic
1162551098 19:11358717-11358739 TCTCTTTCTTTCTTTTGTGATGG + Intronic
1163210707 19:15837675-15837697 TCTTCCTCTTCCTTATTTGAAGG - Intergenic
1163274226 19:16272952-16272974 TCTTTTTTCTTCTTGTTTGAAGG - Intergenic
1163541018 19:17910265-17910287 TTTTTTTTTTTCATGTTTGAGGG - Intergenic
1163816541 19:19468716-19468738 TTTTTTGCTTTCATTTTTGAAGG - Intronic
1163998159 19:21071824-21071846 TCTTTTTATTTTACATTTGAGGG - Intergenic
1164077105 19:21829217-21829239 TGTTTTTTTTTCCTTTGTGATGG - Intronic
1164133725 19:22390574-22390596 TCTTTTTCTTTTTTTTTAGATGG - Intergenic
1164260032 19:23561277-23561299 TCTTTTTCTTTTCTGTTTTTTGG - Intronic
1164724864 19:30459353-30459375 TCTTTTTTTTTTTTTTTTGATGG + Intronic
1164758380 19:30708004-30708026 TCTTTTTTTTTTTTTTTTGATGG - Intronic
1164887146 19:31788923-31788945 TATTTTTCTTTCCATTTTGAGGG - Intergenic
1165378877 19:35463749-35463771 TCTTTTTTTTTTCTTTTAGATGG + Intergenic
1165464671 19:35966598-35966620 TCTTTTTCTTTTTTATTTTGAGG - Intergenic
1165582402 19:36878758-36878780 TTTTTTTATTGACTATTTGATGG + Exonic
1165588828 19:36947370-36947392 TCTTTTTATCTCCTATGTGTAGG + Intronic
1165957488 19:39510521-39510543 TCTCTTTCTTCACAATTTGATGG + Intergenic
1166031625 19:40135207-40135229 TTTTTTTTTTTCCTATATCAGGG - Intergenic
1166514077 19:43432467-43432489 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1166630718 19:44404645-44404667 GCTATTTCATTCCTGTTTGAGGG - Intergenic
1167086732 19:47315046-47315068 TCTGTTTTTTTCCTTTTTGTAGG + Intronic
1167235902 19:48314942-48314964 TCTTTTTCTTTTCTTTTTTGAGG - Intronic
1167417067 19:49380060-49380082 TCTTTTTCTTTTTGATTTGTAGG + Intergenic
1168136205 19:54353735-54353757 TCTTTTCTTTTCTTTTTTGACGG + Exonic
1168167856 19:54565277-54565299 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
1168380525 19:55917345-55917367 TCTTTTTCTTTGTGATTTGATGG - Intronic
1168432026 19:56288867-56288889 TCTTCTTCTGTCCTATCTGGAGG - Intronic
1168442978 19:56387592-56387614 TCTTTCTCTTTCTTTTTTGCAGG + Intronic
1168449228 19:56450377-56450399 TATTTCTCCTTCCTGTTTGAAGG - Intronic
1168602920 19:57733784-57733806 TATTTCTCTTTCATGTTTGAAGG - Intronic
925144153 2:1569816-1569838 TTTTTTTTTTTTTTATTTGACGG - Intergenic
925387520 2:3472435-3472457 TCTCTTCTTTTTCTATTTGAAGG - Intronic
925481048 2:4274689-4274711 TCCTATTCTCTCCTAGTTGAAGG - Intergenic
925836256 2:7950126-7950148 TCTTTTTTTTTTCTACTTAATGG + Intergenic
925881146 2:8353563-8353585 TTTTTTTCTTTCTTTTTTAATGG - Intergenic
925974023 2:9128243-9128265 TTTTTTTCTTTTTTTTTTGATGG - Intergenic
926390288 2:12383385-12383407 TCTTTTTCTTTTTTCTTTGTTGG + Intergenic
926411424 2:12606753-12606775 TCCTTTTCCTTCCTGTTTGGGGG + Intergenic
926546706 2:14250632-14250654 TCTTTTTCTTTTGTTTTTGATGG + Intergenic
926575412 2:14575247-14575269 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
926645972 2:15289989-15290011 TTCTTTTCTTTTCTTTTTGATGG - Intronic
926653766 2:15375848-15375870 TCTATTTTATTCCTTTTTGATGG - Intronic
926750080 2:16191730-16191752 TTTTTTTCTGAACTATTTGAAGG + Intergenic
926958571 2:18329611-18329633 TCTTTTTTTTTCATTTTTGTTGG + Intronic
926987643 2:18640993-18641015 TTTTTTTCTTTCCATGTTGATGG + Intergenic
927070781 2:19527158-19527180 TATTTTCCTTTCCTATCTGGAGG + Intergenic
927176646 2:20414403-20414425 TTTTTTTTTTTTGTATTTGATGG + Intergenic
927262605 2:21107929-21107951 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
927275936 2:21262561-21262583 TCTTTTTCTTTCCTTTCTCCTGG + Intergenic
927299449 2:21494609-21494631 TCTTTTTCTTACAGATTTGTAGG + Intergenic
927337597 2:21943089-21943111 TATTTTTCATTCAGATTTGAGGG - Intergenic
927345217 2:22030386-22030408 TCTCTTTCTTTTGTCTTTGAGGG - Intergenic
927385669 2:22531158-22531180 TCTATTGCTTCACTATTTGAAGG - Intergenic
927411197 2:22828252-22828274 TTTTTTTTTTTCTTTTTTGATGG - Intergenic
927458249 2:23275828-23275850 TCTTTTTTTTTTCTTTTTGTTGG - Intergenic
927804135 2:26130477-26130499 TCTTTTTTTTTTTTAATTGATGG + Intronic
928288045 2:30010402-30010424 TCTTCTTTATTCCTATTTTATGG - Intergenic
928372522 2:30751137-30751159 TCTTCTGCTTTCAAATTTGATGG + Exonic
928571202 2:32610771-32610793 TTCTTTTCTTTTCTTTTTGATGG + Intronic
928614328 2:33021322-33021344 TGTTTTTCTTTCCTTTCTTAAGG + Intronic
928692246 2:33812022-33812044 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
928808114 2:35186777-35186799 TTTTTTTTTTTTCCATTTGAAGG + Intergenic
928823689 2:35392644-35392666 TCTTTTTTTTTTCTTTTTGGAGG + Intergenic
928994779 2:37276515-37276537 TCTTTTTCTTATCAATTTGTTGG + Intronic
929051484 2:37840553-37840575 TCTCTTTCTTTCTTATGGGATGG + Intergenic
929137339 2:38637534-38637556 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
929137428 2:38637966-38637988 TTCTTTTCTTTCCTTTTTGACGG - Intergenic
929138511 2:38647228-38647250 TCTTTTTCTTTCTTTTTGCATGG - Intergenic
929611610 2:43274997-43275019 TCTTTTTTTTTTTTTTTTGAGGG + Intronic
929757752 2:44781456-44781478 TTTTTTTTTTTCCAAATTGAAGG + Intergenic
929880914 2:45836744-45836766 TCTTTTTCTTTTTTACTTGGAGG - Intronic
929963548 2:46515040-46515062 TAGTTTTCTTTCCTTTTTGTAGG - Intronic
930173544 2:48276898-48276920 TGTTTGTCTTTTATATTTGAAGG + Intergenic
930315258 2:49789387-49789409 TGTTTTTTTTTCGAATTTGAAGG - Intergenic
930322423 2:49873263-49873285 TCTTTTTTTTTCTTTTTTAACGG + Intergenic
930570455 2:53079361-53079383 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
930580260 2:53202625-53202647 TCTTTTTTTTTTCCTTTTGAAGG + Intergenic
930868467 2:56145828-56145850 TCTTTTTCTTTCCGTTTTTGAGG + Intergenic
930895215 2:56438432-56438454 TATTTCTCCTTCATATTTGAAGG + Intergenic
930906068 2:56569479-56569501 TCTTTCTTTTTCATATTTTAAGG + Intergenic
931000231 2:57771673-57771695 TCTTTTTCTTTTCTTTTTCTTGG + Intergenic
931128782 2:59307943-59307965 TTTTTTTGTTTCATATTTGAAGG + Intergenic
931155922 2:59630016-59630038 TCTTTTTTTTTCTCATTTAATGG - Intergenic
931469437 2:62523615-62523637 TCTTATTCTTTTTTCTTTGAAGG + Intergenic
931488997 2:62724651-62724673 TTTTCTTTTATCCTATTTGATGG + Intronic
931548834 2:63419600-63419622 TATTTTTCTTCCATCTTTGATGG - Intronic
931561718 2:63568778-63568800 TGTTTCTCTTCCTTATTTGAAGG - Intronic
931590031 2:63872786-63872808 TCTTTTTTTTTTTTTTTTGAGGG - Intronic
931600598 2:63999326-63999348 TATTTCTCTTTCATGTTTGAAGG + Intronic
931984393 2:67727621-67727643 TTCTTTTCTTTTCTTTTTGAGGG + Intergenic
932242221 2:70166349-70166371 TCTTTTTTTTTCCTTTTTGAGGG - Intronic
932385077 2:71324722-71324744 TCTTTTTCTTTTTTTTTTTAAGG + Intronic
932541006 2:72652179-72652201 TTTTTTTTTTTCTTATTTGTGGG - Intronic
932549946 2:72758297-72758319 TCTTTCCCCTTCCCATTTGAGGG - Intronic
932799591 2:74728962-74728984 TATTTCTCTTTCATATTGGAAGG + Intergenic
932813530 2:74843804-74843826 TTTCCTTCTTTCCCATTTGAGGG + Intronic
932931758 2:76049426-76049448 TATCTCTCTTTCATATTTGAAGG + Intergenic
932946466 2:76238224-76238246 TATTTGTCTTTGCTCTTTGATGG + Intergenic
933060533 2:77731575-77731597 TCTTTTCCTTTCTTTTTTTATGG - Intergenic
933124034 2:78581300-78581322 TCTTTTTCTTTTTTTTTTTAGGG - Intergenic
933292179 2:80450307-80450329 TTTTTTTTTTTCCTTTTTAAAGG + Intronic
933292731 2:80455439-80455461 TCTTTTTGTTTCTTTTTTGTGGG + Intronic
933348783 2:81126500-81126522 TATTTCTCTTTCATATTTGAAGG + Intergenic
933397172 2:81748030-81748052 TTTTTTTTTTTCCTGTATGAAGG + Intergenic
933489544 2:82967877-82967899 TTTTTTTGTTTCTTTTTTGATGG - Intergenic
933617956 2:84503624-84503646 TATTTCTCTTTCGTGTTTGATGG + Intergenic
933640511 2:84754181-84754203 TTCTTTTCTTTTCTTTTTGACGG + Intronic
933717743 2:85373927-85373949 TTTTTTTTTTTTCTATTTCAAGG + Intronic
933718251 2:85378033-85378055 TATTCTTCTTCCTTATTTGAAGG - Intronic
934071249 2:88385648-88385670 TGTTTTTCTCTCTTATTTTAAGG - Intergenic
934148917 2:89126259-89126281 TTTTTTTCTTTCCTTTTCAAAGG + Intergenic
934218379 2:90055787-90055809 TCTTTTTCTTTCCTTTTCAAAGG - Intergenic
934497782 2:94824455-94824477 TCCTTTTCTTTCCTTTTTTTGGG + Intergenic
934534016 2:95117945-95117967 TTTTTTTTTTTCCAATTTGCAGG - Exonic
934728951 2:96644170-96644192 TCTTTTTTTTTTTTTTTTGAAGG - Intergenic
934790704 2:97057609-97057631 TGTCTTTCTTTCAGATTTGAGGG + Intergenic
934815753 2:97324920-97324942 TGTCTTTCTTTCAGATTTGAGGG - Intergenic
934821942 2:97383563-97383585 TGTCTTTCTTTCAGATTTGAGGG + Intergenic
934863416 2:97783682-97783704 TCTTTTTCCTGCCTTTTTGTGGG - Intronic
934870795 2:97863179-97863201 TATTCCTCTTTCATATTTGAAGG - Intronic
935427805 2:102939294-102939316 TCTTTTTGTTTCCCCTTTAATGG - Intergenic
935449376 2:103190960-103190982 TTTTCTTTTATCCTATTTGATGG - Intergenic
935485350 2:103646526-103646548 TCTCTTTCTTTCCTCTTTTTGGG - Intergenic
935870254 2:107440307-107440329 ACTTTATCTTTCCTTTTTGTGGG - Intergenic
936171067 2:110175303-110175325 TCTTCTTCAATCCTTTTTGAAGG + Intronic
936283638 2:111163873-111163895 TTTTTTTTTTTCCTATTTTAAGG + Intronic
936452334 2:112643106-112643128 TCTTGTTCTGTCCTCTCTGAGGG + Intergenic
936495193 2:113014468-113014490 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
936580074 2:113692052-113692074 TCTTTTTTTTACCTAATTCAAGG - Intergenic
936620722 2:114094323-114094345 TGTTCTTCTCTCCAATTTGAGGG + Intergenic
936640613 2:114308140-114308162 TCTATTTTTTTCCAATTTGTTGG + Intergenic
936688667 2:114859362-114859384 TCTTTTTTTTTTTTTTTTGACGG - Intronic
936702692 2:115032878-115032900 TCTTTTTTTTTTTTTTTTGACGG - Intronic
936714610 2:115171354-115171376 TCTTTTTTTTTTTTTTTTGATGG - Intronic
936822790 2:116543015-116543037 TATTTTTCTTTTCTACTTCATGG + Intergenic
936829060 2:116618752-116618774 TTTTTTTCTTTCTTATTTTTTGG - Intergenic
936832028 2:116658078-116658100 TATTTTTCTTTTATGTTTGAAGG - Intergenic
936868762 2:117108690-117108712 TTTTCTTTTATCCTATTTGATGG + Intergenic
936876030 2:117190673-117190695 TCTTTTTCTTTTCTTTTTTTTGG + Intergenic
936893474 2:117399619-117399641 TATTTCTCCTTCCCATTTGAAGG - Intergenic
937429638 2:121827322-121827344 TCTTATTCTTTTCTCTTGGAAGG + Intergenic
937631260 2:124104183-124104205 TATTTTTCTTTCATTTTTGAAGG + Intronic
937768919 2:125695951-125695973 TCTTTTTCTTTTCTTTTTCTTGG + Intergenic
937836501 2:126475942-126475964 TTTTTTTCTCTGCTATATGAGGG + Intergenic
937848459 2:126608659-126608681 TATTTGTCTTTTCTATTTGAAGG - Intergenic
938102713 2:128508028-128508050 TCTTTTTCTTTTTGATTTGTGGG + Intergenic
938147201 2:128846109-128846131 TTTCTTCCTTTCCAATTTGAAGG + Intergenic
938268402 2:129946925-129946947 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
938524934 2:132120426-132120448 TCTTTTTTTTTTTTAATTGACGG + Intergenic
938542947 2:132301034-132301056 GCTATTTCCTTCCTCTTTGAGGG + Intergenic
938744099 2:134260701-134260723 TCTTTTTTTTTTTTTTTTGAGGG + Intronic
938749968 2:134318896-134318918 TGTTTTTCTTTTCTCCTTGAGGG + Intronic
938838192 2:135129743-135129765 TTTTTTTCTTTCCTTCTAGATGG + Intronic
939284537 2:140111879-140111901 TTTTTTTTTTTCTTTTTTGACGG - Intergenic
939335935 2:140828024-140828046 TATTTCTCTTTCATGTTTGAAGG - Intronic
939454293 2:142413876-142413898 TTTGTTTCTTTCTTATTTCAGGG + Intergenic
939679067 2:145108268-145108290 ACTTTTTTTTTCCTTTTTGGAGG - Intergenic
939887338 2:147695224-147695246 TTTTTTTTTTTCCTCTTTAAAGG + Intergenic
939902185 2:147864187-147864209 ACTTTGTTTTTCCTAATTGAAGG + Intronic
940248716 2:151649072-151649094 TCTTTTTATCTCCTGTTTCATGG + Intronic
940597408 2:155812815-155812837 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
940746664 2:157575130-157575152 TCTTTTTTTTTTTTTTTTGACGG + Intronic
940864285 2:158801888-158801910 TCTTTTTCTTACCGATTTATAGG - Intronic
941170784 2:162133031-162133053 TCTTTTTTTTTGTTATTAGAGGG + Intergenic
941233970 2:162945993-162946015 TATTTTTCCTTCATGTTTGAAGG - Intergenic
941467893 2:165852385-165852407 TCTTTCTCTTCCTTATTTGTGGG + Intergenic
941467907 2:165852562-165852584 TATTTTTCTTTCATTTATGAAGG + Intergenic
941555497 2:166975481-166975503 TCTTTTCTTTTCTTTTTTGAAGG - Intronic
941851594 2:170189080-170189102 TATTTTTCCTTCCTGTTTGAAGG + Intronic
941901805 2:170686242-170686264 TCTTTTTCTTTTCTTTCTCAGGG - Intergenic
941947583 2:171116693-171116715 TCTTTTTTTTTTTTTTTTGAGGG - Intronic
941948757 2:171130679-171130701 TATTTTTGTTCCTTATTTGAAGG - Intronic
942239690 2:173949355-173949377 TTTTTTTTTTTCCTTTTTGAGGG - Intronic
942258462 2:174131762-174131784 TCTTTTTCTTATTTATTTGTAGG + Intronic
942313759 2:174680624-174680646 TCATTGTCTTTGCTATTTCAAGG - Intronic
942526025 2:176853796-176853818 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
942547403 2:177079352-177079374 TATTTTTTATTCCTATTGGATGG + Intergenic
942610348 2:177736505-177736527 TCTTTTTTTTTTCTTTTAGATGG - Intronic
942633981 2:177981825-177981847 TCTGTTTCTTTTCTTTTTAAAGG + Intronic
942820362 2:180106586-180106608 TTCTTTTCATTCCTACTTGAAGG + Intergenic
943117300 2:183690014-183690036 TATTTTTCCTTCATGTTTGAAGG + Intergenic
943255115 2:185584877-185584899 TATTTCTCTTTCATGTTTGAAGG - Intergenic
943309901 2:186312537-186312559 TTTTTTTCCTTCATGTTTGAAGG - Intergenic
943349062 2:186776010-186776032 TCTTTTTCTTTGATTTTTGGAGG - Intergenic
943738719 2:191387624-191387646 TTTTTTACTTTCTTATTTTAGGG - Intronic
943797821 2:192019635-192019657 TCTTTTTTTTTTCTTTTTCAGGG + Intronic
943803520 2:192092271-192092293 TCATTTATTTTCCTATGTGAAGG + Intronic
943877235 2:193084732-193084754 TCTGTTACTTTCCTATCTAATGG + Intergenic
943923496 2:193740280-193740302 TATTTCTCTTTCATATCTGAGGG - Intergenic
943926252 2:193784634-193784656 TCTTTTTTTTTCCTATTTTTTGG - Intergenic
944171548 2:196784587-196784609 TCTTTTTCATTCCTTTTTTTAGG - Intronic
944228035 2:197367585-197367607 TCTTTTTCTTTCTTTTTATAGGG - Intergenic
944490169 2:200250485-200250507 TCCTTTTCTTGCCTAGCTGAAGG + Intergenic
944706248 2:202291893-202291915 TTTTTTTCTTTCAGATTTGAAGG + Intronic
944856074 2:203768394-203768416 TCTTTTTCTTTTCTATTTTAAGG + Intergenic
945156154 2:206840503-206840525 TCTTTTTCTTATTCATTTGAGGG + Intergenic
945214497 2:207419208-207419230 TCTTTTTAGTTCCTATGAGAAGG + Intergenic
945387955 2:209226190-209226212 TCTTTTTCTTTTTTTTGTGATGG - Intergenic
945429300 2:209746137-209746159 TCTTTTTCTTTTTTTTTTAATGG + Intergenic
945501788 2:210584762-210584784 TATTTTTCTTTCCATTTTGATGG + Intronic
945546213 2:211155323-211155345 TCTTTTTCTTTCATAATTTTTGG + Intergenic
945881791 2:215331869-215331891 GTTTTTTCTTTCTTCTTTGATGG - Intronic
945945969 2:215995872-215995894 TTTTTTTTTTTCCTGTTTAAAGG - Intronic
946076644 2:217079126-217079148 ACTTTTTCTTCCCTTTTGGAGGG - Intergenic
946549210 2:220782316-220782338 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
947046214 2:225989663-225989685 TCTTTTTTTTTCTTTTTTGACGG - Intergenic
947289842 2:228560746-228560768 TCTTTATCTAGCCTTTTTGATGG - Intergenic
947418003 2:229918339-229918361 TTTTTTTGTTTGCTATTTGATGG - Intronic
947430430 2:230023360-230023382 TCTTTTTCTTCCACCTTTGAAGG + Intergenic
947546442 2:231013853-231013875 TCTTTTTTTTTTTTTTTTGAGGG + Exonic
947772161 2:232679056-232679078 TTTTTTTCTTTCCTGTCAGAAGG - Intronic
947892859 2:233641736-233641758 TATTTCTCCTTCCTGTTTGAAGG + Intronic
948086122 2:235250036-235250058 TCTTATTTTTGCTTATTTGAAGG + Intergenic
1168899795 20:1353592-1353614 TATTTTTCCTTCATGTTTGAAGG + Intronic
1168907079 20:1414314-1414336 TCTTTTTCTTCCCTTGTTGCAGG - Intergenic
1168917025 20:1498296-1498318 TATTTCTCCTTCATATTTGAAGG + Intergenic
1169584560 20:7066688-7066710 TTTTTTTTTTTCCATTTTGATGG + Intergenic
1169819623 20:9695229-9695251 CCTTTTTCTTACTCATTTGATGG + Intronic
1169864353 20:10183920-10183942 TCTTATAGTTTCCTATTTGTAGG - Intergenic
1169938292 20:10909137-10909159 TTTTTTCCTTTCCTACTAGATGG + Intergenic
1169949577 20:11028734-11028756 CTTTTTTCTTTTCTTTTTGATGG + Intronic
1170065481 20:12305546-12305568 TCTTTTTCTTTCTTCTTTTGTGG - Intergenic
1170193702 20:13669271-13669293 TCTTTTTCTTTCTTTTTTTTGGG + Intergenic
1170215988 20:13891734-13891756 TATTCTTCTTTCATTTTTGAAGG - Intronic
1170251201 20:14285094-14285116 TTTTTTTCTTTCCTTTCTGAGGG - Intronic
1170463071 20:16597106-16597128 TCTTTTTTTTTTTTTTTTGAGGG - Intergenic
1171061264 20:21963293-21963315 TTTATTTCTTTCATTTTTGAAGG + Intergenic
1171085661 20:22236105-22236127 TCTTTTTCTTTCCACATTGGAGG - Intergenic
1171156836 20:22882245-22882267 TCTTTTCCTTTCTTTTTGGAAGG - Intergenic
1171176958 20:23058838-23058860 TTCTTTTCTTTCCTTTTGGAAGG + Intergenic
1171443862 20:25189368-25189390 TCTATTTCTTGAATATTTGATGG - Intergenic
1171824515 20:29882020-29882042 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1171871826 20:30533863-30533885 GCTATTTCCTTCCTCTTTGATGG + Intergenic
1172389311 20:34555845-34555867 TCTTTTTTTTTTTTTTTTGATGG + Intronic
1172545668 20:35759417-35759439 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1172697890 20:36834991-36835013 TCTTTTTCTTTTTTTTTTTAAGG - Intronic
1172875357 20:38160831-38160853 TCTTTTTCTTTTTTCTTTTAAGG + Intronic
1172922790 20:38500244-38500266 TTTTTTTTTTTCCAAATTGAAGG + Intronic
1172927660 20:38553423-38553445 CCCCTTTCTTGCCTATTTGAAGG + Intronic
1172954384 20:38745474-38745496 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1173195971 20:40913134-40913156 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1173204003 20:40978084-40978106 TATTTCTCTTTCATGTTTGAAGG + Intergenic
1173230763 20:41194942-41194964 TCTCTTTCATTCTTATTTAAAGG + Intronic
1173425483 20:42939453-42939475 CCTTTTCCTTTCCTTCTTGAGGG + Intronic
1173483282 20:43420397-43420419 TATTTTTCCTTCATTTTTGAAGG - Intergenic
1173766995 20:45620812-45620834 TCTTTTTAATTCATATTTGGTGG + Intronic
1173917725 20:46721426-46721448 TTTTTTTTTTTGCTAATTGAGGG - Intronic
1174213647 20:48899499-48899521 TCTTTTTCTTTCTTTTTTTTTGG + Intergenic
1174632473 20:51969736-51969758 TCTTTTTCTTTTTTTTTTGCGGG - Intergenic
1174786444 20:53437466-53437488 TTCTTTTCTTTCCTTTTAGATGG - Intronic
1174874667 20:54214070-54214092 TTTTTTTCTTTCCTTTTAAAAGG + Intronic
1174948585 20:55017117-55017139 TTTTTTTCTTTTTTCTTTGAAGG + Intergenic
1174981904 20:55406136-55406158 TTTTTTTTTTTCATATTTGTAGG + Intergenic
1175015059 20:55781259-55781281 TCTTTTTTTTTTTTAATTGAGGG + Intergenic
1175099743 20:56570581-56570603 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1175225158 20:57440292-57440314 TCTTTGTCCCTCTTATTTGAAGG + Intergenic
1175669219 20:60887488-60887510 CCTTTTTCTTGCCTGTTTGCTGG - Intergenic
1176007084 20:62871518-62871540 TCTTTTTTTTTCTTTTTAGATGG + Intergenic
1176889847 21:14302064-14302086 TCTTTGGCTTTTCTATTTAATGG - Intergenic
1177044614 21:16153598-16153620 TCTTTTTATTTTCTATTTTAAGG + Intergenic
1177137740 21:17324223-17324245 TCTTTTTTTTTCCTCTAAGAGGG - Intergenic
1177245810 21:18521500-18521522 TCCTTTTCTTTCATATTTAGAGG + Intergenic
1177283817 21:19021527-19021549 TCTTTTCTTTTCTTTTTTGACGG + Intergenic
1177309455 21:19370704-19370726 TCTTTTTCTTTTTGATCTGAAGG + Intergenic
1177336178 21:19731721-19731743 TCTTTTTTTTTCCTATGAAACGG + Intergenic
1177492116 21:21840102-21840124 TCTTTTTGTCTTCAATTTGAAGG + Intergenic
1177671400 21:24234830-24234852 TATTTCTCTTTCATTTTTGAAGG + Intergenic
1177761398 21:25406429-25406451 TATTTCTCTTTCATGTTTGAAGG + Intergenic
1177961753 21:27675653-27675675 TCTTTTTCTTACTAATTTGTGGG + Intergenic
1178023507 21:28436989-28437011 TCTCTCTCCTTCCTCTTTGATGG - Intergenic
1178177804 21:30124554-30124576 TCTTTTTCTTTTTTTTTTGATGG - Intergenic
1178200758 21:30402158-30402180 TTTTTTTCCTTCATTTTTGAAGG - Intronic
1178227475 21:30739736-30739758 TCTTTTTCTTACTGATTTGTAGG - Intergenic
1178238348 21:30870080-30870102 TTTTTTTATTTCTTATTTGATGG - Intergenic
1178498334 21:33105419-33105441 TATTTTTTTTTCCGATTTTAAGG - Intergenic
1178762414 21:35415987-35416009 TGTTTTTCTGAACTATTTGAGGG - Intronic
1178793919 21:35725494-35725516 TAATATTCTTTCCTCTTTGAAGG + Intronic
1178885996 21:36485210-36485232 TGTTTTTCTTTTTTTTTTGATGG + Intronic
1178989369 21:37339808-37339830 CCTTTTTAGCTCCTATTTGAGGG - Intergenic
1179111861 21:38453878-38453900 TCTTTTTTTTTTTTTTTTGATGG - Intronic
1179139512 21:38712367-38712389 TCTTTCTCTTTCCTGCTGGATGG - Intergenic
1179279267 21:39920582-39920604 TCTGTTTGTTTCCCAGTTGATGG - Intronic
1179364667 21:40746551-40746573 TGTTTTCCTTACATATTTGAGGG - Intronic
1179649371 21:42797012-42797034 TTTTTTTTTTTCCTTTGTGATGG + Intergenic
1179977489 21:44877123-44877145 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1180577133 22:16787741-16787763 TCTTTGTCTTTGATATTTGTTGG - Intronic
1180578427 22:16804165-16804187 GCTTTTTTTTTCTTAATTGATGG - Intronic
1180668062 22:17530676-17530698 TTTTTTTTTTTCTTTTTTGAGGG - Intronic
1181190989 22:21139501-21139523 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1181208212 22:21270997-21271019 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1181717135 22:24739598-24739620 TCTTTGTCCTTCATGTTTGAAGG - Intronic
1181838486 22:25631528-25631550 TATTTTTCTTTCTTCTTTCATGG + Intronic
1181931795 22:26407750-26407772 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1182804624 22:33059160-33059182 TCTTTTTCTTTTCTTTTTTTTGG - Intergenic
1182834542 22:33331409-33331431 TCTTTTTTTTTTTTTTTTGACGG + Intronic
1182863560 22:33582393-33582415 TTTTTTTTTTTCCTCTTTCAAGG - Intronic
1182888937 22:33799962-33799984 TCTTCTTCTTCCCTATTTCCTGG - Intronic
1182967135 22:34532795-34532817 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1183201853 22:36390586-36390608 TCTTTTTCTTTTCTTTTTTGAGG - Intergenic
1183331205 22:37222611-37222633 GCTTTCTCTTTCCTATATGAGGG + Intergenic
1183523789 22:38311807-38311829 TCTTTTTTTTTTTTTTTTGATGG + Intronic
1183908507 22:41061220-41061242 TCTTTTTCTTTCTTTTTTTTGGG + Intergenic
1184201042 22:42969901-42969923 TCTTTTTCTTTTTTTTTTTAAGG - Intronic
1184633746 22:45808210-45808232 CTTTTTTCTTTCCTTTTTGGGGG - Intronic
1203272113 22_KI270734v1_random:62421-62443 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
949428639 3:3947770-3947792 TCTTTCTCCTTCATGTTTGAAGG + Intronic
949685912 3:6570538-6570560 TTTTTTTTTTTCCTTTTTGATGG + Intergenic
949760185 3:7462064-7462086 CCTTTTTCTTCTTTATTTGATGG + Intronic
949786720 3:7749689-7749711 TCTTTATCTTCCCGATTTGTAGG - Intergenic
950223181 3:11212245-11212267 TCTTTTTCCTTCTCATTTGAAGG - Intronic
950271537 3:11620011-11620033 TCTTTTTCTCTGCTCTTTGCAGG - Intronic
950286559 3:11749900-11749922 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
950336844 3:12201472-12201494 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
950565988 3:13770015-13770037 CATTTTCCTTTCCTATTTCAGGG + Intergenic
950602580 3:14047540-14047562 TTTTTTTGTTTCTTCTTTGAAGG + Intronic
950674034 3:14544027-14544049 TCTGTTTCTGGCCTATTTGACGG - Intergenic
950784155 3:15419271-15419293 TCATTTTCTTTCTTATTTTCAGG - Intronic
950815399 3:15696488-15696510 GCTTTTTTTTTCATATGTGAAGG + Intronic
950970107 3:17177941-17177963 TCATGTTCTCTCTTATTTGAGGG - Intronic
950973836 3:17218639-17218661 AATTTCTCTTTCCTTTTTGAAGG + Intronic
951164150 3:19464664-19464686 TCTTTTTCTTACTTATTTTTAGG - Intronic
951166349 3:19488270-19488292 TCCTTTTCTTTCCCTTTTGGGGG + Intronic
951438895 3:22698927-22698949 TATTTTTCTTTCATTTTTAAAGG - Intergenic
951621362 3:24605047-24605069 TTTTTTTTTTTCTTTTTTGATGG - Intergenic
951694543 3:25432092-25432114 TCTTTTTCTCTTCTTTCTGATGG - Intronic
952137530 3:30439964-30439986 TCTTTTTATTTTCTTTTTGACGG - Intergenic
952238995 3:31510380-31510402 TCTTTGTCTTTACTTTTTGAGGG - Intergenic
952618616 3:35307452-35307474 TCTTTTCCTTTCATATTTGAAGG - Intergenic
952793200 3:37216778-37216800 TTTTTTTCTTTCCTAGTTAGAGG + Intergenic
952920351 3:38279588-38279610 ACTTTTTCTTTCCTTTTTGGGGG + Intergenic
953163086 3:40440298-40440320 GTTTTTTCTTTCCTTTCTGAGGG - Intergenic
953197634 3:40749495-40749517 TCTCTTTCTTTCCTATTTTTGGG + Intergenic
953280487 3:41549750-41549772 TCTTTTTCTTTGACTTTTGACGG - Intronic
953691884 3:45126627-45126649 TCTAGTTCTTTCTTATGTGAAGG - Intronic
954822675 3:53344599-53344621 TCTTTTTCTTTCTAATATGGGGG + Intronic
954908269 3:54081671-54081693 TTTTTTTTTTTGCTATCTGAAGG + Intergenic
955003031 3:54944881-54944903 TGTTTTTCTTTCTTTTTTCAAGG + Intronic
955036541 3:55273603-55273625 GGTTTTTCTTTCCTTTTAGATGG - Intergenic
955114528 3:55984280-55984302 GTTTTTTTTTTCCTATTTCATGG - Intronic
955456913 3:59132254-59132276 TATTTTTCTTTCAGATTTTATGG + Intergenic
955553880 3:60114460-60114482 TCTTGTTCTTCCTTATTTTAAGG - Intronic
955968937 3:64417741-64417763 TTGTCTTCTTTCATATTTGAGGG + Intronic
956078774 3:65535003-65535025 TCTTCTTCCTTCCTAATTGCTGG - Intronic
956212898 3:66820246-66820268 TTTTTTTTTTTTCTTTTTGAGGG + Intergenic
956248306 3:67209051-67209073 TGTTTTTTTTTCCTATTCGGAGG + Intergenic
956256218 3:67285776-67285798 TCTTTTTTTTTTTTTTTTGAAGG - Intergenic
956258826 3:67314457-67314479 TCATTTTCTTTCCTACTTCCAGG + Intergenic
956368766 3:68535374-68535396 TTTTTTTTTTTTCTTTTTGATGG - Intronic
956476325 3:69623660-69623682 TATTTTTCCTTCATGTTTGAAGG - Intergenic
956496425 3:69831358-69831380 CCTTTTTCTTTCCTCTTCCATGG + Intronic
956649008 3:71485767-71485789 TCTTTTTTTTTTTTTTTTGATGG - Intronic
956949986 3:74271619-74271641 TCTTTTTCTTGGCCATCTGATGG + Intronic
957187084 3:76955884-76955906 TCTTTTTTTTTTTTTTTTGACGG - Intronic
957202372 3:77153302-77153324 TTTTCTTGTTTCATATTTGATGG + Intronic
957340102 3:78884534-78884556 TTTCTTTCTTTCTTTTTTGAGGG - Intronic
957622336 3:82610178-82610200 TCTTTTTTTTTCTTATTTCTGGG - Intergenic
957702242 3:83729379-83729401 TCTTTTTCTTTCCTTTTTTAGGG + Intergenic
957907442 3:86576546-86576568 TATTTATCCTTCATATTTGAAGG + Intergenic
957921336 3:86752111-86752133 TCTATTTATATCCTTTTTGATGG + Intergenic
957956750 3:87197183-87197205 TCTTTTTCTTTCCCAGTGCATGG - Intergenic
957987759 3:87593498-87593520 TGTTCTTCTTTTCTATTTGGGGG - Intergenic
957996281 3:87693598-87693620 TTTTTTTTTTTCATTTTTGATGG - Intergenic
958041072 3:88227384-88227406 TTTCTTTCTTTCTTATTTGGTGG - Intergenic
958492003 3:94787738-94787760 TCTTTTTCTGTCACAATTGATGG - Intergenic
958733405 3:97982576-97982598 TCTTTCTCTTGCTTCTTTGAGGG + Intergenic
959086847 3:101859965-101859987 ACTTGTTCTTTTCTATTTTATGG - Exonic
959135229 3:102410536-102410558 TTTTTTTCTTTCTTTTTTGGTGG - Intronic
959606479 3:108246555-108246577 TCTCTCTCTCTCCTATTTGCTGG - Intergenic
959683397 3:109121245-109121267 GCTTTTGCTTTCCTATTAAAAGG + Intergenic
960184714 3:114624467-114624489 TCTTTTTCTTTCTGTTTTGAGGG - Intronic
960317914 3:116200842-116200864 TCTTGTTCTCTTCTATTTGTAGG + Intronic
960418909 3:117419348-117419370 ACTTTTTCTTTTTTATTTAAAGG + Intergenic
960469439 3:118043369-118043391 GCTTTTTCTTTCTTATTTTAGGG - Intergenic
960490864 3:118314982-118315004 TATTTTTCCTTCATGTTTGATGG - Intergenic
960690068 3:120337293-120337315 TTTATTTATTTACTATTTGATGG + Intronic
960716967 3:120585401-120585423 TCTTTTTTTTTCTTTTATGATGG - Intergenic
960984071 3:123260838-123260860 TCTTTTTTTTTTTTTTTTGACGG + Intronic
961020742 3:123504518-123504540 TTTTTTTTTTACCTATTTGAAGG - Intronic
961250792 3:125503495-125503517 TCTTTTTCTTTGTTTTTTAAAGG + Intronic
961395887 3:126589797-126589819 TCTTTTTGTTTTCCATTTGCTGG + Intronic
961397014 3:126600960-126600982 TCTTTCTCTTTCATATTTGAAGG + Intronic
961969964 3:130952490-130952512 TCTTTTTCTTTTCTTTTGGTGGG - Intronic
962166326 3:133052945-133052967 TCTGTTTGTTTCTTTTTTGATGG + Intronic
962228410 3:133636479-133636501 CTTTTTTCTTTCTTTTTTGATGG - Intronic
962330590 3:134474505-134474527 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
962574066 3:136739499-136739521 TCTTTTTTTTTTTTTTTTGACGG - Intronic
962615267 3:137120258-137120280 TCTTTTTCTTTTTTTTTTGATGG + Intergenic
962664982 3:137644965-137644987 TTTTTTTCTTTCCTATATTTTGG + Intergenic
962688576 3:137870683-137870705 TCTTTATCCTTCATGTTTGAAGG - Intergenic
963124974 3:141807528-141807550 TCCTTTTCTTCCCTTGTTGAGGG - Intronic
963199628 3:142572769-142572791 TTTTTTTCTTTTCTATTTTTTGG - Intronic
963305979 3:143653471-143653493 GTTTTTCCTTTCCTATTTCATGG + Intronic
963446608 3:145418021-145418043 TCTTTGTCTTTGAAATTTGAGGG + Intergenic
963674958 3:148299032-148299054 TCTTTTTCTTTTTTTTTTGGCGG + Intergenic
964074316 3:152674767-152674789 TCTTTTTCTTTTTTTTTTTAAGG + Intergenic
964220955 3:154343987-154344009 TCTTTTTCTTTCTTTTTTTTTGG - Intronic
964337523 3:155671859-155671881 TCTTTTACTTTCCTTTTTGTAGG - Intronic
964516520 3:157515136-157515158 TCTTTTTCTTACTGATTTGAAGG + Intronic
964578377 3:158201084-158201106 TATTTTACTTTCATTTTTGAGGG + Intronic
964814965 3:160707200-160707222 TCTTTGTCTTTCCTACTAGTGGG + Intergenic
964833990 3:160916841-160916863 CTCTTTTCTTTCCTATTTGGAGG - Intronic
964837322 3:160953898-160953920 TGTTTTTCTTTCCCATCTGTTGG + Intronic
964978030 3:162643182-162643204 TCCTTTTCTTTCCAAATTTAAGG + Intergenic
965148095 3:164932359-164932381 TCTTTTTATTTATTTTTTGATGG - Intergenic
965317558 3:167210827-167210849 TATTTCTCCTTCATATTTGAAGG - Intergenic
965344716 3:167534193-167534215 TCTTTTTCTTTTTTTTTGGATGG - Intronic
965567225 3:170132967-170132989 TCTTTATCATTTCTTTTTGAAGG - Intronic
965763893 3:172109767-172109789 TCTTTTTCTCTACTACGTGATGG - Intronic
965793756 3:172416370-172416392 TTTTTCTCTTTCCTTTTTGTGGG + Intergenic
965858046 3:173112806-173112828 TCTTGTTCTGTCTTCTTTGATGG + Intronic
966078377 3:175967417-175967439 TATTTTCCTTTCATTTTTGAAGG - Intergenic
966081296 3:176005020-176005042 TCTTTTTTTTTCCCATTTGAAGG + Intergenic
966130939 3:176638361-176638383 TATTTTTCTTTCATTTATGAAGG - Intergenic
966305938 3:178534812-178534834 TCTTTTTCCTACCAATTTAATGG + Intronic
966366800 3:179197041-179197063 TTTTTTTCTTTGTTTTTTGATGG + Intronic
966377023 3:179306858-179306880 TTTTTTTTTTTCCTATTTCATGG + Intergenic
966588611 3:181654466-181654488 TCATTTTTTTTTTTATTTGACGG + Intergenic
966641670 3:182198089-182198111 ACTTTCCCTTTCCTATATGAAGG + Intergenic
966782673 3:183597282-183597304 TCTTTTTCTTTGCTTTTTCTTGG - Intergenic
966907885 3:184540879-184540901 TTTCTTTCTTTCCTTTTAGACGG - Intronic
967004010 3:185365977-185365999 TTTTCTTTTTTCCTATTTAATGG + Intronic
967197588 3:187042120-187042142 TCTTTTTCTGGCCATTTTGAAGG + Intronic
967301405 3:188017846-188017868 ATTTTTTCTTTCCCATTTAAGGG + Intergenic
967428331 3:189353013-189353035 TATTTTTGTTTCATATTTGATGG + Intergenic
967434234 3:189426133-189426155 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
967653501 3:192016385-192016407 TCTTTTTATTTCCCATTTTCAGG - Intergenic
967926911 3:194657467-194657489 TTTTTTTTTTTGATATTTGAGGG + Intronic
968094636 3:195919732-195919754 TCTTTTTCTTTTTTTTTTGACGG - Intergenic
968155309 3:196376023-196376045 TCTTTTTCTTTCTTTTTTTGAGG - Intronic
968206747 3:196809071-196809093 TTTTTTTCTTTTTTTTTTGAGGG - Intronic
968348902 3:198035811-198035833 TCTATTTTTTTCCTGTTTGAAGG + Exonic
968526432 4:1060093-1060115 TCTTTTTTTTTTTTTTTTGATGG - Intronic
968932937 4:3592687-3592709 TCTTTGTCTTTCCTTTGTGGTGG + Intergenic
969189343 4:5504460-5504482 TCTTTTTGATTCCTATTTTGTGG - Intergenic
969473728 4:7408329-7408351 TATCTGTCTTTCATATTTGAAGG + Intronic
970080799 4:12282910-12282932 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
970410016 4:15796349-15796371 TCTTCATTTTTCCTACTTGAGGG + Intronic
970479245 4:16457111-16457133 TATTTTTTTTTACTAATTGAAGG - Intergenic
970484811 4:16514295-16514317 TCCTTTTCTTACCTATTATAAGG - Intronic
970658842 4:18261921-18261943 TCTTATTCTGTACTATTTCAAGG + Intergenic
971038718 4:22725949-22725971 TTTTTTTCTTTCTTATTTTCTGG + Intergenic
971186963 4:24387729-24387751 TCTCTTTCTTTCTTTCTTGATGG - Intergenic
971513591 4:27459090-27459112 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
971666110 4:29487660-29487682 CCTTTTTCTTTCCTGTTTTATGG - Intergenic
971718941 4:30219476-30219498 TATTTTTCCTTCCTGTTTGAAGG + Intergenic
971730661 4:30375627-30375649 TTCTTTTCTTTTCTTTTTGACGG + Intergenic
971741035 4:30521239-30521261 TATTTTTCTTTCCTTTTTAGGGG + Intergenic
971840385 4:31844081-31844103 TTTTTTTCTTTCATTTTTGGTGG + Intergenic
972065920 4:34943622-34943644 TCTGTTAATTTCCTGTTTGAAGG + Intergenic
972103965 4:35459876-35459898 TATTTCTCTTTCATGTTTGAAGG + Intergenic
972125283 4:35757922-35757944 TATTTCTCTTTCATGTTTGAAGG + Intergenic
972187783 4:36552451-36552473 TTTTTTTCCTTCCTTTTTCAGGG + Intergenic
972303963 4:37813799-37813821 CCTTTGTCTTTCATATTGGAGGG + Intergenic
972451856 4:39208673-39208695 TCTTTTTCTATCCTTTTACATGG - Intronic
972698436 4:41470421-41470443 TTTCTCTCTTTCCTATGTGAGGG + Intronic
972735433 4:41836367-41836389 TTTTTTTTTTTCCAATCTGAAGG - Intergenic
973085323 4:46052220-46052242 TCTTTTTTTTTTTTATTTCAAGG - Intronic
973321617 4:48816525-48816547 TTTTTTTTTTTCCTTTTAGACGG - Intronic
973342310 4:49017838-49017860 TTTTTTTTTTTTTTATTTGATGG + Intronic
973847800 4:54930883-54930905 TCTTTTACCTTCTTATTTCAGGG - Intergenic
973852205 4:54972198-54972220 TCTGATTTTTTCCTATTTTATGG - Intergenic
974113450 4:57552051-57552073 TCTTTTTTTTTTCTTTTTTAAGG + Intergenic
974150816 4:58007183-58007205 CTTTTTCCTTTCCAATTTGACGG - Intergenic
974161990 4:58151836-58151858 TTTTTTTCTTTCCAATTTCTTGG - Intergenic
974189971 4:58492159-58492181 TTTTTTTAGTTCCTATTGGAAGG - Intergenic
974350419 4:60737121-60737143 TCTTTTTTTTTTCTTTTAGATGG + Intergenic
974415717 4:61603907-61603929 TTTTTTTCTTTCAGAATTGAAGG - Intronic
974501396 4:62708515-62708537 TTTTTTTCTCTCATATTTGAAGG - Intergenic
974561508 4:63528147-63528169 TCTTGTTCTTTCCTATTAAGTGG - Intergenic
974601877 4:64093515-64093537 GCTTTTTTTTTTCTTTTTGATGG - Intergenic
974628660 4:64455530-64455552 TTTGTTTTTTTCCTATTTCATGG + Intergenic
974709834 4:65575969-65575991 TCTCTCTCTTTCTTTTTTGATGG - Intronic
974719615 4:65721106-65721128 TCTTTTTATTTCTAATTTGTTGG - Intergenic
974756703 4:66218727-66218749 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
974771875 4:66425006-66425028 TATTTCTCTTTCATGTTTGAAGG - Intergenic
974785447 4:66613971-66613993 TTTTTTTTTTTCCATTTTGAAGG + Intergenic
974832514 4:67206854-67206876 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
974873668 4:67675724-67675746 TCTTTCTCTTTCCTTTCTGATGG - Intronic
974915133 4:68170211-68170233 ACTTTTTCTTTACTCTTTGATGG + Intergenic
974945318 4:68520007-68520029 TCATTTTCTTTCCTATTTGTTGG + Intergenic
975066409 4:70070350-70070372 TCTTTGTCTCTACTATTTAATGG - Intergenic
975383506 4:73729170-73729192 TCTTTTTCTTTTCTTTGAGATGG + Intergenic
975455859 4:74589117-74589139 TATTTTTCTTTTCTTTTGGAGGG - Intergenic
975463359 4:74681533-74681555 TATTTTTCCTTCAGATTTGAAGG + Intergenic
975550085 4:75603708-75603730 TCTTTTTTTTTTTTTTTTGATGG - Intronic
975597468 4:76063152-76063174 TCTTTTTCTCTACTACTTCATGG + Intronic
975629963 4:76389870-76389892 TATTTTTCCTTCATGTTTGAAGG - Intronic
975630982 4:76402150-76402172 TTTTTTTCTTTTCAATTTAATGG - Intronic
975739981 4:77420355-77420377 ACTTTGTCTTTCATATTGGAAGG - Intronic
975914930 4:79313135-79313157 TTTTTTTGTTTCCTCTTTAATGG - Intronic
975929449 4:79501322-79501344 TCTTTTTCTTGCCTTTTTGAGGG - Intergenic
975992932 4:80279410-80279432 TCTTTTTCTTTCTGATTTTGGGG + Intronic
976164799 4:82242924-82242946 TCTTTTTCTTTCTTATTTGTAGG - Intergenic
976229523 4:82827022-82827044 TATTTTTCTTTTCTATTTTAAGG + Intronic
976233030 4:82866060-82866082 TTTTTTTCTTTTCTTTTTGCAGG - Intronic
976249164 4:83033034-83033056 TCTTTCTCTTTCCCAATAGAGGG + Intergenic
976840864 4:89431050-89431072 TCTTTCTCTTTCCTATTCCTGGG - Intergenic
977039394 4:91996403-91996425 TCTTTTTTTTTTTTTTTTGAGGG + Intergenic
977079390 4:92504563-92504585 TCTTTTTCTTTCATATGTTTTGG + Intronic
977339569 4:95741590-95741612 TTTTTTTTTTTCATATTTCATGG + Intergenic
977350006 4:95871715-95871737 TCTTTGTATTTCATATATGACGG + Intergenic
977672367 4:99710765-99710787 TCTTTTTTTTTTTTCTTTGATGG - Intergenic
977851014 4:101829228-101829250 CCTTTATCTTTCTTATTTCAAGG + Intronic
977926756 4:102709144-102709166 TCTTTTCCTTTCCTTCCTGACGG - Intronic
978122685 4:105099512-105099534 TTTTTTTTTTTCCTTTTAGAAGG - Intergenic
978280198 4:107002859-107002881 TCTCTTTCTTTCCTATAAAATGG + Intronic
978365934 4:107981529-107981551 TCTTTTTTTTTTTTTTTTGAGGG - Intergenic
978466029 4:109010374-109010396 TCTTTTTCTTTTTAATTTCAGGG - Exonic
978590393 4:110317923-110317945 GCTTTTTCTTGCCACTTTGATGG - Intergenic
978610291 4:110530070-110530092 TCTTTTTTTTTCTTTTTAGACGG - Intronic
978687597 4:111465005-111465027 TTCTTTTCTTTCTTTTTTGAAGG - Intergenic
978690990 4:111509587-111509609 TCTTTTTCTATGCTTTGTGAAGG + Intergenic
978765709 4:112403030-112403052 TCTTTTTCTTTCTTTTTTAGGGG + Intronic
978767077 4:112415188-112415210 TTTTTTTCTTAATTATTTGATGG - Intronic
978930086 4:114299573-114299595 TTTTTTTTTTTGCTATTGGATGG + Intergenic
979032052 4:115661886-115661908 TCTTTCTGTCTCCTAATTGAAGG + Intergenic
979105218 4:116677159-116677181 TTATTTTCTTCCCTGTTTGAAGG + Intergenic
979124133 4:116946162-116946184 TATTTTTCTTTTCAATTTGAAGG - Intergenic
979221801 4:118235023-118235045 TTTTTTTCTTTTTTTTTTGATGG - Intronic
979372284 4:119903488-119903510 TCTTATTATTTATTATTTGATGG - Intergenic
979395242 4:120179663-120179685 TATTTCTCCTTCATATTTGAAGG - Intergenic
979589123 4:122458170-122458192 TCATTTTTTTTTCTACTTGAGGG - Intergenic
979779691 4:124635132-124635154 TATTTATCTTTGCTAATTGATGG + Intergenic
979834117 4:125340129-125340151 TCTTATTCTTTTCTATTTTGTGG + Intronic
979841655 4:125449510-125449532 TCTGTATCTTCCCTATTTAAAGG - Exonic
980055744 4:128077821-128077843 TCTTTTTCTTTTCTATTTTGTGG - Exonic
980292476 4:130860688-130860710 TCCTTTACTTTTCTATATGATGG + Intergenic
980334175 4:131448532-131448554 TCTATTTCATTCCAATTTGCTGG - Intergenic
980382213 4:132037016-132037038 TATTTTTTTTTCCTATTAAAAGG - Intergenic
980761301 4:137237845-137237867 TCTTTTTTCTTCATCTTTGATGG + Intergenic
980805648 4:137809931-137809953 GCTTTTTCTTTCTCCTTTGACGG + Intergenic
980922416 4:139100273-139100295 TCTTTTTTTTTCCTTTTTGGGGG + Intronic
981140430 4:141261232-141261254 TATTCTTCCTTCATATTTGAGGG - Intergenic
981432881 4:144682435-144682457 TCTTTTACTTTGATATTTGGTGG - Intronic
982042930 4:151412686-151412708 TCTTTTTTTTTTTTTTTTGATGG + Intronic
982057140 4:151563073-151563095 AATTTTTCTTTCCTTATTGATGG + Intronic
982234775 4:153242324-153242346 TTTTTTTCTTTCCTATTCCCAGG + Intronic
982317698 4:154048118-154048140 TCTGTTTCTTTCTTATATGTTGG - Intergenic
982334612 4:154220162-154220184 TCTTGTTCTATCCTTTTTGGAGG + Intergenic
982556699 4:156875592-156875614 TGTTTTTCTTTCCGATATGTCGG - Intronic
982624017 4:157742151-157742173 TCTTTTTCTTCACAATTTCATGG + Intergenic
982707637 4:158727196-158727218 TCTTTTTCCTTTCTATTTCAGGG - Intergenic
982757760 4:159243727-159243749 TCTTTTCCTTTCCTCCTTTATGG + Intronic
982775407 4:159436309-159436331 TGTTTTTCATCCCTATTTGGGGG - Intergenic
982867014 4:160526051-160526073 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
983121456 4:163890388-163890410 TCTTCTTGTTTGCTACTTGAAGG + Intronic
983203410 4:164886639-164886661 TCTTTTTCTTTTTTTTTAGACGG - Intronic
983208569 4:164935634-164935656 TCTTTTTCTTTTCTTTGAGATGG + Intergenic
983367088 4:166805382-166805404 GGGTTTTCTTTCCTACTTGATGG + Intronic
983587202 4:169368665-169368687 TCTTTTTCTTTTCTTTTTTTTGG - Intergenic
983666152 4:170186619-170186641 TGTTTTTCTTTGTGATTTGATGG + Intergenic
983715983 4:170781693-170781715 TCTTTTTCTTTCCTTTTTTGAGG + Intergenic
983790969 4:171796324-171796346 TCTTTTTTTCTCCTATTTTCTGG + Intergenic
983921751 4:173353382-173353404 TCTTTTTCTTACTGATTTGTAGG - Intergenic
983934907 4:173494936-173494958 TCTTTTTCTTTCCTCTCAGCCGG - Intergenic
983987454 4:174077200-174077222 TCCTTTTTTTTCCTTTTTTAAGG + Intergenic
984201081 4:176722116-176722138 TTTTTTTCTATCCTATTGGTGGG - Intronic
984205233 4:176779730-176779752 TTTTTTTTTTTCCTATCTGGGGG - Intronic
984302999 4:177947998-177948020 TTTTTTTTTCTCCTATTTGCAGG - Intronic
984406117 4:179332220-179332242 TCCTTTTCTTTCTCATTTAAGGG - Intergenic
984463442 4:180066102-180066124 TCTTATACTTTACTATTTCAAGG - Intergenic
984720029 4:182962120-182962142 TCTTTTTCTTTTTGATTTGCAGG + Intergenic
984838437 4:184044517-184044539 ACTTTTTCTGAACTATTTGAAGG + Intergenic
985147164 4:186905447-186905469 TTTCTTTCTTTCTTTTTTGATGG + Intergenic
985190148 4:187363901-187363923 TCTTTTTCTTTTCTATTCTTAGG + Intergenic
985231911 4:187827473-187827495 TCTTTTTCTTTTTTTTTAGACGG - Intergenic
985492795 5:189144-189166 TCTTTTGCTTTCCTCCTGGATGG + Exonic
985871316 5:2559590-2559612 TCTTTTTTTTTTTTTTTTGAGGG + Intergenic
986250880 5:6057581-6057603 TAGTTTTCTGACCTATTTGATGG - Intergenic
986277342 5:6288443-6288465 TATTTTTCCTTCATTTTTGAAGG - Intergenic
986603260 5:9495543-9495565 TCTTGTTCCTTCATATTCGAGGG - Intronic
986657379 5:10028851-10028873 TCTTTCTCCTTCATGTTTGAAGG + Intergenic
986865940 5:11987246-11987268 CCTTTTTCTTTTCTTTTTTAAGG - Intergenic
987019093 5:13851664-13851686 TTTCTTCCTTTCATATTTGATGG - Intronic
987225733 5:15839092-15839114 TTTTTTTTTTTCCAATTTGTAGG + Intronic
987370542 5:17188873-17188895 TCCTTTTCTTCCCTATTTTCCGG - Intronic
987375763 5:17232715-17232737 TCTTTTTCTTTTTTTTTTGGAGG + Intronic
987483877 5:18497383-18497405 TTTTTCTCTTTCATTTTTGAAGG - Intergenic
987525855 5:19048035-19048057 TCTTTTTCTGTTTTATTTCAAGG - Intergenic
987611138 5:20204404-20204426 TCTCTCTCCTTCATATTTGAAGG - Intronic
987704921 5:21450512-21450534 TTTTTTTATTTTTTATTTGATGG - Intergenic
987729118 5:21744816-21744838 TTTTTTTCTTTCCTCTTTTAAGG - Intergenic
987931001 5:24399022-24399044 TCTTTCTCTTTCCTTTCTGCTGG - Intergenic
987971703 5:24954728-24954750 TTTTTTTTTTTCCTGTTTGCAGG + Intergenic
988398004 5:30721302-30721324 TTTTTTTTTTTTCTATTTTAGGG - Intergenic
988613751 5:32753326-32753348 TTTTTTTTTTTCCTGTATGAAGG + Intronic
988683637 5:33506809-33506831 TCTTTTTCTTCCCTGTCTCAGGG - Intergenic
988709127 5:33755956-33755978 CCTTTTTCCTGCCTATATGATGG - Intronic
988937970 5:36108202-36108224 TGTTTTTCTTTCCTATTAGTAGG - Intronic
988977997 5:36534908-36534930 TTTTTTTCTTTTCAATTCGAGGG + Intergenic
989083074 5:37646595-37646617 TATTTTTCTTTCATGTTTGAAGG + Intronic
989211854 5:38864484-38864506 TATTTCTCTTTCATTTTTGAAGG + Intronic
989291853 5:39776871-39776893 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
989327133 5:40211511-40211533 TCTTTTTTTTTCTTTTTTCAGGG - Intergenic
989435093 5:41403282-41403304 TTTTTTTTTTTTCTATTTAAAGG + Intronic
989451465 5:41591134-41591156 TTTTATTCTTTCCTTTTTGTGGG + Intergenic
989671480 5:43922930-43922952 TATTTTTCCTTCGTGTTTGAAGG + Intergenic
989808355 5:45640576-45640598 TCTTTTTTTTTTTTTTTTGACGG + Intronic
990238740 5:53796012-53796034 TTTTTATCTGTCCTATTTCAGGG - Intergenic
990289369 5:54333116-54333138 TCTTCTACCTTCCTATATGAAGG + Intergenic
990301326 5:54452067-54452089 TTTTTTTCTTTTCTTTTAGATGG + Intergenic
990389543 5:55304801-55304823 TCCTTATCTTTCCAATTTGACGG - Intronic
990392372 5:55338232-55338254 TATTTTGCTTTCATTTTTGAAGG + Intronic
990475537 5:56158684-56158706 TCTTTTTCTTTTCTTTTTGGAGG + Intronic
990812028 5:59737416-59737438 TTTTTTTCTTTCAAATTTCATGG - Intronic
990915321 5:60896789-60896811 CATTTTTCTTTCCTTCTTGAAGG - Intronic
990953990 5:61325515-61325537 TCATTCTCATTCCTATTTGGAGG - Intergenic
990993645 5:61709498-61709520 TCTTTCTCTTGCCTGATTGAGGG - Intronic
991004525 5:61814336-61814358 TTTTTTTTTTTACTTTTTGATGG - Intergenic
991186107 5:63809789-63809811 TCTTTTTTTTTAATATTTCATGG + Intergenic
991205444 5:64044184-64044206 TATTTCTCCTTCATATTTGAAGG - Intergenic
991329766 5:65481647-65481669 TCTTTTCCTTTCCTTTTTTGGGG - Exonic
991546458 5:67787240-67787262 TGTTTTTGTTTAGTATTTGAGGG + Intergenic
991615292 5:68490892-68490914 TCTTCTTCTTTTCTTTTTGGGGG + Intergenic
991693455 5:69248172-69248194 TATTTCTCCTTCCTGTTTGAAGG + Intronic
991701617 5:69321838-69321860 TCTTTTTTTTTTCTTTTAGACGG + Intronic
991897597 5:71421048-71421070 TTTTTTTTTTTCCTCTTTCAAGG - Intergenic
992037680 5:72797224-72797246 TCTTTTTTTTTCATTTTTGTAGG - Intergenic
992060788 5:73044685-73044707 TCTTTTTCTTTCTTTTTTTTTGG + Intronic
992133895 5:73723192-73723214 TTTTTTTTTTTCCTTTGTGATGG + Intronic
992341311 5:75826302-75826324 TCTTTTTTTTTCCTTTTTTCCGG - Intergenic
992426702 5:76664853-76664875 TTTTTTTCTTTGCAAATTGAAGG - Intronic
992579233 5:78154187-78154209 TATTTCTCCTTCATATTTGAAGG + Intronic
993147598 5:84115067-84115089 TACTTTTCTTTCTTTTTTGAAGG + Intronic
993338873 5:86696930-86696952 TTTTTTTTTTTCTTGTTTGAAGG + Intergenic
993414116 5:87604750-87604772 TATTTCTCCTTCATATTTGAAGG + Intergenic
993414715 5:87612233-87612255 ACTTTTTCTTTAAAATTTGAAGG - Intergenic
993645693 5:90457693-90457715 TCTTTTTCTTACTGATTTGTAGG + Intergenic
993677461 5:90834371-90834393 TCTTTCTCCTTCATGTTTGAAGG + Intronic
993692319 5:91017413-91017435 TCTTTTGCTTTCCTATCTGAAGG + Intronic
993786761 5:92148418-92148440 TATTTTCCTTTTGTATTTGAGGG + Intergenic
993799763 5:92318595-92318617 TCTTTTTCTTTCCTTCCTGAAGG + Intergenic
993936892 5:94015303-94015325 TATTGTTCCTTCCTATTTGAAGG - Intronic
994202823 5:96998124-96998146 TGATTCTCTTTCCTATTTTAAGG + Exonic
994319048 5:98368444-98368466 TCTTTTGCTTTCCAATTTTCTGG - Intergenic
994426140 5:99589776-99589798 TTATTTTCTTTCCTTTTTTAGGG - Intergenic
994531122 5:100972593-100972615 TATTTTTTCTTCCTGTTTGAAGG - Intergenic
994653783 5:102563323-102563345 TCTCTCTCCTTCATATTTGAAGG - Intergenic
995049851 5:107689777-107689799 TCTCCTTCTTTCATGTTTGAAGG - Intergenic
995074119 5:107961202-107961224 TCTTTTTCTTTTCTTTTTTTGGG + Intronic
995305147 5:110637894-110637916 AGTTTTTCTTTTCTATTTTAAGG - Intronic
995591209 5:113701601-113701623 TCTTGTTCTTTCCTACTTCTGGG + Intergenic
995770823 5:115667042-115667064 TATTTCTCCTTCATATTTGAAGG - Intergenic
995841836 5:116449607-116449629 TCTTTTTCTTTCCTTCCTAAGGG + Intronic
995886927 5:116905610-116905632 TTTTTTTTTTTACAATTTGAAGG + Intergenic
995902374 5:117085283-117085305 TCTTGTTTTTTAATATTTGATGG - Intergenic
996059768 5:119020613-119020635 TCTTTTTTTTTTTTTTTTGAAGG + Intergenic
996116216 5:119622858-119622880 TATTTTTCCTTCATGTTTGAAGG + Intronic
996216663 5:120876018-120876040 TGTTTTGATTTCCTCTTTGATGG + Intergenic
996234871 5:121114156-121114178 TATTTTTCTTTTGTATTTTATGG - Intergenic
996401719 5:123069892-123069914 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
996410634 5:123155233-123155255 TTTTTTTCTTTCCTTTTTTGAGG + Intronic
996652559 5:125898107-125898129 TCTTTCTGTTTTCTATTTGTAGG - Intergenic
996663272 5:126028211-126028233 TTTTCTTTTATCCTATTTGATGG - Intergenic
996751959 5:126897618-126897640 TCTTTTACTTTCTTCTTTTATGG - Intronic
996855552 5:128002240-128002262 TTTTTTTCCTTCCTGTTTGGAGG - Intergenic
996915663 5:128709199-128709221 TCTGTTTCTTTCCTTTGTGATGG + Intronic
996956600 5:129189976-129189998 TATTTTTCCTTCATGTTTGAAGG - Intergenic
996998334 5:129726370-129726392 TGTATTTCTTTCCCATTTGCTGG + Intronic
997502847 5:134391481-134391503 CCATTTTCTATACTATTTGAAGG - Exonic
998022411 5:138780900-138780922 TTTTTTTCTTTAATAATTGAAGG + Intronic
998047530 5:139001159-139001181 TCTATTTTTTGCCAATTTGATGG - Intronic
998526062 5:142844412-142844434 TTTTTTTTTTTTCTTTTTGAGGG + Intronic
998836486 5:146207222-146207244 TCTTTTTCTTTCTTTTTTTGAGG + Intronic
999281285 5:150367891-150367913 GCTTTTTCTTTCATGCTTGATGG - Exonic
999470191 5:151848369-151848391 TCTTTTTCTTTTTTTTTAGATGG + Intronic
999587673 5:153108875-153108897 ACTTTTTCTTTCATACTTGCTGG + Intergenic
999677219 5:154016062-154016084 TCTTTTTCTTTTGTCTTTGTTGG - Intronic
999822497 5:155241745-155241767 TTTTTTTTTTTACTATTTCATGG + Intergenic
999830908 5:155318890-155318912 TCTTTTTCTTATTTATTTGCAGG + Intergenic
999860685 5:155642479-155642501 TCTTTTTCTTTTTTTTTTGGGGG - Intergenic
999904532 5:156125167-156125189 TATTTTTCTTTCTTTTTTGAAGG - Intronic
1000296779 5:159919100-159919122 TCTTTTTCTTTCTTTTTAAATGG - Intronic
1000479788 5:161757945-161757967 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
1000529887 5:162406469-162406491 TTTTTTTTTTTTCTTTTTGAGGG - Intergenic
1000573974 5:162952734-162952756 TCTTTTTCATTACAATTTTATGG + Intergenic
1000724725 5:164755073-164755095 TATTTTTCTGTCCTAACTGAGGG - Intergenic
1000784387 5:165526083-165526105 TCTTTTTCTTTTCTTATAGAAGG + Intergenic
1001546700 5:172574863-172574885 CCTTTTTCTTTCCTTTTTTTGGG + Intergenic
1001731364 5:173962731-173962753 TCTTTTTCTTTCTTCTGGGATGG - Intergenic
1001749698 5:174119154-174119176 TCTCTTTCTTACATATTTGCTGG + Intronic
1001943615 5:175759044-175759066 TCTTTTTCCTTCCTTCTTGGGGG - Intergenic
1002511240 5:179719647-179719669 GCTTTTTCTTTTGTATTTAAGGG + Exonic
1003238910 6:4324185-4324207 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1003259854 6:4507087-4507109 TATTTTTTTTTCCTACTTCATGG + Intergenic
1003509100 6:6764551-6764573 TCTTTCTCTTTCTTCTTTTAGGG - Intergenic
1003628282 6:7763761-7763783 TTTTTTTCTTTCCTTTTAGCAGG - Intronic
1003762139 6:9191274-9191296 TCTTTCTGTTTCCTAATTCAGGG - Intergenic
1003992791 6:11503490-11503512 TCTTTTTATTTTTTATTTCAGGG + Intergenic
1004184350 6:13409078-13409100 TTTCTTTCTTTCCTTTCTGATGG - Intronic
1004606024 6:17195705-17195727 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1004642315 6:17527185-17527207 TTTTTTTCTTTCAGATTTCAGGG - Intronic
1004812664 6:19276667-19276689 TCTTTCTCTTTCCTTTCTGCTGG - Intergenic
1004868397 6:19877146-19877168 TGTTTTCGTTTCCTATTTTAGGG - Intergenic
1005046427 6:21647144-21647166 TCTTTTTCTTTTCTATGAAATGG - Intergenic
1005178749 6:23078946-23078968 TTTTTTTCTATCATATTTTAGGG + Intergenic
1005183471 6:23135654-23135676 TATTTTTCCTTCATTTTTGATGG + Intergenic
1005225074 6:23633328-23633350 TTTTTTCATTTCCTATTTGAAGG + Intergenic
1005368222 6:25101258-25101280 TTTTTTTTTTTACTTTTTGAGGG + Intergenic
1005951202 6:30632565-30632587 TCTTTTTCTTTTTTCTTTGATGG - Intronic
1006044340 6:31281569-31281591 TCTTTTTCTTTTTTTTTTAATGG - Intronic
1006205506 6:32338141-32338163 TCTTTTTATTTCCTCTCTCAGGG + Intronic
1006711293 6:36074613-36074635 TCTTTTTTTTTCCTTTTTTTTGG + Intronic
1007671821 6:43561381-43561403 TCTTTTTTTTTTCTTTTAGATGG + Intronic
1008098618 6:47367288-47367310 TCTTTTTTTTGCTTTTTTGAGGG - Intergenic
1008246720 6:49184125-49184147 CCATTTTATTTCCAATTTGAGGG - Intergenic
1008262555 6:49385032-49385054 ACTATTTCTTTCATATATGAAGG - Intergenic
1008346495 6:50433513-50433535 TATTCTTCTGTCTTATTTGATGG - Intergenic
1008348776 6:50462887-50462909 ATTTTTTTTTTCCTTTTTGAAGG + Intergenic
1008478286 6:51957245-51957267 TCTTTCTCTTTCCTACTTGCTGG - Intronic
1008641834 6:53472226-53472248 TCTTTCTCCTTCGTGTTTGAAGG + Intergenic
1008643783 6:53492140-53492162 TCTTTTTTTATCCTTTTTAATGG - Intergenic
1008727399 6:54439517-54439539 TATTTCTCTTTCATGTTTGAAGG + Intergenic
1008777577 6:55060178-55060200 TATTTCTCTTTCATTTTTGAAGG + Intergenic
1008803691 6:55401975-55401997 TCTTTTTCTTTTCTTTTTTGTGG + Exonic
1008848025 6:55992222-55992244 TATTTTTCTTTCACATTTGAAGG + Intergenic
1009329530 6:62399682-62399704 TATTTCTCCTTCATATTTGAAGG + Intergenic
1009559901 6:65225710-65225732 TTTTTTTTTTTCTTTTTTGATGG - Intronic
1009692453 6:67053457-67053479 CATTTTTCTTTTCTATTTTATGG + Intergenic
1009789468 6:68383517-68383539 TATTTTTCCTTCATGTTTGAAGG + Intergenic
1009883474 6:69597803-69597825 TGTTTTTCTTTCCTCTGTTAGGG - Intergenic
1009893860 6:69722200-69722222 TCTTTATCTTTCATACTTGAAGG - Intronic
1010028251 6:71244784-71244806 TGTATTTCTTTCATATTTTATGG + Intergenic
1010077918 6:71822537-71822559 TCTTTTTGTTTCCAATTAGCAGG + Intergenic
1010085068 6:71907962-71907984 TCTCTTACTTTCAAATTTGAAGG - Intronic
1010556291 6:77283208-77283230 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1010594430 6:77747312-77747334 TCTTTTTCTTTTTTTTTAGATGG - Intronic
1010740572 6:79498160-79498182 TTTTTTTTTTAGCTATTTGAGGG - Intronic
1010800302 6:80167656-80167678 TTTTTTTCTTTTCTATTTTAAGG + Exonic
1010970419 6:82257081-82257103 TCTTTTTCTTTCTTTCTAGATGG - Intergenic
1011078136 6:83459912-83459934 TCTCTTTGTTTCCTGTTTGTTGG - Intergenic
1011123027 6:83975642-83975664 ACTTTTTTTTTCCAATTTGAAGG - Intergenic
1011243127 6:85293895-85293917 GCTTATTCTTTTCTATTTAAGGG + Intergenic
1011404229 6:87000657-87000679 TATTTCTCTTTCATGTTTGAAGG - Intronic
1011447150 6:87453243-87453265 TATTTTTCCTTCATGTTTGAAGG - Intronic
1011508147 6:88070775-88070797 TCTCTCTCCTTCATATTTGAAGG + Intergenic
1011527460 6:88280692-88280714 TTTTTTTCTTTCTTAATAGAGGG - Intergenic
1011723991 6:90189695-90189717 TCTTTTTCTTCCCTACCAGAAGG + Intronic
1011799736 6:90998888-90998910 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
1011815130 6:91180390-91180412 TTTTTTTCTTTCTTTTTTTAGGG - Intergenic
1012076543 6:94693792-94693814 TCTTTTTCTTTCCAGCTGGATGG - Intergenic
1012140377 6:95619419-95619441 TCTTTTGCTTTCCTCTCTGTTGG - Intergenic
1012275583 6:97271401-97271423 TTTATTTCTTACATATTTGATGG + Intronic
1012493077 6:99804186-99804208 TCTCTTTCTCTCCTATTGGCTGG + Intergenic
1012710135 6:102589056-102589078 TTCTTTTTTTTCTTATTTGATGG + Intergenic
1012760135 6:103290960-103290982 TATTTTTCTTTCATTTTTGAAGG - Intergenic
1013222937 6:108095605-108095627 TCTTTTTCTTTCTTTTGAGACGG - Intronic
1013298913 6:108784808-108784830 TCTTTTTCTTGCTTATTTGTAGG + Intergenic
1013449653 6:110267265-110267287 GGTTTTTCTTTCTTATTTCATGG - Intronic
1013548333 6:111182322-111182344 TTTTTTTTTTTCCTTTTTAACGG + Intronic
1013773160 6:113649953-113649975 TCTTTTTCCTTCCTATTCAAAGG - Intergenic
1013781352 6:113731848-113731870 TATTTTTCTTACTTTTTTGAGGG + Intergenic
1014100244 6:117503751-117503773 TCTTTTTCTTTACCAGGTGATGG + Exonic
1014123978 6:117756461-117756483 TCTCTCTCTTTCATGTTTGAAGG - Intergenic
1014445285 6:121520047-121520069 TCTTTTCCTATCCTCTTAGAGGG + Intergenic
1014491042 6:122062148-122062170 TTTCTTTCTTTCCTTTTTTAGGG - Intergenic
1014679095 6:124406415-124406437 TCTTTTTATTTCTGATTAGATGG + Intronic
1014687527 6:124521311-124521333 TCTTTTTTATTCCTAGTTTATGG + Intronic
1014697021 6:124635368-124635390 TCTTTATCTTTGCCATTTGCTGG - Intronic
1014744579 6:125184778-125184800 TCTTTTCCTCTACTATTTGCTGG - Intronic
1014928592 6:127305332-127305354 TATTTCTCTTTCATGTTTGAAGG - Intronic
1014994934 6:128131055-128131077 TCTTTCTCTTTTCCATTTTAAGG + Intronic
1015008352 6:128311861-128311883 TCCTTTTCCTTCCCATTTAAGGG + Intronic
1015173759 6:130283457-130283479 TTTTTGTCTTTGGTATTTGATGG - Intronic
1015240478 6:131017578-131017600 ACTTTATTTTTCCTAATTGAAGG + Intronic
1015257459 6:131195674-131195696 TATTTCTCTTTCATGTTTGAAGG + Intronic
1015402741 6:132805230-132805252 TCTTTTTCTTTTCTTCTAGATGG + Intergenic
1015411153 6:132895278-132895300 ACTTTTTCTTTCCCCTTTGGAGG + Intergenic
1015450691 6:133363477-133363499 TCTTTTTTTTTTTTTTTTGACGG + Intronic
1015491956 6:133836766-133836788 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1015544687 6:134349301-134349323 TTTTTTTTTTTCTTTTTTGATGG - Intergenic
1015622473 6:135146029-135146051 TGTTGTACTTTCCTACTTGATGG - Intergenic
1015635085 6:135267024-135267046 TTTTTTTCTTCCCAATTTGAAGG - Intergenic
1015647587 6:135411023-135411045 TCTCTTTCTTTCCTAGGAGATGG + Intronic
1015668145 6:135654892-135654914 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1015678974 6:135782172-135782194 TTTTCTTTTATCCTATTTGATGG - Intergenic
1015812429 6:137174177-137174199 ACTTGTTCTTTCTTATTTGCTGG + Intergenic
1016080635 6:139850838-139850860 TCTCTTTCTTTTCTATTTTATGG + Intergenic
1016163641 6:140912074-140912096 TCTTGTTCTTGCCTATTTCAAGG - Intergenic
1016234535 6:141847237-141847259 TTTTTTTCTTTTGTAATTGAAGG - Intergenic
1016251758 6:142050947-142050969 TATTTCTCTTTCATGTTTGAGGG - Intergenic
1016369705 6:143360741-143360763 TCTTTTTCTCTTCTTTTTGTGGG + Intergenic
1016391786 6:143581842-143581864 TAACTTTCTTTCCTTTTTGAGGG - Intronic
1016423010 6:143904308-143904330 TTCTTTTCTTTCCTATTCCATGG + Intronic
1016471641 6:144380987-144381009 TCTTTTTTTTTTTCATTTGAAGG + Intronic
1016646725 6:146418662-146418684 TCTATTACTTTGCTAATTGAAGG - Intronic
1016749479 6:147617100-147617122 TCTCTTTCTTTGTTATGTGAGGG + Intronic
1016750731 6:147628700-147628722 TCTTTTTCTTCCTTTTTTGGAGG - Intronic
1016855603 6:148667551-148667573 TCTTTTTTTTTAATATTTGAGGG + Intergenic
1017050481 6:150388704-150388726 TCTTTTTTTTTTTTTTTTGATGG + Intronic
1017242773 6:152189029-152189051 TCTTTTTCTTTCACTTTTGCTGG - Intronic
1017331767 6:153207787-153207809 TCTATTTCTATCCTAATAGAAGG + Intergenic
1017396390 6:154003913-154003935 TATTTCTCTTTCATGTTTGAAGG - Intergenic
1017624188 6:156331419-156331441 ACTTTCTCCTTCATATTTGAAGG + Intergenic
1017924091 6:158895951-158895973 TTTTTTTTTTTTCTTTTTGACGG + Intronic
1018525832 6:164708907-164708929 TCTCTTCCTTTCTTATATGATGG + Intergenic
1018557846 6:165066925-165066947 TGTTATTCTTTTCTATTTGTTGG - Intergenic
1018750796 6:166803168-166803190 ACTTTTGATTTTCTATTTGAAGG - Intronic
1018895190 6:168011428-168011450 TATTTTTCTTTCATTTCTGAAGG + Intronic
1018949018 6:168366343-168366365 TGTTTCTCTTCCTTATTTGAAGG + Intergenic
1019043230 6:169123245-169123267 TTTTTTTCTTACCTAGTGGAAGG - Intergenic
1019135611 6:169905799-169905821 TCTTCTTCTTTTCAATTTGGGGG + Intergenic
1019719203 7:2558241-2558263 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1019814368 7:3188812-3188834 TCTTTTTCTTTTTGATTTGTAGG + Intergenic
1019829754 7:3315830-3315852 TTTGTTTGTTTCCTATTTGAGGG + Intronic
1019872248 7:3775431-3775453 ATTTTTTTTTTTCTATTTGAAGG + Intronic
1019939315 7:4276743-4276765 TTCTTTTCTTTCCTTTTTTATGG + Intergenic
1020235657 7:6353453-6353475 TCTCTTTCTTTCTTTCTTGATGG - Intergenic
1020446186 7:8270700-8270722 TTTTTTTTTTTTCTTTTTGAGGG - Intergenic
1020481347 7:8665917-8665939 TCTTTTTTTTTTTTTTTTGAAGG + Intronic
1020573210 7:9892098-9892120 TATTTCTGTTTCATATTTGAAGG - Intergenic
1020574648 7:9911427-9911449 TATTTCTCTTTCCTGTTTGAAGG + Intergenic
1020688672 7:11327583-11327605 TTTTTTTTTTTCCTTTTTGGCGG + Intergenic
1020708719 7:11578315-11578337 TGCTTTTCTTTCCTTTTTAAAGG - Intronic
1021227480 7:18045255-18045277 TGTTTTTTTTTTCTGTTTGATGG - Intergenic
1021334283 7:19379295-19379317 GCTTTTCCTTTCCTTCTTGAGGG + Intergenic
1021565479 7:22012431-22012453 TTTTTCTCTTTCCTACTTGCTGG - Intergenic
1021667756 7:23003204-23003226 TCTTTTTTTTTCTTATATTAAGG + Intronic
1021700379 7:23314018-23314040 CATTTTTCTTTCCTTTTTGTTGG + Intronic
1021748376 7:23767721-23767743 TGTTTTTCTTTCTGATGTGAGGG + Intronic
1021853237 7:24828911-24828933 TCTCTTTCTTGCTTATTTCATGG + Intronic
1022144743 7:27525838-27525860 TCCTTTTCTTTCCTTTAAGATGG + Exonic
1022267679 7:28773296-28773318 TATTTTACTTTCCTAATTAAGGG - Intronic
1022293359 7:29024748-29024770 TCTTTTTCCTTCTTTTTTGAAGG - Intronic
1022379354 7:29845091-29845113 TTTTTTTTTTTCCTATTAGAAGG - Intronic
1022580636 7:31550117-31550139 CCTTTTTTTTTCCTTTTTCAAGG + Intronic
1022686841 7:32605048-32605070 TCTTTTTCTTATTTATTTGTAGG + Intergenic
1022721543 7:32945714-32945736 TCTATTTCTTTCCTGTTTCCTGG + Intergenic
1023326546 7:39065793-39065815 TCTTTCTTTTTCCTCTTGGAGGG - Intronic
1023326645 7:39067878-39067900 TTTTTTTCTAACCTATTAGATGG - Intronic
1023356148 7:39369358-39369380 TCTTTTTCTTTCTTTTTTTTTGG + Intronic
1023369652 7:39500207-39500229 TCTTTGTCTTTGGTATTTGCAGG - Intergenic
1023422684 7:39999749-39999771 AGTTTTTCTTTCCTCTTTTATGG + Intronic
1023469137 7:40494594-40494616 CCATTTTCTCTCCAATTTGATGG - Intronic
1023801749 7:43840788-43840810 TTTTTTTTTTTCTTTTTTGATGG + Intergenic
1024105696 7:46082926-46082948 TCTTTTTCTTTCTTTTCTGCAGG - Intergenic
1024170475 7:46779871-46779893 TATTTTCCCTTCATATTTGAAGG - Intergenic
1024661055 7:51495686-51495708 TATTTCTCTTTCATGTTTGAAGG + Intergenic
1025292619 7:57744377-57744399 TCTTTTTTTTTCCTTTGAGATGG - Intergenic
1025590118 7:62848391-62848413 TCTTTTTATTTTTTATCTGAAGG - Intergenic
1025756610 7:64350682-64350704 TTTTTTTTAATCCTATTTGATGG + Exonic
1025857073 7:65290591-65290613 TCTCTTTCTCTCTTTTTTGATGG + Intergenic
1026052204 7:66956681-66956703 TCTTTTTCTTTTTTTTTGGAGGG + Exonic
1026627720 7:72011145-72011167 TTTTTTTCTTTTTTTTTTGACGG - Intronic
1026647673 7:72186345-72186367 TCTTCTCCTTGCCTATCTGAGGG - Intronic
1026920439 7:74151668-74151690 TTTTTCTCTTTCCTTGTTGATGG - Intergenic
1027028764 7:74873588-74873610 TCTTTTTTTTTTCTTTTAGATGG - Intergenic
1027150968 7:75733429-75733451 TCTTTTTTTTTTTTTTTTGAGGG + Intronic
1027514323 7:79123285-79123307 TTTTTCTCTTTCTTTTTTGAAGG + Intronic
1028096001 7:86761778-86761800 TCTGTTCCTTCCCTATTTGAAGG + Intronic
1028284484 7:88979411-88979433 TATTTCTCTTTCATGTTTGAAGG + Intronic
1028406360 7:90478834-90478856 TTTTTTTTTTTACTATTTAAAGG + Intronic
1028430322 7:90738898-90738920 TTTTTTTTTTACTTATTTGATGG + Intronic
1028548777 7:92033389-92033411 TCTTCTTCTATCATATCTGAGGG - Intronic
1028612660 7:92729747-92729769 TCTTTTTCTTTTCTTTTTAGAGG + Intronic
1028623010 7:92845329-92845351 TTTTCTTCTTTCCTATCTGTGGG + Intergenic
1028628348 7:92903887-92903909 TCTTTTTATTCTTTATTTGAAGG + Intergenic
1028712642 7:93927163-93927185 TCTTTTTCTTACTGATTTGTAGG + Exonic
1028825653 7:95270456-95270478 TCATTTTTTTTCATATCTGAGGG + Intronic
1028841156 7:95431422-95431444 TTTTTTTCTTTTTTTTTTGAGGG + Intronic
1029009288 7:97241773-97241795 CTTTGTTCTTTCCTTTTTGATGG - Intergenic
1029271177 7:99377631-99377653 TCTTTTTTTTTTTTATTTGGAGG + Intronic
1029467605 7:100736206-100736228 TCTTTTTCTTTTCTTTGAGACGG + Intronic
1029823460 7:103166609-103166631 TCTTTTTATTTGCTATTGTAAGG - Intergenic
1030021404 7:105278679-105278701 TCTTTTTCTTTCCTTCTTCACGG - Intronic
1030219045 7:107078197-107078219 TCTTTTTTTTTTTTTTTTGATGG - Intronic
1030225356 7:107144452-107144474 TCCTTTTCTTTCTTTTTTGGAGG + Intronic
1030370277 7:108692365-108692387 TATTTCTCTTTCATGTTTGAAGG + Intergenic
1030393981 7:108962523-108962545 TCTTTTTCTTACTGATTTGTAGG - Intergenic
1030636070 7:111950467-111950489 TATGTTTCTTTCCTATTACATGG + Intronic
1030804911 7:113904595-113904617 TCTTTTAATTTTGTATTTGAGGG - Intronic
1030910624 7:115244571-115244593 TATTTTTCTTTAATTTTTGATGG + Intergenic
1030912399 7:115267162-115267184 TCTTTTTCTTTCTTTTTTTATGG + Intergenic
1031037268 7:116801305-116801327 TTTTTCTTTTTCATATTTGAGGG + Intergenic
1031335408 7:120524228-120524250 TTTTTTTCTTTTTTTTTTGACGG - Intronic
1031733341 7:125325632-125325654 GTTTTTCCTTTCTTATTTGATGG - Intergenic
1031736726 7:125373334-125373356 TCTTTTTCTTTTCTCCCTGATGG - Intergenic
1032358717 7:131234569-131234591 TTTTTCTCTTTCCTATTTCTTGG - Intronic
1032617334 7:133488425-133488447 TCTTTTTCCTTCCTCTGTGTGGG + Intronic
1032677812 7:134147734-134147756 TCCTTTTCTGTCCACTTTGAGGG - Intronic
1032859968 7:135867584-135867606 TCTTTTTTGTTCTTATATGAAGG + Intergenic
1033152566 7:138928270-138928292 TCTTTTTCTTTCTGATTTAAAGG + Intronic
1033525861 7:142212514-142212536 TCTTTTTACTTCCCATTTGATGG - Intronic
1033964281 7:146955424-146955446 TCTTTTTCACTCCTATTAGCAGG - Intronic
1034841146 7:154398546-154398568 TCTTTTTCCTTTCTATTTTATGG + Intronic
1034886194 7:154800793-154800815 TTTTTTTCTTGCCTTCTTGATGG + Intronic
1035138047 7:156727126-156727148 CCTTTTTCTAACCTATTGGAAGG - Intronic
1035415348 7:158679194-158679216 TCTTTTTCTTTTCTAACTTATGG - Intronic
1035753845 8:2016153-2016175 TATTTCTCCTTCATATTTGAAGG + Intergenic
1035943417 8:3930434-3930456 TGTTCTTCTTCCTTATTTGAAGG + Intronic
1035980601 8:4366253-4366275 TCTTTTTTTTTTCTGTTTTATGG + Intronic
1036142862 8:6224281-6224303 TTTTTTTTTTTCTTTTTTGATGG - Intergenic
1036465145 8:8990438-8990460 TCTTTTTCTTTTCTTTTTTTTGG + Intergenic
1036717287 8:11137709-11137731 TTTTCTTCTTTCCTATTTCAGGG - Intronic
1036932987 8:12974168-12974190 TCCTTTTCTTTTCTTTTTTAAGG - Intronic
1037031469 8:14111535-14111557 TGTTTTTCATTGCTATTTTAAGG + Intronic
1037238699 8:16752302-16752324 TCATTTTCTTGCCTAGCTGAAGG - Intergenic
1037361658 8:18080944-18080966 TCTTTCTCTATCCTATTTCTAGG + Intronic
1037385334 8:18333910-18333932 TATCTTTCCTTCCTGTTTGATGG - Intergenic
1037506193 8:19532007-19532029 AGTTTTTCTTTCCTATTCTAAGG + Intronic
1037864334 8:22430990-22431012 TCTTTTTTTTTTTTTTTTGATGG + Intronic
1038388260 8:27169864-27169886 TCTATTTCCTCCCTATTTGTAGG + Intergenic
1038557797 8:28539386-28539408 TGTTTTGCTGTCCTAGTTGAGGG + Intronic
1038700254 8:29843091-29843113 TCTTTTTCTTTTTTTTTTGAGGG - Intergenic
1038926412 8:32144969-32144991 TCTTTTCTTTTCCTCTTTGTTGG + Intronic
1038995311 8:32916560-32916582 TCTTTTTTTTTCTTTTTCGATGG + Intergenic
1038997020 8:32934864-32934886 CCTTTTCCTTCCCAATTTGAGGG + Intergenic
1039039459 8:33393702-33393724 TCTGGTCCTTTCCTATTTGCTGG - Intronic
1039137941 8:34347979-34348001 TCCTTTGATTTCATATTTGAAGG + Intergenic
1039217104 8:35284557-35284579 TTCTTTTCTTTTCTTTTTGACGG + Intronic
1039242388 8:35570952-35570974 TCTCTTTCTTTCTTTCTTGATGG - Intronic
1039242652 8:35573448-35573470 TCTTTTTCTTTCCTAAGAGATGG - Intronic
1039281698 8:35992922-35992944 TATTTCTCTTTCATGTTTGATGG + Intergenic
1039336410 8:36595516-36595538 TCTTTTTCTCTTCAGTTTGAAGG + Intergenic
1039373457 8:37010398-37010420 TTTTTTTTTTAGCTATTTGAGGG + Intergenic
1039420972 8:37440043-37440065 TATTTCTCCTTCATATTTGAAGG + Intergenic
1039621673 8:39002837-39002859 TCTTTTTCTTTTTTTTTAGACGG + Intronic
1039639032 8:39198945-39198967 TATTTCTCTTTCATTTTTGAAGG + Intronic
1039731333 8:40282032-40282054 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1039781164 8:40787453-40787475 TCTTTTTCTTCACAATTTCATGG + Intronic
1039812146 8:41058577-41058599 TCTCTTTCTTTCTTTTTTGACGG - Intergenic
1039961762 8:42253958-42253980 TGTTCTTCTTCCTTATTTGAAGG - Intergenic
1040588614 8:48767708-48767730 TCTTTTCCTCTCCTATTTTCTGG - Intergenic
1040684904 8:49860262-49860284 CCTTCTCCTTTCCTATTTTAGGG - Intergenic
1040687516 8:49892903-49892925 TATGTTTCTTTCCTATTTTATGG - Intergenic
1040703126 8:50091825-50091847 TTTTTTTTTCTCCTATTTGATGG + Intronic
1040787023 8:51178292-51178314 TTTCTTTCTTTCTTTTTTGAAGG + Intergenic
1040919472 8:52600187-52600209 TTTTTTTTTTTCCTTTTGGAAGG + Intergenic
1041212095 8:55562496-55562518 TGTTTTTCCTTCATTTTTGAAGG + Intergenic
1041316168 8:56564749-56564771 TATTTTTTTTTCTTTTTTGACGG - Intergenic
1041732538 8:61077076-61077098 TCTTTATCTTTTTTTTTTGACGG + Intronic
1041761468 8:61371344-61371366 TCTTTTTCTTGCTTATTTGTTGG + Intronic
1041859072 8:62490764-62490786 CCTTATTCTTTCCTGTATGAAGG - Intronic
1041869074 8:62613252-62613274 TATTTTTCCTTCATGTTTGAAGG + Intronic
1041985713 8:63920449-63920471 TCTTTTTCTTTCTTTTTTTGGGG - Intergenic
1042078470 8:65022228-65022250 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1042438410 8:68795330-68795352 TTTTTTTTTTTCCTATTTATGGG + Intronic
1042459038 8:69040788-69040810 TCTTCTGCTTTGTTATTTGAAGG - Intergenic
1042470449 8:69181632-69181654 TCATTTTCTTTTCATTTTGATGG + Intergenic
1042796269 8:72666631-72666653 ACTTTTTATTTTTTATTTGAAGG - Intronic
1042934393 8:74044188-74044210 TCTTTTTCTTTTTTTTTTTAGGG + Intergenic
1043033062 8:75163276-75163298 TCTCTTTCCTTCATATTTGAAGG + Intergenic
1043144887 8:76640763-76640785 GTTTTTTCTTTCACATTTGAAGG - Intergenic
1043227234 8:77747846-77747868 TATTTCTCTTTCATGTTTGAAGG - Intergenic
1043464998 8:80496368-80496390 TCTTTTTTTTTTTTTTTTGAAGG + Intronic
1043770700 8:84196190-84196212 TCTTTTTATTTCATAATTGCTGG + Intronic
1043789104 8:84440744-84440766 TTTTATTCATTCCTGTTTGAGGG + Intronic
1043831964 8:84999988-85000010 TTTTTTTCTTGCCAATTTGGAGG + Intergenic
1044299852 8:90571101-90571123 TTTTTTTCTTTTCTTTTTGAGGG - Intergenic
1044584586 8:93857708-93857730 TGAGTTTCTTTCCTCTTTGAGGG + Intergenic
1044787826 8:95814254-95814276 TTTTTTTCTTGCTTATTTGTTGG + Intergenic
1044913380 8:97086016-97086038 TTTTGTTTTTTCCCATTTGAAGG - Intronic
1045015159 8:97995015-97995037 TCTTCTTCTTTCCTATCAAAGGG - Intronic
1045170261 8:99658333-99658355 TCTTTTTCTTACTGATTTGTAGG - Intronic
1045207644 8:100058654-100058676 TATTTCTCCTTCATATTTGAAGG - Intronic
1045482469 8:102602975-102602997 TCTTTTTTTTTCCTTTGAGATGG - Intergenic
1045594889 8:103642655-103642677 TCTTTCTCTTTCACTTTTGAAGG + Intronic
1045853658 8:106735654-106735676 TATTTTTCTTTCTTTTTTCATGG - Intronic
1045904583 8:107328453-107328475 TCTTTTTTTTTCTTAGTTGCTGG - Intronic
1045912017 8:107421542-107421564 TCTTTTCCTTTCCTAGCTCAGGG - Intronic
1045964328 8:108006482-108006504 TCTTTTCCTTTTCACTTTGAAGG - Intronic
1045982920 8:108212803-108212825 TCTTTTTCTTTCTTTTTTTGGGG - Intronic
1045997750 8:108383207-108383229 TCTTTTTTTTTCATATTTTGAGG + Intronic
1046111619 8:109732589-109732611 TCTGTTTTCTTCCTATTTCATGG + Intergenic
1046246558 8:111570597-111570619 TCTTTTTCTTTCATGTTTTTTGG + Intergenic
1046346137 8:112930023-112930045 TATTTTACTTTTTTATTTGAAGG - Intronic
1046360939 8:113154780-113154802 TGTATGTCTTTCCCATTTGATGG + Intronic
1046378664 8:113422270-113422292 TTTTCTTCCTTCCTCTTTGAAGG - Intronic
1046504647 8:115121949-115121971 ACATTTTCTCTCCTATTTAATGG + Intergenic
1046615268 8:116470546-116470568 TGTTTTTCTGTCTTATTTTATGG - Intergenic
1046883904 8:119341198-119341220 TCTGTTTCCTTCCCTTTTGAGGG - Intergenic
1047116499 8:121847822-121847844 TCTTTCTCTTTACTTTTTGTAGG - Intergenic
1047325516 8:123832124-123832146 ACATTTTGTTTCCTACTTGAGGG + Intergenic
1047532444 8:125689327-125689349 TCTTTTTCTTTTTTTTTTGATGG + Intergenic
1047990891 8:130285308-130285330 TTTTTTTCTTTCCAACTTGGTGG - Intronic
1048012163 8:130466667-130466689 TCTTTGTTTTTTCTTTTTGATGG + Intergenic
1048137350 8:131759364-131759386 TTTTCTTCTTTTCTATTTCATGG - Intergenic
1048557227 8:135491405-135491427 TTTTTTTCTTTCCTTTTTTTTGG - Intronic
1048983656 8:139717210-139717232 TCTCTTTCTCTCATTTTTGATGG - Intergenic
1049870535 8:144971793-144971815 TCTTTTTTTTTTTTTTTTGAGGG + Intergenic
1050042764 9:1513316-1513338 TCTAATTCTTACCTATTTGGTGG - Intergenic
1050219723 9:3373547-3373569 TCTTTGACTTTCTTATTTTAAGG - Intronic
1050238636 9:3611194-3611216 TTTTTCTCCTTCATATTTGATGG + Intergenic
1050298347 9:4230242-4230264 TCTGTTTCTTTCTTAGTTGGTGG - Intronic
1050369624 9:4907508-4907530 TTTTTTTCTTTCTTATTTATAGG + Intergenic
1050436446 9:5615375-5615397 CTTTTTTCTTTCTTTTTTGAAGG - Intergenic
1050705940 9:8397518-8397540 TCTTTTTCTTTTCTTTTTTTGGG - Intronic
1050805697 9:9674902-9674924 TCTTTTTGTTCACCATTTGAGGG - Intronic
1050831557 9:10020305-10020327 TCTTTTTCTTTTTTCTTTGACGG + Intronic
1050831654 9:10021429-10021451 TCTTTTTCTTTTTTCTTTGACGG + Intronic
1050889134 9:10801763-10801785 TATCTATCTTTCCTTTTTGAAGG + Intergenic
1051405392 9:16732153-16732175 TCTTTTTCTTTTTTTTTTGCAGG - Intronic
1051667541 9:19479692-19479714 TCTTTTTCTTACAGATTTGTGGG + Intergenic
1051736034 9:20200064-20200086 TATTTTTGTTTCTTATTTGAAGG - Intergenic
1051793993 9:20843335-20843357 ATTTTCTCTTTCGTATTTGAAGG + Intronic
1051981422 9:23024078-23024100 TCTCTCTCTCTCCAATTTGAGGG + Intergenic
1052198847 9:25752644-25752666 TGTTTTTCTTTCGTATTTACTGG - Intergenic
1052258561 9:26488756-26488778 TATTTCTCTTTCATGTTTGAAGG + Intergenic
1052308769 9:27041095-27041117 ATTTCTTCTTTCCTACTTGAGGG + Intronic
1052396248 9:27941704-27941726 TCTTTACCTTTCGTACTTGAGGG - Intergenic
1052439433 9:28476029-28476051 TCTTTTCATTTCCTATTTTTTGG - Intronic
1052573275 9:30257377-30257399 TCTTATTATTGCTTATTTGATGG + Intergenic
1052581722 9:30364872-30364894 TATTTTTATTTCTTATTTCAGGG + Intergenic
1052639670 9:31150684-31150706 TCTTTTTCGTTTGTTTTTGAAGG - Intergenic
1052664623 9:31478757-31478779 AATTTTTCTTTCATTTTTGATGG - Intergenic
1052781653 9:32787207-32787229 TCTGTCTCTTTCCAAATTGAGGG + Exonic
1052908981 9:33863184-33863206 TCTTTTTTTTTTTTTTTTGAGGG - Intronic
1053401065 9:37822964-37822986 TCTTTTTCTTTCTTTTTATAAGG - Intronic
1053709748 9:40794269-40794291 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
1054419652 9:64915063-64915085 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
1054433294 9:65188755-65188777 TCTTTTTTTTTTTTTTTTGAGGG - Intergenic
1054819314 9:69506012-69506034 TCTTTTTCTTTTTTTTTAGATGG - Intronic
1054884969 9:70186380-70186402 TCTTTTTCCTTTACATTTGAAGG + Intronic
1054982787 9:71225387-71225409 TATTTTTCCTTCATGTTTGAAGG - Intronic
1054993291 9:71355118-71355140 TCTTTTTCCTTCCAATCTCATGG + Intronic
1055051776 9:71988717-71988739 TCTTTTCTTTTCTTTTTTGATGG + Intergenic
1055165533 9:73186914-73186936 TATTTGTCTTTCATTTTTGAAGG - Intergenic
1055718218 9:79141935-79141957 TCTTTTTTTTTCTTTTTAGATGG - Intergenic
1056373142 9:85979398-85979420 TGTTCTTCTTTCTTATTTGAAGG - Intronic
1056588630 9:87946167-87946189 TTTTTCTCTTTTCTATTTCATGG + Intergenic
1056681222 9:88720878-88720900 TCTTTTTTTTTTTTTTTTGAGGG - Intergenic
1056716068 9:89030683-89030705 TCTTTTTATTACCTGTTTGTTGG + Intronic
1056756564 9:89385558-89385580 TCTTTTCCTTTCAGATCTGAGGG + Intronic
1056957562 9:91094644-91094666 TATTTTTCCTTCATGTTTGAAGG - Intergenic
1056970849 9:91201086-91201108 AATTTTTCTTTCATTTTTGAAGG - Intergenic
1057028572 9:91756101-91756123 TCTTTTTGTTTCCTCTTTTTAGG - Exonic
1057032617 9:91787656-91787678 TCTTTTTGTTTTTTATTTGATGG - Intronic
1057105970 9:92417563-92417585 TTTTTTTTTTTCCTATTGCAAGG + Exonic
1057126875 9:92623545-92623567 TCTTTTTCTTATTGATTTGAAGG - Intronic
1057241205 9:93411209-93411231 TATTTTTCCTTCATATTTGAAGG - Intergenic
1057337263 9:94166016-94166038 TCTCCTTCTTTCCTAGTGGAGGG - Intergenic
1057613735 9:96569627-96569649 TCTTCTTTTTTTCTTTTTGATGG + Intronic
1057614670 9:96578821-96578843 TCTTTTTCTTTTCTTTGAGACGG + Intronic
1057729433 9:97596065-97596087 TCTTCTTCTTTTTTTTTTGATGG - Intronic
1057987360 9:99730804-99730826 TCTCTTTCTTTCTTTTTTAAAGG - Intergenic
1058016509 9:100038016-100038038 TATTTCTCTTTCATATTTGAAGG - Intronic
1058258674 9:102802781-102802803 TCTTTTTTTTTTTTTTTTGAGGG + Intergenic
1058298116 9:103334626-103334648 TATTTTTCTTTCACTTTTGAAGG + Intergenic
1058302093 9:103388562-103388584 TTTTTTTCTTTCTTATTTCTTGG + Intergenic
1058306747 9:103452900-103452922 TCTTTTTCTTTTCTATGAAATGG - Intergenic
1058353925 9:104059840-104059862 TCTCTTTCTTTCTTTCTTGATGG - Intergenic
1058375276 9:104315950-104315972 TCTTTATCTTTCCTAGTCCATGG + Intergenic
1058601451 9:106675079-106675101 TCTTTTTCTTTGCAAATGGAAGG - Intergenic
1058648180 9:107150162-107150184 TTTTTTTCTTTTCAGTTTGAGGG - Intergenic
1058830389 9:108811305-108811327 ACTTTTTTTTTTCTCTTTGATGG + Intergenic
1059205332 9:112458980-112459002 TCTTTTTCTTTTCTTTTTTTTGG - Intronic
1059225544 9:112669846-112669868 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
1059266441 9:113036495-113036517 TTTGTTTCTTTCCTATAAGAAGG + Intergenic
1059586285 9:115610685-115610707 TCTTTTTCTTATCTACTTCATGG - Intergenic
1059731447 9:117060888-117060910 TCTTTTCCCTTTCTTTTTGACGG - Intronic
1059829759 9:118082404-118082426 TCTTTTTCTTTTTTTTTAGACGG + Intergenic
1059900397 9:118919421-118919443 TCTTTCTCCTTCATGTTTGAAGG + Intergenic
1060670508 9:125465397-125465419 TCTGTTTCTTTATTATTTAAAGG - Intronic
1060721291 9:125980884-125980906 TTTTTTTCTTTCTTCTTAGATGG - Intergenic
1061088241 9:128411808-128411830 CCCTCATCTTTCCTATTTGAGGG - Intronic
1061350854 9:130063809-130063831 TCTTTTTTTTTTTTTTTTGAGGG + Intronic
1061870140 9:133516057-133516079 TCGTTTGCTTTCCTAGTTAAAGG + Intronic
1061964937 9:134007989-134008011 TTTTTTTCTTTTCTTTTTTAGGG - Intergenic
1062143562 9:134974958-134974980 TATTTTTCTTTCTCATTTGGTGG - Intergenic
1062301317 9:135872455-135872477 TCTTTTTCTTCCCTCTTTTAAGG - Intronic
1185667786 X:1781034-1781056 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1185802528 X:3026848-3026870 TCTTTTTCTTTTTTATTTTTTGG + Intronic
1185813200 X:3129663-3129685 TTTTGTTCTTTCCTTTTTTAGGG + Intergenic
1185890610 X:3818656-3818678 TCTTTTTCTTCTCTATTTTCAGG - Intronic
1185894610 X:3846453-3846475 TCTTTTCCTTTTTTTTTTGATGG + Intergenic
1185899728 X:3884877-3884899 TCTTTTCCTTTTTTTTTTGATGG + Intergenic
1185904844 X:3923306-3923328 TCTTTTCCTTTTTTTTTTGATGG + Intergenic
1186296094 X:8150149-8150171 TCTTTTTCTTTTATTTTTGAAGG - Intergenic
1186911429 X:14172112-14172134 TATTTCTCCTTCATATTTGATGG + Intergenic
1187012547 X:15294677-15294699 TCTTTAACTTTCCAATTTAATGG - Intronic
1187077762 X:15952632-15952654 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
1187177929 X:16913552-16913574 TTTCTTTCTTTCCTTTTTGATGG + Intergenic
1187332367 X:18353124-18353146 TTTTTTTTTTTTCTATTTAATGG - Intronic
1187601135 X:20831731-20831753 TGTTTGTCCTTCCTATTTGATGG + Intergenic
1188068599 X:25692965-25692987 TATTTTTCCTTCATGTTTGAAGG + Intergenic
1188079764 X:25822591-25822613 TATGTTTATTTCCTATTTGTAGG - Intergenic
1188171167 X:26928794-26928816 TTTTTATCTTTACTATTTGTTGG + Intergenic
1188212657 X:27443312-27443334 TTGTTTTTTTTCCTTTTTGAAGG - Intergenic
1188279253 X:28243588-28243610 TATTTTTTTTTTCTTTTTGAGGG + Intergenic
1188668454 X:32853126-32853148 TCTTTATCTTTCTTGTTGGAAGG - Intronic
1188733846 X:33687166-33687188 TATTTATCTTTCATATTTGAAGG + Intergenic
1188734329 X:33693851-33693873 TCTACTTCTTTCCAGTTTGAAGG + Intergenic
1188774203 X:34192808-34192830 TATTTTTCCTTCATGTTTGAAGG + Intergenic
1188972125 X:36631006-36631028 TATTTCTCTTTTATATTTGAAGG + Intergenic
1188996294 X:36889597-36889619 TACTTTTCCTTCATATTTGAAGG - Intergenic
1188998895 X:36921726-36921748 TATTTTCCCTTCCTATTTGAAGG + Intergenic
1189666927 X:43365845-43365867 TCTTTTTCTTTCCTGATCAAAGG + Intergenic
1189741304 X:44119678-44119700 TCATTTTGTTCCCTATTTAATGG + Intergenic
1189803794 X:44715934-44715956 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1189964749 X:46361329-46361351 TATTTTTCCTTCATGTTTGAAGG + Intergenic
1190071901 X:47286552-47286574 TCTTTTTCTAACATATTGGACGG + Intergenic
1190082449 X:47367156-47367178 TTTCTTTCTTTCTTTTTTGACGG + Intergenic
1190177697 X:48165155-48165177 TCTTTTTCTTTTGTTTTTCAAGG + Intergenic
1190209252 X:48431778-48431800 ACTTTTTTTTTCATTTTTGACGG + Intergenic
1190374125 X:49772895-49772917 TATTTTTCTTTCATAGTTGATGG + Intergenic
1190398678 X:50010243-50010265 TTCTTTTCTTTCTTTTTTGATGG + Intronic
1190507721 X:51144025-51144047 CATTTCTCTTTCATATTTGAAGG + Intergenic
1190538411 X:51452740-51452762 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1190565173 X:51723174-51723196 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1190614798 X:52219216-52219238 TATTTTTCTTTCATGTTTGAAGG - Intergenic
1190616809 X:52242459-52242481 TCTTTTTCTTTTCTTTGAGACGG - Intergenic
1190880272 X:54486984-54487006 TCTTTGTTTTTGCTTTTTGACGG - Intronic
1190949198 X:55125898-55125920 TCATTTTCTTTCCTTTTCTAGGG + Intronic
1191225775 X:58041222-58041244 TTTTTTTAAATCCTATTTGATGG - Intergenic
1191600790 X:63003138-63003160 TGTATTTCTTTTATATTTGACGG + Intergenic
1191703939 X:64072779-64072801 TATTTCTCCTTCATATTTGAAGG - Intergenic
1191751859 X:64551287-64551309 TCTTTTTCTTTTCCTTTTTAGGG - Intergenic
1192055856 X:67772016-67772038 TTTTTTTTTTTTTTATTTGAAGG - Intergenic
1192088230 X:68123236-68123258 TATTTTTCCTTCATGTTTGAAGG - Intronic
1192088270 X:68124212-68124234 TATTTCTCTTTCATGTTTGAAGG + Intronic
1192127488 X:68515545-68515567 TCTGTATCTGTCCTATTGGAAGG + Intronic
1192406247 X:70888991-70889013 TCTTTCTCCTTCACATTTGAAGG - Intronic
1192460762 X:71315148-71315170 TTTTTTTCTTTCTTCTTTGGAGG + Intergenic
1192494984 X:71610259-71610281 TCTTTTTCCTTTTTATTAGAGGG + Intronic
1192536156 X:71929747-71929769 TCTTTTTTTTTTCTTTTTGGCGG + Intergenic
1192556963 X:72097922-72097944 TTTTTTTCTTTCCTGGTTCAAGG - Intergenic
1192633852 X:72800007-72800029 TCTTTTTCTTTCTTTTTTGCTGG + Intronic
1192647858 X:72920794-72920816 TCTTTTTCTTTCTTTTTTGCTGG - Intronic
1192659303 X:73025430-73025452 TCTTTGTCTTTGATTTTTGATGG + Intergenic
1192668473 X:73113203-73113225 TTTTTTTTTTTCCTTTTTCAAGG - Intergenic
1193064079 X:77239050-77239072 TCTTTTTCTTTACTAATTTGGGG - Intergenic
1193147130 X:78088847-78088869 TCTTTTTCTTTTCTTTTAGATGG + Intronic
1193218069 X:78887975-78887997 TTTTTTTTTTTCCAAATTGAAGG + Intergenic
1193552931 X:82921294-82921316 TCTTTTCCTTTCATTTTTGTGGG + Intergenic
1193558222 X:82983174-82983196 TGTTTGTCTTTCCTATTTTTTGG - Intergenic
1193629577 X:83866247-83866269 TCTTTTATTTTCCCATTTTATGG - Intronic
1193665613 X:84311883-84311905 TATTTTTCCTTCATATCTGAAGG - Intergenic
1193721135 X:84989250-84989272 TCTTATTGTGTCCTATTGGATGG + Intergenic
1193903887 X:87219231-87219253 TCTGTTTATTTCCTACTTCATGG - Intergenic
1193923126 X:87453952-87453974 CAATTTTCTTTCCTTTTTGAGGG - Intergenic
1193925908 X:87484221-87484243 AGTCTTTCTTTCCTATTTGGTGG - Intergenic
1193970927 X:88051590-88051612 TTTTTTTCTTTTCTACCTGAAGG - Intergenic
1194042969 X:88964884-88964906 TCTTTCTGTTTCCTAATTGTTGG + Intergenic
1194253405 X:91605398-91605420 TATTTCTCTTTCATGTTTGAAGG - Intergenic
1194458914 X:94141213-94141235 TTTTTTTCTTTCCTAGTTCTTGG - Intergenic
1194532672 X:95070449-95070471 TCTCTTTATTTCCTCTTTAAGGG - Intergenic
1194637991 X:96368881-96368903 TCTTTTTTTTTTCTTTTAGACGG - Intergenic
1194863518 X:99035604-99035626 TCTTTTTATTTGCCATTTAATGG - Intergenic
1195036965 X:100979360-100979382 TATTTCTCTTTCATGTTTGAAGG + Intronic
1195110482 X:101643141-101643163 TCTTTTTCTTTTGGATTTGCAGG + Intergenic
1195302786 X:103547911-103547933 TTTTTTTTTTTCCTATTGCATGG - Intergenic
1195559240 X:106264512-106264534 TATTTCTCCTTCATATTTGAAGG + Intergenic
1195834691 X:109101161-109101183 TATTTCTCATTCATATTTGAAGG + Intergenic
1196000908 X:110784705-110784727 TATTTTACTTTCCTATTAGCAGG + Intronic
1196126560 X:112107740-112107762 TCTTTGTCTTTGATTTTTGATGG + Intergenic
1196247576 X:113417535-113417557 TATTTCTCTTTCATGTTTGAAGG - Intergenic
1196248625 X:113430544-113430566 TATTTCTCTTTCATGTTTGAAGG - Intergenic
1196298489 X:114027283-114027305 TCTTTTTGTCTCCTATGTCATGG - Intergenic
1196352135 X:114744455-114744477 TCTTTTTTTTTTTTTTTTGACGG + Intronic
1196458976 X:115910477-115910499 TTTTTTTCTTTCATTTTTGCTGG - Intergenic
1196538766 X:116880874-116880896 TATTTCTCCTTCATATTTGAAGG + Intergenic
1196609763 X:117697636-117697658 TATTTCTCTTTCATGTTTGAAGG - Intergenic
1196614863 X:117756493-117756515 TCTTTCTTTTTCCTAATAGAAGG - Intergenic
1196672270 X:118381575-118381597 TCTTTTTTTTTTTTTTTTGATGG + Intronic
1196732981 X:118959910-118959932 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1196982171 X:121227112-121227134 TTTTTTTTTTTTCTTTTTGATGG + Intergenic
1197382583 X:125763833-125763855 TATTGTTCCTTCCTGTTTGAAGG + Intergenic
1197520691 X:127492417-127492439 TGTTATTCTTTCCTTTTTCAAGG + Intergenic
1197554652 X:127938368-127938390 CCTTTTTCTTTTTTTTTTGAGGG + Intergenic
1197599525 X:128511151-128511173 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1197626149 X:128804404-128804426 TCTTTTTTTTTTTTTTTTGACGG - Intergenic
1197671908 X:129286094-129286116 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1197947270 X:131852806-131852828 CCATTTTCTTTTCTATTTTATGG - Intergenic
1197950732 X:131893608-131893630 TTTTTTTCTTTCATGTTTGTTGG - Intergenic
1198206590 X:134471640-134471662 TCTTTTTCTTTTTTATTTTGAGG + Intronic
1198391176 X:136176069-136176091 TCTCTTTCTTCCGTATTTGGTGG + Intronic
1198469106 X:136929648-136929670 TCGCTTTCTTTTCTTTTTGACGG + Intergenic
1198607937 X:138364406-138364428 TGTTATTTTTTCCTATTTTATGG - Intergenic
1198723334 X:139648380-139648402 TCTTTTTCTTTCTTTTTGGGGGG - Intronic
1198794093 X:140377426-140377448 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1199216764 X:145267977-145267999 TTTTTTTTTTTGCTATTTGTTGG - Intergenic
1199274941 X:145929758-145929780 TCTTTTTTTTTTTTTTTTGACGG + Intergenic
1199296271 X:146162250-146162272 TTTTTTTCTTTCCTTTCTGTAGG - Intergenic
1199299633 X:146197781-146197803 CCTTTTCCTTTCCTTTTGGAGGG - Intergenic
1199304125 X:146246949-146246971 TCTTTCTCCTTCATGTTTGAAGG - Intergenic
1199317040 X:146393136-146393158 TATTTGTCTTTCATATTTGAAGG + Intergenic
1199459481 X:148069067-148069089 TCTTTTTTTTTTTTTTTTGATGG + Intergenic
1199468068 X:148162438-148162460 TTTTTTTTTTTGTTATTTGAGGG + Intergenic
1199730635 X:150628849-150628871 TATTTTTCTTTTCTTTTAGATGG + Intronic
1199734359 X:150670574-150670596 TATTCTTTTTTCCAATTTGAGGG - Intronic
1199882834 X:151988512-151988534 TCTTTATCTTGCCAGTTTGATGG - Intergenic
1200340060 X:155386870-155386892 TCATGTTATTTGCTATTTGATGG + Intergenic
1200711518 Y:6488807-6488829 TCTGTTTCTTTCCTGTCTGTTGG - Intergenic
1200937857 Y:8753932-8753954 GCTTTTTTTTTCTTTTTTGAAGG + Intergenic
1201022414 Y:9673180-9673202 TCTGTTTCTTTCCTGTCTGTTGG + Intergenic
1201220878 Y:11769323-11769345 TCTTTTTCTTTTGTTTTTGATGG + Intergenic
1201360712 Y:13145403-13145425 TCTTTCTCTTTTATTTTTGAAGG - Intergenic
1201410072 Y:13690801-13690823 TCCTTTGATTTTCTATTTGAGGG - Intergenic
1201518900 Y:14850743-14850765 TTTTTTTGTTTCCTTTTTTAGGG + Intergenic
1201894678 Y:18980944-18980966 TCTTTTTTTTTTTTTTTTGATGG - Intergenic
1201898053 Y:19015334-19015356 TTTTTTTTTTTCCTTTTTTAGGG + Intergenic
1202052981 Y:20799718-20799740 TCTTTTTCTTTTATATTTTTAGG + Intergenic
1202234076 Y:22690108-22690130 TCTTTTTGTTTGTTTTTTGATGG + Intergenic
1202271633 Y:23079481-23079503 TCTTTTTCTCTCCTTCTTGCTGG + Intergenic
1202294393 Y:23341201-23341223 TCTTTTTCTCTCCTTCTTGCTGG - Intergenic
1202309080 Y:23506050-23506072 TCTTTTTGTTTGTTTTTTGATGG - Intergenic
1202345766 Y:23924082-23924104 TCTTTGTCTTTGATATTTGGTGG - Intergenic
1202352370 Y:24007805-24007827 TTTTTTTTTTTTCTTTTTGATGG - Intergenic
1202424630 Y:24713225-24713247 TCTTTTTCTCTCCTTCTTGCTGG + Intergenic
1202446159 Y:24956860-24956882 TCTTTTTCTCTCCTTCTTGCTGG - Intergenic
1202518409 Y:25662310-25662332 TTTTTTTTTTTTCTTTTTGATGG + Intergenic
1202525005 Y:25746008-25746030 TCTTTGTCTTTGATATTTGGTGG + Intergenic
1202561721 Y:26164542-26164564 TCTTTTTGTTTGTTTTTTGATGG + Intergenic
1202581591 Y:26387385-26387407 TCTATTTCTTTTCTTATTGATGG - Intergenic